Tulip transcription factor TgTCP2 for regulating and controlling sugar transport, growth and development of plants and application of tulip transcription factor TgTCP2

Abstract

The invention belongs to the technical field of plant genetic engineering, and relates to a tulip transcription factor TgTCP2 for regulating and controlling sugar transport and growth and development of plants and application of the tulip transcription factor TgTCP2, the plant growth and development traits comprise at least one of seedball size, crown breadth size, rosette leaf number and plant height, the nucleotide sequence of the TgTCP2 gene is shown as SEQ ID NO: 1, and the nucleotide sequence of the TgTCP2 gene is shown as SEQ ID NO: 2. Or the corresponding amino acid sequence is as shown in SEQ ID NO: 2. The result shows that the overexpression TgTCP2 promotes the growth and development of arabidopsis thaliana, which is mainly reflected in the increase of crown breadth, the increase of rosette leaf number and the increase of plant height; a VIGS technology is utilized to silence TgTCP2, and it is found that tulip seedball development is inhibited by silence of the gene, the sugar content in tulip seedballs is reduced, and it is indicated that TgTCP2 has the effect of regulating tulip seedball development and sugar transport. Application of the gene has important practical significance on regulation and control of plant sugar transport and growth and development.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a tulip transcription factor TgTCP2 for regulating plant sugar transport and growth and development, and an application thereof. Background Art

[0002] Tulips (Tulipa neriana L.) are autumn-planted bulbs of the genus Tulipa in the Liliaceae family. They are widely used in flower fields, flower mirrors, and flower shows in my country and are deeply loved by people. Seed propagation and bulb propagation are the main methods of tulip propagation, with bulb propagation being the most important in the flower industry. The tulip bulb consists of fleshy scales that surround the base of the bulb, with the flower bud in the center and axillary buds nestled between the scales. Tulips primarily propagate vegetatively through bulb renewal, and annual multiplication occurs through the outward growth of axillary buds. Eventually, the axillary buds develop into daughter bulbs. Therefore, the branching (which determines the number of daughter bulbs) and development (which determines the size of the daughter bulbs) of the axillary buds are extremely important for tulip reproduction. In principle, each mature tulip bulb has the capacity to produce the same number of daughter bulbs as its axillary buds. However, in reality, only a few axillary buds have the ability to expand into daughter bulbs and continue production the following year. This results in the degeneration of tulip bulbs (bulbs).

[0003] Carbohydrates are essential for the growth and energy metabolism of bulbous plants. Their efficient accumulation and distribution directly determine the development of storage organs, such as tulip bulbs. Sucrose, as the primary carbon source and transporter, not only provides energy for the daughter bulbs but also promotes bulb expansion by regulating gene expression and signal transduction. Efficient transport of sucrose from source leaves to sink organs (bulbs) is a key factor in determining bulb yield and reproductive efficiency.

[0004] Currently, carbohydrate research has largely focused on the physiological level, and the molecular mechanisms remain unclear. Elucidating the molecular mechanisms of sucrose transport and identifying key regulatory genes could provide a theoretical basis for optimizing tulip breeding and cultivation techniques, and have significant implications for improving bulb yield and quality, and for the sustainable development of the industry. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a tulip transcription factor TgTCP2 for regulating plant sugar transport and growth and development and its application.

[0006] The present invention is achieved through the following technical solutions:

[0007] In one aspect, the present invention provides a tulip transcription factor TgTCP2, the nucleotide sequence of the tulip transcription factor TgTCP2 is shown in SEQ ID NO: 1, or the protein sequence encoded by the gene is shown in SEQ ID NO: 2.

[0008] Another aspect of the present invention provides a tulip transcription factor TgTCP2 for regulating plant sugar transport and growth and development and its application

[0009] Furthermore, the plant growth and development traits include: at least one of bulb size, plant growth rate, number of rosette leaves and plant height.

[0010] Furthermore, the application includes the following steps: constructing a TgTCP2 overexpression vector, transforming wild-type plants, and screening to obtain transgenic plants with enhanced TgTCP2 expression.

