Amylose improvement method based on Wx gene intron branch point editing
By editing the intron branching points of the rice Wx gene, constructing a luciferase expression vector to detect the splicing efficiency, and obtaining mutants with reduced expression levels, the problem of long time required to improve rice quality in traditional breeding methods was solved, the regulation of amylose content and gel consistency was achieved, and the quality of rice was improved.
Patent Information
- Application Number
- CN202510824243.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2025-09-19
AI Technical Summary
Existing technologies make it difficult to efficiently regulate the amylose content and gel consistency in rice through traditional breeding methods, resulting in a long time span for rice quality improvement and difficulty in breaking the chain reaction of adverse agronomic traits.
By performing site-directed editing on the intron branch point of the Wx gene, a luciferase expression vector was constructed, the intron splicing efficiency was detected, and the mutant type with decreased expression was selected to construct a Wx intron knockout vector. Eleven mutants were obtained by transforming rice.
The method achieves different degrees of reduction in the amylose content and increase in the gel consistency of rice, which is suitable for the cultivation of new rice varieties with low amylose content and high gel consistency, and improves the quality of rice.
Smart Images

Figure CN120665945A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a method for improving amylose based on editing of Wx gene intron branch points and its application. Background Art
[0002] The Wx gene in rice encodes granule-bound starch synthase 1 (GBSS1), a major regulator of amylose content (AC) in the rice endosperm. In addition to regulating AC, the Wx gene also regulates gel consistency (GC) and has been identified as a major quantitative trait locus (QTL) controlling GC in both indica and japonica rice. Different ratios of amylose to amylopectin in rice grains contribute to varying taste qualities and appearance. The Wx gene consists of 13 exons and 12 introns, encoding a 609-amino acid protein. Non-glutinous rice varieties contain two alleles, Wxa and Wxb. The Wxa allele is almost exclusively found in wild rice. Wxa is a strong allele, primarily found in indica rice cultivars, and produces high amylose content (AC approximately 25-30%). Wxb is a weak allele, primarily found in japonica rice cultivars, and produces moderately low amylose content (AC approximately 15-18%). Compared to Wxa, Wxb has a GT to TT mutation at the 5'ss boundary donor site of intron 1. This mutation reduces or even delays the splicing of intron 1, leading to reduced mature Wx gene transcript levels, decreased β-glucuronidase activity, and, consequently, reduced amylose content. These results suggest that the Wxb allele evolved from the Wxa allele. Generally, rice with a high amylose content (AC) and a low gel consistency (GC) exhibits poor cooking and eating qualities. Conversely, rice with a moderate amylose content (AC approximately 15-20%) and a high gel consistency (GC approximately 60-80) exhibits better cooking and eating qualities. Therefore, continuous backcrossing can be used to introduce the Wxb allele into indica rice cultivars to improve rice quality. However, this traditional breeding method is difficult to break the linkage of negative agronomic traits and takes a long time. Studies of Wx alleles have revealed that the Wxlv allele, the ancestor of the rice Wx gene, has an amylose content of approximately 27%. Wxop also reduces AC to a certain extent. The mutant allele Wx-mq has an even lower amylose content (AC) than the Wxb allele, at approximately 10%. Recent studies have identified the Wxmw allele, which has an amylose content intermediate between the Wx-mq and Wxb alleles, at approximately 14%.
[0003] Gene editing primarily regulates gene expression in two ways. One is by deleting or altering the structure of the promoter and 5' UTR regions to affect gene expression; the other is by integrating dCas proteins to activate or repress specific domains, thereby regulating gene expression. With the continuous advancement of crop breeding and improvement technologies, gene editing has become a major tool for fine-tuning amylose content. Both 5' UTR and promoter editing have been shown to effectively regulate the expression of the Wx gene, thereby controlling amylose content.
[0004] Previous studies have found that intron regions, as important regulatory regions, affect gene expression and function. Through the splicing efficiency of introns, intron retention regulated by alternative splicing, exon skipping, and the multiple alternative pairing of multiple 5'ss and 3'ss in introns, a complex post-transcriptional regulatory system is formed, which plays an important role in growth, development, and resistance to adversity. Genomic and transcriptomic analysis shows that each gene in plant cells contains an average of about 4.5 introns, and 98.6% of plant introns are of the GT-AG type (i.e., GT at the 5' end and AG at the 3' end). Its splicing is mediated by a highly complex spliceosome complex, which is composed of U1, U2, U4, U5, and U6 snRNAs and more than 200 proteins. Canonical GT-AG intron splicing requires recognition of the 5' splice site (5'ss), 3' splice site (3'ss), branch point (BS), and polypyrimidine tract (PPT). The 5'ss, BS, and 3'ss are key signals for proper spliceosome assembly and functional execution. Alternative splicing can occur through three main forms: intron retention, exon skipping, and selective pairing of the 5'ss and 3'ss, generating diverse functional mRNAs and further influencing protein function.