[0011] Furthermore, the application includes the following steps: constructing a silent expression vector for TgTCP2, transforming wild-type plants, and screening to obtain transgenic plants with reduced TgTCP2 expression.

[0012] Furthermore, constructing the TgTCP2 overexpression vector includes the following steps: amplifying the TgTCP2 gene using the primer pair shown in SEQ ID NO.3-4, and connecting the amplified TgTCP2 gene to the plant expression vector pCAMBIA1305 to obtain the TgTCP2 overexpression vector pCAMBIA1305-TgTCP2.

[0013] Furthermore, the overexpression vector pCAMBIA1305-TgTCP2 is introduced into wild-type plants through Agrobacterium-mediated inflorescence infection, and transgenic positive strains are obtained through infection, screening, identification, etc.

[0014] Furthermore, constructing the TgTCP2 silencing expression vector includes the following steps: amplifying the TgTCP2 gene using the primer pair shown in SEQ ID NO.3-4, and connecting the amplified TgTCP2 gene to the plant expression vector pTRV2 to obtain the TgTCP2 silencing expression vector pTRV2-TgTCP2.

[0015] Furthermore, the silencing expression vector pTRV2-TgTCP2 is introduced into wild-type plants through Agrobacterium-mediated inflorescence infection, and transgenic positive strains are obtained through infection, screening, identification, etc.

[0016] Furthermore, the plant is Arabidopsis thaliana or tulip.

[0017] The present invention also provides the use of the tulip transcription factor TgTCP2 in regulating plant sugar transport.

[0018] The present invention has the following beneficial effects compared to the prior art:

[0019] The present invention proposes for the first time the key gene TgTCP2 that regulates plant sugar transport and growth and development. TgTCP2 was introduced into Arabidopsis thaliana through Agrobacterium-mediated inflorescence infection and overexpressed. Compared with wild-type Arabidopsis plants, the transgenic plants showed significantly increased plant size, rosette leaf number, and plant height, playing a key role in promoting plant growth and development. In addition, the expression of TgTCP2 was silenced in tulips. The results showed that the bulbs of the transgenic plants were smaller and the amount of sugar transport was reduced, indicating that this gene is involved in regulating tulip bulb development. The discovery of the function of this gene provides key evidence for analyzing plant growth and development, and also provides a new approach and effective means for improving plant growth and development and bulb development of bulb plants through genetic engineering breeding, which has important theoretical significance and application potential. In addition, this gene is involved in the plant's sucrose transport process, which is of great significance in the regulation of plant carbohydrate transport to storage organs, and is expected to be applied to the fields of regulating tulip bulb development and increasing bulb yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the domain distribution map of the tulip transcription factor TgTCP2 protein;

[0021] Figure 2 This is the subcellular localization map of the transcription factor TgTCP2;

[0022] Figure 3 Figures 4 and 5 show the phenotypic results of transgenic Arabidopsis plants overexpressing the TgTCP2 gene. Figure A shows the plant size at week 4, Figure B shows the number of rosette leaves at week 4, Figure C shows the plant height at week 4, and Figure D shows the branching at week 4. Figures E and E show the statistical data of plant size, number of rosette leaves, and plant height, respectively.

[0023] Figure 4 Figure 1 shows the results of bulb development measurements of transgenic tulips with TgTCP2 gene silenced. Figure A shows bulb sizes on days 0, 30, and 90; Figure B shows a statistical graph of bulb size; and Figure C shows a statistical graph of bulb fresh weight.

[0024] Figure 5 Figure 3 shows the results of measuring the sugar transport capacity of transgenic tulips with silenced TgTCP2 genes. Figure A shows the injection of 1 mg / mL CFDA fluorescent dye into the base of tulip leaves. Figures BC show the fluorescence intensity of tulip leaves and bulbs 3-4 days after injection of CFDA fluorescent dye. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0026] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0027] For a better understanding of the present invention and not to limit the scope of the present invention, all numbers used in the present invention to express amounts, percentages and other numerical values ​​should be understood as modified by the word "approximately" in all cases. The term "approximately" has its usual meaning, used to indicate that a value includes the inherent variation of the error of the device or method used to determine the value, or includes a value close to the value, for example, within 10% of the value (or range of values). Therefore, unless otherwise indicated, the numerical parameters listed in the specification and the appended claims are approximate values, which may vary depending on the different ideal properties sought to be obtained.

[0028] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those skilled in the art.

[0029] The terms "include," "comprising," "containing," "having," and similar expressions are non-limiting, i.e., other steps and other components that do not affect the result may be added. The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0030] The term "gene" is the entire nucleotide sequence required to produce a polypeptide chain or functional RNA. Thus, gene expression includes transcription and the stable accumulation of coding RNA (mRNA) or functional RNA derived from the gene, and can also refer to the translation of mRNA into a polypeptide or protein.

[0031] The term "vector" refers to a self-replicating DNA molecule that transfers an exogenous gene of interest into a host organism, often in the form of a circular double-stranded DNA molecule. A vector containing a gene of interest is a recombinant vector. Typical vectors include plasmids, viruses, bacteriophages, cosmids, and minichromosomes. Plasmids are the most common form of vector; therefore, in the context of this invention, the terms plasmid and vector are used interchangeably.

[0032] The term "expression vector" allows the exogenous target gene inserted into the vector to be expressed in a host organism. When the expression vector is introduced into a suitable host organism, the inserted target gene (such as the TgTCP2 gene of the present invention) can be expressed.

[0033] The term "importing" or "transferring" refers to the transfer of target gene nucleic acid molecules (such as the overexpression vector containing the TgTCP2 gene) into the host organism, causing genetically stable inheritance. The nucleic acid molecules imported can be in the form of a plasmid retained in the host organism, or can be integrated into the host organism genome. The host organism containing the imported gene is referred to as "transgenic" or "recombination" or "transformed" organism or "engineering" organism. Expression vectors can be imported into the host organism and conventional techniques well known to those skilled in the art are used to carry out.

[0034] The terms "overexpression," "overexpression," "overexpression," "overexpression," and the like refer to gene expression levels exceeding normal expression levels. In preferred embodiments, gene expression levels are at least 10%, 20%, 50%, 100% (2-fold), 200% (3-fold), 300% (4-fold), or even more times higher than normal expression levels. In the present invention, overexpression or overexpression is relative to wild-type plants.

[0035] In order to make the above-mentioned objects, features and advantages of the present invention more clearly understood, the following detailed description of specific embodiments of the present invention is given in conjunction with the accompanying drawings. The following describes the principles and features of the present invention. The examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0036] 1. Isolation and cloning of the TgTCP2 gene

[0037] Extraction of total RNA from tulip and preparation of genomic cDNA: Total RNA was extracted from tulip according to the method described in the literature "Zhu LF, Tu LL, Zeng FC, et al. An Improved Simple Protocol for Isolation of High Quality RNA from Gossypium spp. Suitable for cDNA Library Construction[J]. Acta Agronomica Sinica, 2005, 31:1657-1659." Total RNA was reverse transcribed into cDNA using reverse transcriptase.

[0038] Obtaining the full-length sequence of the tulip TgTCP2 gene: Specific primers TgTCP2-F and TgTCP2-R were designed based on the TgTCP2 sequence in the transcriptome. PCR conditions: 95°C, 3min; 95°C, 30s; 55°C, 30s; 72°C, 2min; 30 cycles; 72°C, 10min. The CDS sequence of the TgTCP2 gene is 1116bp. The sequence obtained by sequencing was further analyzed using the ORF Finder online tool (http: / / www.ncbi.nlm.nih.gov) to determine that it contains a complete ORF containing 371 amino acids. The nucleotide sequence of the TgTCP2 gene obtained in this example is shown in SEQ ID NO.1, and the amino acid sequence of the protein is shown in SEQ ID NO.2. The details are as follows:

[0039] Nucleotide sequence of the TgTCP2 gene:

[0040]

[0041] Amino acid sequence of TgTCP2 protein:

[0042] MENHTCKRPRVGGSQAPAAKVGRLGSSDNGGDVRAAAAMHPWHQPSSRIYRVSRATGGKDRHSKVYTAKGLRDRRVRLSVSTAIQFYDLQDRLGYDQPSKAIEWLIKSAAAAIAELPTLESSFPEFTKGDAGLAVVPVDDPVSRSGCSSTSETSKGSVLSLSRSESRIKARERARAAKEKDKDVED PTQNPAINPQSSFTELLTGTTSNAPSVSTAQTSPSDHKPIRYLPGIATADYFSQAAPMGMMPFNIAAGAGDQHELQHFSFLHEHSVPIATVAPGNYSLNFSGLNRGTLQSNSPFQLPHQHLQRLSPSVDGSNLPFFLGATAPATSTTAANASENQFPAGFDGRLQLCYSNEYGHSDFKGKGKN (see SEQ ID NO.2).

[0043] The sequences of TgTCP2-F and TgTCP2-R primers are as follows:

[0044] TgTCP2-F: gcagtctgatggagaaccaca (see SEQ ID NO. 3);

[0045] TgTCP2-R: aattgagcaaacggggaagc (see SEQ ID NO. 4).

[0046] The TgTCP2 target sequence obtained by primer amplification is as follows:

[0047]

[0048] TCP (Teosinte branched 1 / Cycloidea / Proliferating cell factor) transcription factors are a family of transcription factors unique to higher plants. They participate in multiple processes of plant growth and development, such as leaf shape development, seed germination, and increasing the number of buds, meristems, and lateral organs in grasses. However, the molecular mechanisms and gene identification of TCP transcription factors related to sugar transport in tulips are rare. Based on our understanding of the role of TCP transcription factors in plant growth and development, we further investigated the function of TgTCP2 in growth and sugar transport in tulips and Arabidopsis.

[0049] 2. Analysis of the expression pattern of the TgTCP2 gene

[0050] Using healthy Nicotiana benthamiana plants of about 4 weeks old as plant material, the specific steps are as follows:

[0051] (1) Resuscitation of bacterial liquid: Use an inoculation loop to dip the Agrobacterium liquid stored at -80℃ and streak it on an LB plate containing the vector and the bacterial liquid resistance, and incubate it upside down at 28℃ for 2-3 days. (2) Activation of bacterial cells: Pick a single clone and place it in 10ml LB containing the vector and the bacterial liquid antibiotic, and incubate it at 28℃ in a shaker at 200r / min for 24-48h. Then take 500μL of the bacterial liquid and add it to 50mL of fresh culture medium to expand the culture until the OD value is 0.6-0.8. At this time, the bacterial activity is high. (3) Collection of bacteria: Transfer the activated Agrobacterium liquid to a 50mL centrifuge tube, centrifuge it at room temperature at 4000rpm for 10min, and remove the supernatant. (4) Washing of bacteria: Add 10mL of washing solution (10mM MES, 10mM MgCl2), fully suspend the bacteria, centrifuge it at 4000rpm for 5min, and discard the supernatant; repeat with 5mL of washing solution, and finally resuspend in 5mL of washing solution. (5) Determination of bacterial solution OD value: Dilute the suspended bacteria 20 times and measure the OD value. (6) Preparation of injection solution: The injection solution is a 5mL combination, in which the OD ratio of the gene is 0.5:0.5, add 5μL of acetosyringone (Coollab) AS (150mM) and mix well. Place in a 28℃ incubator for 2-3 hours and wait for injection. (7) Injection of tobacco leaves: Use a disposable syringe to draw up the prepared injection solution and inject. Each bacterial solution can be injected into 2-3 leaves, preferably randomly distributed in different plants. (8) The injected tobacco plants are placed in the dark for 24 hours, and then placed in a light incubator for 48-72 hours. The fluorescence signal in the tobacco mesophyll cells is detected using a confocal microscope (Leica TCS-SP8, Germany).

[0052] In tobacco epidermal cells, the TgTCP2-YFP fusion protein was fluorescent in the tobacco cell nucleus and overlapped with the red fluorescence of mcherry, indicating that the TgTCP2 gene was localized in the cell nucleus (see Figure 2 ).