[0005] In comparison, regulating gene expression through introns offers two advantages. First, approximately 85% of plant genes contain introns, with an average of 4 to 6 introns per gene. Therefore, we have a wider range of options for editing. For example, the rice granule starch synthase gene Wx has more than a dozen introns, and the low-amylose haplotype Wxb itself is a naturally occurring intronic mutant allele. Second, unlike editing of promoters and other elements, intron splicing is less affected by tissue specificity, and its mutation efficiency can be predicted using a protoplast transient expression system. This feature could enable the development of new, predictable methods for fine-tuning Wx gene expression. However, this method has not yet been applied to the creation of rice materials with amylose variation. Summary of the Invention
[0006] To this end, the present invention introduced a dual luciferase detection system to evaluate the splicing efficiency after the Wx intron mutation, and selected appropriate Wx intron sites for editing to create rice materials with amylose changes.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] One of the objectives of the present invention is to provide a method for preparing rice mutants based on Wx gene intron branch point editing, the method comprising the following steps:
[0009] S1: Analysis of the Wx intron structure yielded the branch point BS sequences containing the conserved branch point A on introns 5 and 7;
[0010] S2: Design a double knockout target combination on introns 5 and 7, construct it into a luciferase expression vector, and then transiently express it in rice protoplasts to detect the efficiency of intron splicing after mutation;
[0011] S3: Mutation types with decreased expression levels were selected for rice editing, and Wx intron knockout vectors were constructed and transformed, finally obtaining 11 rice mutants.
[0012] Furthermore, the branch point BS sequences obtained on introns 5 and 7 in step S1 are SEQ ID NO. 7 and SEQ ID NO. 8.
[0013] Furthermore, step S2 includes the following steps:
[0014] S2-1: Construction of the firefly luciferase expression vector Pubi-luc driven by the Ubi promoter;
[0015] S2-2: The wild-type fragments of introns 5 and 7 were ligated into the SacI / bamHI sites of Pubi-luc to construct Wx5-luc and Wx7-luc;
[0016] S2-3: Design and synthesize a mutant linker fragment covering the branch point, ligate it to Wx5-luc / Wx7-luk, and transform to obtain positive clones.
[0017] Furthermore, the step S2-1 includes using a fragment Ubi+sacI_bamHI containing an Ubi promoter, the sequence of which is shown in SEQ ID NO.9.
[0018] Furthermore, the sequences of Wx5-luc and Wx7-luc in step S2-2 are shown as SEQ ID NO.12 and SEQ ID NO.13.
[0019] Furthermore, the sequences of the mutant connection fragments in step S2-3 are shown as SEQ ID NO.14 to SEQ ID NO.33.
[0020] Furthermore, the sequences of the specific amplification primers used for rice editing in step S3 are shown as SEQ ID NO.34 to SEQ ID NO.39.
[0021] Furthermore, the sequences of the 11 rice mutants in step S3 are shown as SEQ ID NO. 44 to SEQ ID NO. 62.
[0022] A second object of the present invention is to provide application of any of the methods for preparing rice mutants in rice cultivation.
[0023] Furthermore, the application includes application in the breeding of new rice varieties and / or new strains with low amylose content and / or high gel consistency.
[0024] Compared with the prior art, the present invention has the following technical effects:
[0025] The present invention obtains mutants with reduced Wx expression by performing site-directed editing around the branch points of different intronic regions of the major amylose gene Wx. Rice quality tests show that: (1) these mutants cause varying degrees of decrease in amylose content, and the degree of decrease in amylose content is correlated with the expression level; (2) these mutants also cause an increase in rice gel consistency. Therefore, the present invention can be applied to the cultivation of new rice varieties and / or new strains with low amylose content and / or high gel consistency, which is of great significance for the production of high-quality rice. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the Wx gene branch point prediction diagram in embodiment 1 of the present invention.
[0027] Figure 2 These are the results of luciferase activity determination for different mutation types in Example 1 of the present invention.
[0028] Figure 3 5in1-1 and 7in6-1 in Example 1 of the present invention are Wx gene knockouts in the Teqing background.
[0029] Figure 4 These are 7in4-1 to 7in4-9 in which the Wx gene is knocked out in the Teqing background in embodiment 1 of the present invention.
[0030] Figure 5 This is the qPCR detection result of the Wx gene in embodiment 1 of the present invention.
[0031] Figure 6This is the SDS-PAGE of total grain protein of the Wx mutant in Example 1 of the present invention.
[0032] Figure 7 This is the change in amylose content of the knockout mutant in embodiment 1 of the present invention.
[0033] Figure 8 This is the change in gel consistency of the knockout mutant in embodiment 1 of the present invention.
[0034] Figure 9 This is the change in the alkaline elimination value of the knockout mutant in embodiment 1 of the present invention. DETAILED DESCRIPTION
[0035] The following examples are intended to illustrate the present invention but are not intended to limit the scope of the invention. Without departing from the spirit and essence of the present invention, modifications or substitutions made to the inventive method, steps or conditions are intended to fall within the scope of the present invention. The reagents, products and instruments used in the following examples are all commercially available, and the methods used in the examples are consistent with conventional methods unless otherwise specified.
[0036] The technical solution of the present invention is further elaborated in detail below with reference to the embodiments.
[0037] Example 1
[0038] 1 Experimental methods
[0039] The methods used in this embodiment are as follows:
[0040] Method 1: T4 ligation system (Table 1)
[0041] Table 1
[0042]
[0043] Note: After mixing the above reagents, place them in a 22°C constant temperature incubator in the dark for 120 minutes to perform the ligation reaction.
[0044] Method 2: Homologous recombination ligation (Table 2)
[0045] Table 2
[0046]
[0047]
[0048] Note: Using the One Step Cloning Kit homologous recombination ligase provided by Vazyme, after mixing the above reagents, place them in a 37°C constant temperature incubator in the dark for 30 minutes to perform the recombination reaction.
[0049] Method 3: E. coli transformation and colony detection
[0050] (1) Take the competent DH5α E. coli out of the -80°C medical refrigerator and immediately place it on ice.
[0051] (2) After the DH5α E. coli competent cells are completely thawed, 10 μL of binding product is added (the volume of the competent cells is 100 μL, and the volume of binding product added should not exceed 1 / 10 of the volume of the competent cells) and ice-bath for 30 minutes.
[0052] (3) After removing the competent mixture from the ice, immediately place it in a 42°C constant temperature water bath, heat shock it for 45 seconds, and then cool it on ice for 2 minutes.
[0053] (4) Add 500 μL of resistance-free LB (performed in a clean bench) to the competent mixture and incubate at 37°C in a constant temperature shaker at 220 rpm for 1 h.
[0054] (5) Take out the culture medium and centrifuge it at 4000 rpm for 3 min at room temperature to collect the activated E. coli cells. Remove the supernatant in a clean bench and thoroughly mix the remaining 50-100 μL by pipetting. Use a spreading rod to evenly spread it on solid LB culture medium containing the corresponding antibiotics. Invert it at 37°C for more than 12 h and culture it in the dark.
[0055] (6) After colonies grow on the culture medium, use a sterile pipette tip to pick up a single colony on the culture medium and add it to a 2 mL sterile centrifuge tube (the centrifuge tube contains 500 μL of the corresponding resistance liquid LB culture medium), and culture it in a constant temperature shaker at 37°C and 220 rpm until the liquid becomes turbid.
[0056] (7) Design specific primers in advance, perform PCR on the bacterial solution after it becomes turbid, run the solution on agarose gel electrophoresis, and send 200 mLd of the correct single colony to a biotechnology company for sequencing. Compare the sequencing results in SnapGene, activate the correct strain in resistant liquid LB, add 50% sterile glycerol in a 1:1 ratio to maintain the bacteria, and extract the plasmid for subsequent experiments.
[0057] Method 4: E. coli plasmid extraction
[0058] (1) Column equilibration: Add 500 μL of equilibration solution LB to the adsorption column and centrifuge at 12,000 rpm for 1 min.
[0059] (2) Collecting bacterial suspension: Centrifuge at 9000 rpm for 2 min in a 50 mL centrifuge tube to collect the activated bacterial suspension at the bottom of the tube and discard the supernatant.
[0060] (3) Resuspend: Add 250 μL P1 (for RNA removal) to a 50 mL centrifuge tube and vortex.
[0061] The precipitated bacteria were completely suspended and transferred to a 2 mL sterile centrifuge tube.
[0062] (4) Lysis: Add 250 μL P2 and gently invert up and down 6-8 times until the liquid becomes viscous. Let it stand at room temperature for 4 minutes.
[0063] (5) Combination: Add 350 μL P3 and immediately mix thoroughly by gently inverting the tube 6-8 times. A white flocculent precipitate will appear and centrifuge at 12,000 rpm for 10 min.
[0064] (6) Elution: Carefully collect the supernatant into the adsorption column and centrifuge at 12000 rpm for 1 min.
[0065] Add 500 μL of deproteinized PD and centrifuge at 12,000 rpm for 1 min.
[0066] Add 600 μL of deproteinized PD and centrifuge at 12,000 rpm for 1 min.
[0067] Repeat the rinse cycle.
[0068] The adsorption column was idling for 2 minutes and then left uncovered for 5 minutes to evaporate the alcohol.
[0069] (7) Plasmid collection: Place the adsorption column in a sterilized 1.5 mL centrifuge tube and leave it at room temperature for 2 min. Add 50 μL of 55°C ddH2O to the adsorption column and leave it at room temperature for 2 min. Centrifuge at 12,000 rpm for 2 min to obtain the plasmid and measure the OD value.
[0070] Method 5: Rice protoplast preparation and transformation
[0071] Table 3 Protoplast preparation reagent preparation
[0072]
[0073] (1) After cutting off the cultivated etiolated rice seedlings from the stem base, approximately 300 etiolated rice seedlings were selected and cut into 0.5 mm slices using a razor blade. The sliced rice strips were quickly placed in a triangular flask containing 1 mL enzyme solution (the triangular flask should be wrapped with tin foil to protect it from light). The mixture was placed in a shaking incubator at 28°C and enzymatically hydrolyzed for 3-5 hours at 70 rpm in the dark.
[0074] (2) Add W5 Solution with the same volume as the enzymatic solution and rotate rapidly horizontally for 15 seconds to fully release the protoplasts.
[0075] (3) Filter the enzymatically hydrolyzed protoplasts through a sterilized sieve (35 μm, 100 mesh) rinsed with W5 Solution into a new 250 mL Erlenmeyer flask. Rinse the sieve with a small amount of W5 Solution to fully elute the protoplasts, and transfer all of the sieve to a new Erlenmeyer flask.
[0076] (4) The protoplasts in the Erlenmeyer flask were divided into two 50 mL transparent centrifuge tubes and centrifuged at 350 g for 3 min in a horizontal rotor (the speed was adjusted to 1), and the supernatant was carefully removed.