[0053] 3. Construction of TgTCP2 gene overexpression vector and silencing expression vector and genetic transformation of Arabidopsis thaliana

[0054] After the amplified PCR product fragments were recovered, homologous recombination was performed using a homologous recombination enzyme kit (Novozymes, Express II One Step Cloning Kit, C112-01). The target fragment was amplified using primers SEQ ID NO. 6 and SEQ ID NO. 7 and inserted into the vector pCAMBIA1305. The constructed overexpression plasmid was named pCAMBIA1305-TgTCP2. The target fragment was amplified using primers SEQ ID NO. 8 and SEQ ID NO. 9 and inserted into the vector pTRV2. The constructed silent expression plasmid was named pTRV2-TgTCP2. Reaction conditions: 37°C for 30 min.

[0055] pCAMBIA1305-TgTCP2-F(Xbal):

[0056] TACACCAAATCGACTCTAGAATGGAGAACCACACTTGCAA(SEQ ID NO.6);

[0057] pCAMBIA1305-TgTCP2-R (Spel):

[0058] CATGGTACCGGATCCACTAGTGTTTCTTCCCCTTCCCCTTGA(SEQ ID NO.7);

[0059] pTRV2-TgTCP2-F(XbaI):

[0060] AGTAAGGTTACCGAATTCTCTAGAATGGGGATGATGCCGTTC (SEQ ID NO. 8);

[0061] pTRV2-TgTCP2-R(Sacl):

[0062] CCGGGCCTCGAGACGCGTGAGCTCGAAGTCTGAATGTCCGTA (SEQ ID NO. 9).

[0063] Target fragment amplification method: PCR conditions: 95℃, 3 min; 95℃, 30 s; 55℃, 30 s; 72℃, 2 min; 28 cycles; 72℃, 10 min.

[0064] The constructed recombinant plasmid was introduced into the Agrobacterium strain and transformed into Arabidopsis thaliana using the Agrobacterium-mediated transformation method.

[0065] In order to better elucidate the function of the TgTCP2 gene, the cloned gene sequence was overexpressed in Arabidopsis thaliana, and its function was verified by phenotypic observation of transgenic plants.

[0066] 1. Agrobacterium infection of Arabidopsis thaliana to obtain transgenic material. The specific steps are as follows:

[0067] (1) Select Arabidopsis plants with a large number of flower buds and strong growth, and cut off the pods one day before transformation. (2) Small shaking: Select the preserved Agrobacterium strain and transfer it to 10mL LB medium containing 50mg / L Kan + 50mg / L Rif antibiotics at a ratio of 1ml, and shake for 24h-48h. (3) Large shaking: Transfer the small-shaken bacteria to 50mL LB medium containing 50mg / L Kan antibiotics at a ratio of 1:50, and shake until OD600 = 2.0 or above. (4) Resuspend: Centrifuge the large-shaken bacteria at 4000rpm for 10min, add 5% sucrose solution to resuspend the bacteria to about OD600 = 0.8, add Silwet-77 before infection to a final concentration of 0.02-0.03%, and mix well. (5) Infection: Pour the above resuspension into a large culture dish, turn the plant upside down so that the flower buds are immersed in the resuspension, infect for 30s, and place the plant flat. (6) After the infected plants are placed in the dark for 24 hours, they are placed upright in a growth room with normal light for cultivation, and the transgenic plant seeds are harvested.

[0068] 2. Screening of transgenic positive plants: the specific steps are as follows:

[0069] (1) Collect Arabidopsis T0 seeds and use hygromycin to screen and identify transgenic plants. The operation is carried out in a clean bench. (2) Take an appropriate amount of Arabidopsis seeds and place them in a 2mL centrifuge tube. Add 1mL of 2% NaClO disinfectant and disinfect for 2min 20s. Shake continuously during the period to ensure that the seeds are fully in contact with the disinfectant. (3) Quickly add 1mL of sterile water and shake to wash away the disinfectant on the surface of the seeds. Repeat 5-6 times. (4) Use a sterilized pipette to evenly spread the washed seeds on MS culture medium containing 50mg / L hygromycin, suck out excess water, blow dry, and seal. (5) Place the culture dish in a 4℃ incubator in the dark for 2 days to vernalize the seeds, then place it in a 22℃ tissue culture room. After 10 days, select positive seedlings with long hypocotyls and roots and normal leaves. (6) Move the initially screened positive seedlings to the soil. After vigorous growth, extract genomic DNA to further verify whether the target gene has been transferred.