[0077] (5) Add 15 mL of W5 solution to resuspend the protoplasts, centrifuge at 350 g for 3 min, carefully remove the supernatant, and resuspend the protoplasts in 1 mL of MMg solution to a final concentration of 1-5 × 10 6 cell / mL.
[0078] (6) The resuspended protoplast mixture was cultured at 28°C in the dark for 16-18 hours.
[0079] (7) Add 10 μg of plasmid to a 2 mL centrifuge tube, then add 100 μL of prepared protoplasts and gently pipette to mix. Add 110 μL of 40% PEG and mix quickly and gently to prevent the protoplasts from clumping.
[0080] (8) Place in a 28°C water bath for 15 min, add 1.8 mL of W5 solution to resuspend, and terminate the reaction. Place a 2 mL centrifuge tube inside a 10 mL centrifuge tube and centrifuge at 250 g in a swinging rotor for 3 min.
[0081] (9) Carefully remove the supernatant with a pipette and resuspend the protoplasts in 500 μL of W5 solution. Transfer the protoplasts to a 12-well cell culture plate, cover with sealing film, and incubate at 28°C in the dark for 14–16 h.
[0082] Method 6: Dual luciferase expression activity detection
[0083] (1) Remove the transfected protoplasts that have been incubated in the dark for 14-16 hours, centrifuge at 1°C in a 350g bucket rotor for 3 minutes, and carefully aspirate the remaining liquid.
[0084] (2) Add 100 μL of the prepared 1× Cell Lysis Buffer, shake for 30 seconds to mix thoroughly, and react in a 28°C metal bath at 500 rpm for 10 minutes to allow for complete lysis.
[0085] (3) Centrifuge the lysed sample at 12,000 g for 3 min, carefully aspirate the supernatant and transfer it to a sterile 1.5 mL centrifuge tube and place it on ice.
[0086] (4) Use a multifunctional microplate reader to detect dual luciferin (firefly and Renilla) signals. Pipette 20μL of supernatant into a white microplate, then use a dispenser to add 100μL of Luciferase Substrate, set up the reaction detection system in advance, and measure the signal value of firefly luciferin; then add 100μL of freshly prepared Renilla Substrate, mix well, and immediately measure the Renilla luciferin signal value. (Note that both Luciferase Substrate and Renilla Substrate reaction solutions need to be returned to room temperature before use)
[0087] (5) Finally, the LUC / REN value is compared with the differences of the samples to be tested.
[0088] Method 7: Agrobacterium plasmid transformation
[0089] (1) Take out the competent Agrobacterium EHA105 stored at -80℃, place it on ice, wait for it to completely thaw, add 2μg of recombinant plasmid, pipette and mix, place on ice for 30min, freeze in liquid nitrogen for 5min, keep warm in a constant temperature water bath at 37℃ for 5min, and place on ice for 2min.
[0090] (2) Add 500 μL of non-resistant liquid LB medium (performed in a clean bench) to the mixed Agrobacterium competent cells and culture in a constant temperature shaker at 28°C and 180 rpm for 3 to 6 h.
[0091] (3) Centrifuge at 4000 rpm for 1 min to collect the bacterial liquid, discard the supernatant, retain 50-100 μL of the liquid to resuspend the bacteria, and evenly spread it on solid LB medium with 50 ng / mL of kanamycin (Kan) and rifamycin (Rif), and culture it in the dark at 28°C for 2-3 days.
[0092] (4) After single colonies grow, pick 3 to 6 single colonies and perform PCR on the bacterial solution. The correct positive strains will be preserved.
[0093] Method 8: Agrobacterium-mediated rice transformation
[0094] (1) Callus induction and subculture
[0095] First, select rice seeds with full grains and clean and free of impurities after removing the husks. Transfer to a sterilized 250mL conical flask, wash thoroughly with ddH2O, and repeat 3 times. Then add 100mL of 75% ethanol and wash for 2 minutes (shake continuously during this period to achieve the purpose of surface disinfection), and wash again with ddH2O 3 times. Then add 100mL of 25% sodium hypochlorite solution prepared in advance, place on a shaker and shake at 180rpm for 15 minutes, then wash several times with ddH2O (8 to 10 times to remove sodium hypochlorite residues). After washing, transfer to a culture dish with multiple filter papers, blow dry the water in the clean bench, and place the embryo close to the surface of the solid NB culture medium.
[0096] (2) Agrobacterium transformation
[0097] Streak the transformed Agrobacterium onto solid LB medium with K+R resistance, invert, and incubate at 28°C in the dark for 2 days before activation. Pipette an appropriate amount of AAM liquid medium onto the surface of the activated Agrobacterium medium to rinse the Agrobacterium cells. Measure the OD value and adjust the value appropriately. Select well-growing calli and place them in an Erlenmeyer flask containing the Agrobacterium suspension. Infect for 15 minutes (shake gently during inoculation). Transfer the calli to a Petri dish lined with sterile filter paper and air-dry. Next, transfer the calli to solid co-cultivation medium and incubate at 25°C in the dark for 3 days. Select the calli, wash them 6-8 times with ddH2O, shake vigorously, and then shake them in ddH2O containing carbenicillin (Car) on a shaker at 120 rpm for 30 minutes. Transfer them to sterile filter paper, air-dry, and then transfer them to selection medium containing hygromycin (50 mg / L Hygromycin) and incubate for 14 days.
[0098] (3) Screening of resistant calli, subculture, differentiation, and hardening of seedlings.
[0099] After that, the first generation is screened every 14 days. When new callus tissue grows out of the second generation, it is the resistant callus, which is transferred to a new screening medium until the callus grows up. It is transferred to a solid pre-differentiation medium again and cultured in light at 28℃. After 6-8 days, green spots emerge on the surface. The green spots grow into seedlings and are transferred to a glass bottle with solid rooting medium at the bottom 1 / 3 and cultured in light (regularly check whether it is contaminated during this period. If it is contaminated, it must be removed in time). After about 14 days of culture, the culture medium can be washed off and the base of the stem is immersed in nutrient solution to harden the seedlings.
[0100] Method 9: PCR detection and mutation analysis of gene-edited plants
[0101] DNA was extracted from leaves of transgenic plants using the CTAB method. PCR amplification of the target fragment was performed using the designed F / R primers. The PCR amplification procedure generally consisted of 35 cycles of pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 10 minutes. After PCR, agarose gel electrophoresis was performed, and products with the correct bands were selected and sent to the company for next-generation sequencing. Sequencing results were aligned and analyzed for mutation sites using Snapgene.
[0102] Method 10: Analysis of Wx gene expression in gene-edited plant seeds
[0103] (1) Select full rice grains, remove the husks, and use a scalpel to separate the embryo from the endosperm. The cut embryos are placed in a 2 mL centrifuge tube containing steel balls and quickly frozen in liquid nitrogen for 5 min. During this period, the sample grinder and desktop centrifuge are pre-cooled to 4°C, and 75% ethanol solution and isopropanol are placed on ice for use.
[0104] (2) Place the sample frozen in liquid nitrogen in a sample grinder at 4°C for 2 min, add 1 mL of TRIzol, mix thoroughly, and let it stand at room temperature for 10 min.
[0105] (3) Add 200 μL of nucleic acid extraction solution, mix thoroughly, and let stand at room temperature for 10 minutes.
[0106] (4) Centrifuge at 12000 rpm and 4°C for 10 min. Pipette 450 μL of supernatant and mix with an equal volume of isopropanol (on ice) and place at -20°C for 1 h.
[0107] (5) Discard the supernatant, add 1 mL of 75% ethanol solution (prepared with DEPC water, operate on ice) for washing, and centrifuge at 12000 rpm at 4°C for 5 min; repeat once.
[0108] (6) Discard the supernatant and centrifuge the empty tube for 3 minutes. Place the sample on ice in a clean bench and drain the remaining liquid. Add 30-50 μL RNA-free ddH2O and pipette until it is completely melted.
[0109] (7) Oscillate in a 65°C metal bath for 5 min to destroy the RNA tertiary structure and store in a -80°C refrigerator.
[0110] (8) Using the OsActin gene as an internal reference and the reverse transcribed cDNA as a template, real-time fluorescence quantitative analysis was performed using a qRT-PCR instrument (ABIPRISM7500). The qRT-PCR reaction system and procedure (Table 4) are:
[0111] Table 4
[0112]
[0113] Each sample should be replicated three times and cycled 40 times. After the reaction is complete, observe the melting curve, analyze the differences between the three replicates, and summarize the relative expression levels of each.
[0114] Target gene primer sequence:
[0115] Wx-5-qpcr-F:ggaacttatggtgaggatgttgtg(SEQ ID NO.1)
[0116] Wx-5-qpcr-R:cattgggctggtagttgttcttc(SEQ ID NO.2)
[0117] Wx-7-qpcr-F:cgggtatgagtatgacacgcc(SEQ ID NO.3)
[0118] Wx-7-qpcr-R:gctcctcggcgtagtacgggctc(SEQ ID NO.4)
[0119] Actin (internal reference)-F: agtgtctggattggaggat (SEQ ID NO.5)
[0120] Actin (internal reference)-R: tcttggcttagcattcttg (SEQ ID NO.6)
[0121] Method 11: Determination of amylose content in seeds of gene-edited plants
[0122] (1) Accurately weigh 100 mg (± 1 mg) of seed powder and place it in a 50 mL conical flask.
[0123] (2) Add 1 mL of 95% ethanol to the sample (to prevent sample clumping), then add 9 mL of distilled water and mix thoroughly. Add 2 mL of 1 mol / L NaOH solution, shake well, and heat in a 95°C water bath for 10 minutes to completely gelatinize the starch. Remove and cool to room temperature.
[0124] (3) Transfer the solution to a 100 mL volumetric flask, dilute to volume with distilled water, and shake well.
[0125] (4) Pipette 2 mL of the constant volume solution into a colorimetric tube, add 1 mL of iodine reagent (0.2% I2 + 2% KI), and then add distilled water to 10 mL, making the total volume 10 mL. Mix well and let it stand at room temperature for 15 minutes to develop color.
[0126] (5) Measure the absorbance at 620 nm using a spectrophotometer. Calibrate with a blank control (no sample added). Use standard amylose solutions of varying concentrations and follow the same color development procedure to plot a standard curve.
[0127] (6) Calculate the amylose content in the solution based on the standard curve corresponding to the sample absorbance, and then convert it into a percentage (%) based on the initial weight of the sample.
[0128] Method 12: Starch potassium iodide staining of gene-edited plant seeds
[0129] (1) Prepare 5 dried, plump rice grains and place them in a 10 ml centrifuge tube.