[0070] 3. Use the 2×CTAB method to extract genomic DNA to further identify positive plants. The steps are as follows:

[0071] (1) Take a 1cm-sized healthy leaf and place it in a 2mL centrifuge. (2) Add steel balls to each centrifuge tube and 800μL of CTAB solution preheated at 65℃. Place the centrifuge tube in a sampling box and shake the box at low amplitude and high frequency for 10 times in each direction. Pour out the steel balls and mix thoroughly. Heat at 65℃ for 30 minutes, shaking up and down every 15 minutes. (3) Remove and cool to room temperature. Add an equal volume of chloroform:isoamyl alcohol = 24:1 solution, shake, let stand for 10 minutes, centrifuge at 12000rpm at room temperature for 10 minutes, and take the supernatant into a new centrifuge tube. (4) Take 500 μL of the supernatant, add 1 ml of anhydrous ethanol, shake well, let it stand at -20°C for 2-3 hours, and centrifuge at 12,000 rpm for 10 minutes at room temperature; (5) Discard the supernatant, add 500 μL of 75% ethanol to the precipitate, let it stand for 5 minutes, and centrifuge at 12,000 rpm for 10 minutes at room temperature; (6) Discard the supernatant (first pour out and then aspirate), and let it air in a fume hood for 30 minutes to 1 hour to completely dry the ethanol; (7) Add 50 μL of sterile water and dissolve the DNA at 4°C overnight.

[0072] The transgenic plants that were identified as positive were harvested and propagated, and three strains with high expression levels were selected through fluorescence quantitative experiments for subsequent other research.

[0073] 4. Application of Tulip TgTCP2 gene in improving the growth and development of Arabidopsis

[0074] Three strains and the wild type were sterilized and sown on Murashige and Skoog medium (MS). After vernalization at 4°C in the dark for 3 days, the seeds were transferred to a culture chamber and incubated at 22°C with a 16 / 8 h light / dark cycle. After 10 days, seedlings of uniform size were selected and transplanted into black square pots (in a 1:1 ratio of vermiculite to peat soil) for another 4 weeks.

[0075] Figure 3 The phenotypes of Arabidopsis plants 4 weeks after transplantation are shown. In the figure, OE#1, OE#4, and OE#10 represent three independent TgTCP2 overexpressing Arabidopsis transgenic lines, used to illustrate the reproducibility of the results. WT represents the wild-type Arabidopsis control that has not been subjected to transgenic treatment. Figure 3 As can be seen from Figure AB, when the plants grew to the 4th week, the plant size and number of rosette leaves of the transgenic lines were significantly larger or more than those of the WT. Figure 3 As can be seen from the CD graphs in the middle, when the plants grew to the 7th week, the height of the transgenic lines was significantly higher than that of the WT. Figure 3 Figures EG in the middle are the experimental data statistics of plant size, number of rosette leaves and plant height.

[0076] 5. Application of Tulip TgTCP2 Gene in Improving Tulip Growth and Development

[0077] The TgTCP2 gene was transiently silenced using VIGS silencing technology. The steps are as follows:

[0078] (1) Streak and activate Agrobacterium carrying pTRV2-TgTCP2, pTRV2 and pTRV1 on LB solid medium (containing 50 mg / mL Kan + 50 mg / mL R-1f) and incubate at 28°C for 2 days. (2) Shake well: Pick a single clone of bacteria and inoculate 10 mL of LB liquid medium (containing 50 mg / mL Kan + 50 mg / mL R-1f) Rif), 28℃ 200r / min, shake culture for 12-16h. (3) Large shaking: dilute the bacterial solution shaken by small shaking into 200mL LB liquid culture medium according to 2ml, 28℃, 200r / min, shake culture for 12-16h, until OD600 reaches 0.8-1.0. (4) Collect bacteria: centrifuge at 4000rpm for 10min at room temperature, discard the supernatant, and collect bacteria. (5) Resuspend the bacteria with 1-2mL infection solution, and then add appropriate amount of infection solution to make the OD600 of the resuspended bacteria solution = 1.2-1.5, and pTRV2-TgTCP2, pTR The OD600 values ​​of V2 and pTRV1 should be as close as possible. (6) Mix equal volumes of pTRV2-TgTCP2, pTRV2 and pTRV1, add AS (100mM), and incubate in the dark for 3-4h. (7) Poke holes in the vernalized tulip bulbs, 8 holes around the root plate and 2 holes at the bottom, then immerse the punctured bulbs in the bacterial solution, evacuate to 1.0MPa, and treat for 30min. (8) After treatment, place the bulbs at room temperature in the dark for 2d. After dark treatment, place the bacterial solution under light to dry, then plant the tulip bulbs in the base glass greenhouse and observe their growth in the later stage.

[0079] like Figure 4 Figure A shows the bulb size on day 0, day 30, and day 90, Figure B shows the statistical data of bulb size, and Figure C shows the statistical data of bulb fresh weight. The results show that silencing this gene significantly inhibited the development of tulip bulbs.

[0080] 6. Application of Tulip TgTCP2 Gene in Plant Sugar Transport

[0081] The TgTCP2 gene was transiently silenced using VIGS silencing technology. After 3 days of silencing, the sugar transport efficiency was detected using CFDA fluorescent dye. 1 mg / mL CFDA dye was injected into the base of the leaf (e.g. Figure 5 A). After 3-4 days, the fluorescence intensity of CFDA in leaves and tulip bulbs was observed (e.g. Figure 5 B) The results showed that the fluorescence intensity in the leaves and bulbs of the silencing tulips was significantly lower than that in the control group. This indicates that the tulip TgTCP2 gene plays a role in sugar transport in tulips.

[0082] In summary, the TgTCP2 gene not only promotes the growth and development of Arabidopsis and tulip, but also participates in the transport of sucrose by the plant, and is of great significance in the regulation of plant carbohydrate transport to storage organs.

[0083] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Tulip transcription factor TgTCP2, characterized in that The amino acid sequence is shown in SEQ ID NO:

2.

2. The tulip transcription factor TgTCP2 according to claim 1, characterized in that The nucleotide sequence is shown in SEQ ID NO:

1.

3. Use of the tulip transcription factor TgTCP2 as claimed in claim 1 in regulating plant growth and development traits.

4. The use of TgTCP2 in regulating plant growth and development traits according to claim 3, characterized in that The plant growth and development traits include: at least one of bulb size, plant growth rate, number of rosette leaves and plant height.

5. The use of TgTCP2 in regulating plant growth and development traits according to claim 3, characterized in that, The application method comprises: constructing a TgTCP2 overexpression vector, transforming wild-type plants, and screening to obtain transgenic plants with enhanced TgTCP2 expression.

6. The use of TgTCP2 in regulating plant growth and development traits according to claim 3, characterized in that The application method comprises: constructing a TgTCP2 silencing vector, transforming wild-type plants, and screening to obtain transgenic plants with reduced TgTCP2 expression.

7. The use of TgTCP2 in regulating plant growth and development traits according to claim 5, characterized in that The method for constructing the TgTCP2 overexpression vector comprises: The TgTCP2 gene was amplified using the primer pair shown in SEQ ID NO. 5-6, and the amplified TgTCP2 gene was ligated to the expression vector pCAMBIA1305 by enzyme digestion and ligation reaction to obtain a TgTCP2 overexpression vector.

8. The use of TgTCP2 in regulating plant growth and development traits according to claim 6, characterized in that The method for constructing the TgTCP2 silencing vector comprises: The TgTCP2 gene was amplified using the primer pair shown in SEQ ID NO. 7-8, and the amplified TgTCP2 gene was ligated to the expression vector pTRV2 by enzyme digestion and ligation reaction to obtain the TgTCP2 silencing vector.

9. The use of TgTCP2 in regulating plant growth and development traits according to claim 3, characterized in that The plant is Arabidopsis thaliana or tulip.

10. Use of the tulip transcription factor TgTCP2 according to claim 1 in regulating plant sugar transport.

Images