[0130] (2) Add 1 ml of 75% ethanol solution to the centrifuge tube and wash in a constant temperature shaker at 220 rpm for 3 minutes.
[0131] (3) Add 0.4% KI solution (KI is prepared with anhydrous ethanol) to the washed rice grains.
[0132] (4) Dyeing was carried out in a constant temperature shaker at 220 rpm for 10 h.
[0133] (5) Take out the stained seeds and wash them with 95% ethanol solution by shaking for 3 minutes. Wash three times.
[0134] (6) Take photos of the dyed grains.
[0135] Method 13: Determination of gel consistency of gene-edited plant seeds
[0136] (1) Grind the polished rice into rice flour using a rice grinder and sieve it through a 100-mesh sieve.
[0137] (2) Weigh 125 mg of thymol blue and dissolve it in 500 ml of 95% ethanol to prepare a 0.025% thymol blue solution.
[0138] (3) Accurately weigh 11.22 g of KOH and dissolve it in 50 ml of distilled water. Use a volumetric flask to make up to 100 ml to prepare a 0.2 mol / L solution.
[0139] (4) Open the water bath and adjust the temperature to 100°C.
[0140] (5) Accurately weigh 100 ± 1 mg of rice flour and pour it into the bottom of the test tube.
[0141] (6) Add 0.2 ml of thymol blue solution to the test tube and shake the test tube gently to fully disperse the rice flour.
[0142] (7) Add 2.0 ml of KOH solution to the test tube and shake the test tube gently to mix the solution thoroughly.
[0143] (8) Place the test tube in boiling water and add it to the boiling water bath for 8 min.
[0144] (9) After 8 minutes, remove the test tube immediately and let it stand at room temperature for 5 minutes. Then place the test tube in a 0℃ refrigerator to condense for 20 minutes.
[0145] (10) Place the condensed test tube on the table with the bottom of the test tube close to the ruler to ensure that the bottom is on the same reference line.
[0146] (11) Let stand at room temperature for 1 hour.
[0147] (12) Measure the flow length of rice glue in the test tube.
[0148] Method 14: Determination of Gelatinization Temperature of Gene-Edited Plant Seeds
[0149] (1) After harvesting, dry the seeds in the sun or in an oven, and then thresh the seeds.
[0150] (2) The seeds were stored at room temperature for 3 months and then separated to obtain brown rice.
[0151] (3) The brown rice is ground into polished rice on a rice polishing machine.
[0152] (4) Take 6 mature and plump whole polished rice grains and place them in a square box. Add 10.0 ml of 1.70% potassium hydroxide solution. Use a glass rod to evenly distribute the rice grains in the box and cover it.
[0153] (5) Move the box steadily to a constant temperature incubator at 30±2℃ and keep warm for 23 hours.
[0154] (6) Take out the box steadily and observe the decomposition of the rice endosperm grain by grain, and record the classification according to (Table 1).
[0155] (7) Calculation of alkali-dissipation value of rice sample: alkali-dissipation value = ∑(G·N) / 6
[0156] Where G represents the grade of each grain of rice, and N represents the number of rice grains of the same grade.
[0157] Table 5 Classification of rice gelatinization temperature
[0158]
[0159] Table 6 Alkali elimination value (gelatinization temperature) classification standard
[0160]
[0161]
[0162] 2 Experimental process and results
[0163] 2.1 Analysis of Wx intron structure
[0164] For the known Wx gene intron sequence, the branch point BS site was predicted online using the bioinformatics website NetGene22.42 (URL https: / / services.healthtech.dtu.dk / services / NetGene2-2.42 / ) and ERISdb (URL http: / / lemur.amu.edu.pl / share / ERISdb / home.html), and a 20 bp branch point BS sequence containing the conserved branch point A was obtained ( Figure 1 ). The sequences of No. 5 and No. 7 are tgatgatcagactaattcct (SEQ ID NO. 7) and ttttgagctgacaaccctgc (SEQ ID NO. 8), respectively.
[0165] Verification of the splicing efficiency of 2.2Wx mutations 5 and 7
[0166] Since introns 5 and 7 contain abundant potential Cas9 targets (PAM sequence of NGG), two types of double knockout target combinations were designed on intron 5 of the Wx gene, and eight types of double knockout target combinations were designed on intron 7. These combinations were constructed into Luciferase expression vectors and transiently expressed in rice protoplasts to detect the efficiency of intron splicing after mutation.
[0167] The following are the steps for luciferase vector construction and detection:
[0168] 1) The following fragment containing the Ubi promoter, Ubi+sacI_bamHI (SEQ ID NO. 9), was synthesized and ligated into the pGreen0800 vector (https: / / doi.org / 10.1186 / 1746-4811-1-13) by homologous recombination to construct the firefly luciferase (firefly) expression vector Pubi-luc driven by the Ubi promoter. Homologous recombination, E. coli transformation, and plasmid extraction were performed as described in Methods 2, 3, and 4 above.
[0169] Ubi+sacI_bamHI (SEQ ID NO.9, where the uppercase letters indicate the restriction site and homology arm sequence, and the lowercase letters indicate the cloned sequence):
[0170]
[0171] 2) The wild-type fragments of intron 5 and intron 7 of the Wx gene were synthesized by the company and ligated into the SacI / bamHI sites of Pubi-luc using T4 ligase (refer to methods 1, 3, and 4 above for the ligation system and transformation), constructing Wx5-luc and Wx7-luc (SEQ ID NO. 12, SEQ ID NO. 13) for subsequent mutant intron ligation.
[0172] SEQ ID NO.10: Original sequence of intron 5 (including branch points, underlined):
[0173] gtgagttacaattgatctcaagatcttataactttcttcgaaggaatcca tgatgatcagactaattc ct tccggtttgttactgacaacag
[0174] SEQ ID NO.11: Original sequence of intron 7 (including branch points, underlined):
[0175] gtaagattctaagagtaacttactgtcaattcgccatatatcgattcaatccaagatcc ttttgagct gacaaccctgc actactgtccatcgttc aaatccggttaaatttcag
[0176] SEQ ID NO.12: Intron 5 (BsaI restriction site, sacI and BamHI sites added, where the underlined capital letters indicate the restriction sites at both ends, and the bold letters indicate the internal BsaI restriction site):
[0177]
[0178] SEQ ID NO.13: Intron 7 (BsaI restriction site, sacI and BamHI sites added, where the underlined capital letters indicate the restriction sites at both ends, and the bold letters indicate the internal BsaI restriction site):
[0179]
[0180] 3) Vector construction based on the BS site of the Wx gene intron branch point
[0181] Because dual-target gene knockout was required to edit introns 5 and 7 of the Wx gene, we screened for suitable NGG-containing PAM sequences and designed a total of 10 mutant intron sequences covering the branch points, including two intron 5 and eight intron 7. We commissioned a biotechnology company to synthesize oligonucleotides for all 10 Wx gene intron mutant sequences (see Table 7). After denaturation and annealing, the two single-stranded oligos were ligated into the Wx5-luc / Wx7-luk vector using T4 and transformed into E. coli to obtain positive clones (see Methods 1, 3, and 4 above).
[0182] Table 7 Mutant junction fragment sequences
[0183]
[0184] After the relevant plasmids were extracted (method 4 above), they were used for rice protoplast transformation (method 5 above) and dual fluorescein detection (method 6 above). The results showed that ( Figure 2 ) Except for 5m2, all other target combinations on introns 5 and 7 could reduce the luciferase content to varying degrees when transiently expressed.
[0185] 2.3Wx intron knockout vector construction and transformation
[0186] The mutant types with the above-mentioned expression changes, Wx5-m1, Wx7-m4, and Wx7-m6, were selected for subsequent rice editing. When using CRISPR / Cas9 gene editing, the published plant gene editing vector PHUE411 (10.1186 / s12870-014-0327-y) was used for construction. Universal primer sequences were added before and after the target to obtain specific amplification primers containing the target (Table 8). Using the universal plasmid PCBC-MT1T2 as a template, PCR amplification can obtain primers containing the target and sgRNA (the template plasmid and method are as described in the PHUE411 published paper). The primers were then connected to the PHUE411 vector through the T4 cut-and-ligate system, and the recombinant plasmid was transformed into the competent E. coli to obtain the PHUE411 plasmid containing the knockout target (the connection method is the same as the above methods 1, 3, and 4).
[0187] Table 8 Primer details
[0188]
[0189] The plasmid was transformed into Agrobacterium using the liquid nitrogen freeze-thaw method, and then transformed into the high-amylose indica conventional rice variety, Teqing (Wx-a), according to the method described in Method 7 above. DNA was extracted from the gene-edited plants and PCR amplified the target region sequence (primers are shown below). PCR and alignment were performed according to Method 8 above, and the mutation was analyzed by first-generation sequencing.
[0190] Wx5-cas-seq-F:AGGTTTTTCCATTGCTACAAGCGT(SEQ ID NO.40)
[0191] Wx5-cas-seq-R:CCTGGTAGGAGATGTTGTGGATG(SEQ ID NO.41)
[0192] Wx7-cas-seq-F:CAGGTTGCTTTCTGCATCCACAAC(SEQ ID NO.42)
[0193] Wx7-cas-seq-R:TGTTCCTCCAGCCTGCCGATGAAC(SEQ ID NO.43)
[0194] A total of 11 rice mutants were found. Among them, one type, 5in1-1, was derived from the Wx5-m1-ko mutant vector ( Figure 3 A), 1 type of 7in6-1 derived Wx7-m6-ko mutant vector ( Figure 3 B). The other 9 types 7in4-1 to 7in4-9 are Wx7-m4-ko ( Figure 4 ) mutation vector. The above mutants all produced small deletion mutations around the branch point BS, with sizes ranging from 2 to 43 bp.
[0195] The 11 rice mutants and their sequences are as follows:
[0196] 5in1-1: homozygous, the mutation site of both chromosomes is the same, and the sequence of both chromosomes is TCTCAAGATCT TATAACTTTCTTTTCCGGTTTG (SEQ ID NO. 44).
[0197] 7in6-1: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AGATTCAAA TCCGGTTA (SEQ ID NO.45) and AGATTTGAGCTGACAACCCTGCACTACTGTCCATCGTTCAAATCCGGTTA (SEQ ID NO.46), respectively.
[0198] 7in4-1: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AATCCAAGA TCCTTTTGCTGACAACCCTGCACTACTGTCCATCGTAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO.47) and AATCCAAGATCCTTTTTGTGACAACCCTGCACTACTGTGGAGGGCAGGAAG (SEQ ID NO.48), respectively.
[0199] 7in4-2: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AATCCAAGA TCCTTTTACAACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO.49) and AATCCAAGATCCTTTGCTGACAA CCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGA GGGCAGGAAG (SEQ ID NO.50), respectively.
[0200] 7in4-3: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AATCCAAGA TCCTTTTGTGACAACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO.51) and AATCCAAGATCCTTTTTGTGAC AACCCTGCACTACTGTCCATCGATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGG GCAGGAAG (SEQ ID NO.52), respectively.
[0201] 7in4-4: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AATCCAAGA TCCTTTTGACAACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO.53) and AATCCAAGATCCTTTTTGCTGAC AACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTG GAGGGCAGGAAG (SEQ ID NO.54), respectively.
[0202] 7in4-5: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AATCCAAGA TCCTTTTCCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO.55) and AATCCAAGATCCTTTTTGACAACCCTGCA CTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAG GAAG (SEQ ID NO.56), respectively.
[0203] 7in4-6: homozygous, the mutation site of both chromosomes is the same, and the sequence of both chromosomes is AATCCAAGATT CAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO. 57).
[0204] 7in4-7: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AATCCAAGA TCCTTTTGACAACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO.58) and AATCCAAGATCCTTTTTGCTGAC AACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTG GAGGGCAGGAAG (SEQ ID NO.59), respectively.
[0205] 7in4-8: heterozygote, the mutation sites of the two chromosomes are different, and the sequences of the two chromosomes are AATCCAAGA TCCTTTTAACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO.60) and AATCCAAGATCCTTTTTGACAACCCT GCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGC AGGAAG (SEQ ID NO.61), respectively.
[0206] 7in4-9: homozygous, the mutation site of both chromosomes is the same, and the sequence of both chromosomes is AATCCAAGATC CTTTTTGACAACCCTGCACTACTGTCCATCGTTCAAATCCGGTTAAATTTCAGGTATGACACGCCGGTGGAGGGCAGGAAG (SEQ ID NO. 62).
[0207] 2.4 Effect of CRISPR / Cas9-mediated Wx gene knockout on expression
[0208] In order to verify whether the expression of Wx gene in intron mutant materials is affected, fluorescent quantitative primers across intron 5 and intron 7 of Wx gene were designed to verify the expression of Wx. Figure 5 It can be seen that the expression of 7in4-1, 7in4-2, 7in4-3, and 7in4-5 was not affected. The expression of 7in4-4, 7in4-6, 7in4-7, 7in4-8, 7in4-9, and 5in1-1 was significantly downregulated, while the expression of 7in6-1 was significantly increased.
[0209] By extracting the mutant seed Wx protein, it was used to prove whether the intron knockout of the Wx gene would affect its protein expression. The wild-type Teqing (Wxa), glutinous rice (Wx) and FXZ (Wxb) were used as controls for protein staining. Figure 6 ) showed that the protein expression of the Wx gene was downregulated to varying degrees when the intron was knocked out, which was consistent with the qPCR results.
[0210] 2.5 Rice quality determination of CRISPR / Cas9-mediated Wx gene knockout mutants
[0211] The rice quality of the 11 different knockout rice plants was tested, including amylose content, alkali digestibility, and gel consistency. The results showed that compared with Teqing (wild type), the KI staining results of the 11 mutants were different, among which 7in4-9 showed the most obvious change, with a significantly reduced degree of staining ( Figure 7 ); Similarly, the amylose content also decreased to varying degrees, with 7in4-9 showing the highest decrease, with only 8.2% amylose (soft rice), while the amylose content of 7in4-7 and 7in4-8 decreased to 15.3-17.9%, which is comparable to the amylose content of Wx-b japonica rice. The amylose content of 7in4-4 decreased to 12.3%, which is between the soft rice and Wx-b types. The gel consistency of the mutant plants also increased to varying degrees compared with Teqing (wild type), with 7in4-9 showing the most significant change, with the increase being roughly twice that of the wild type ( Figure 8 The alkali digestibility of the mutant plants did not change significantly compared to the wild type, indicating that changes in Wx gene expression mainly affected the amylose content and gel consistency, and had little effect on the alkali digestibility of Teqing ( Figure 9 ).
[0212] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.
Claims
1. A method for preparing rice mutants based on Wx gene intron branch point editing, characterized in that: The method comprises the following steps: S1: Analysis of the Wx intron structure yielded the branch point BS sequences containing the conserved branch point A on introns 5 and 7; S2: Design a double knockout target combination on introns 5 and 7, construct it into a luciferase expression vector, and then transiently express it in rice protoplasts to detect the efficiency of intron splicing after mutation; S3: Mutation types with decreased expression levels were selected for rice editing, and Wx intron knockout vectors were constructed and transformed, finally obtaining 11 rice mutants.
2. The method for preparing a rice mutant according to claim 1, wherein: The branch point BS sequences obtained on introns 5 and 7 in step S1 are SEQ ID NO. 7 and SEQ ID NO.
8.
3. The method for preparing a rice mutant according to claim 2, characterized in that: The step S2 comprises the following steps: S2-1: Construction of the firefly luciferase expression vector Pubi-luc driven by the Ubi promoter; S2-2: The wild-type fragments of introns 5 and 7 were ligated into the SacI / bamHI sites of Pubi-luc to construct Wx5-luc and Wx7-luc; S2-3: Design and synthesize a mutant linker fragment covering the branch point, ligate it to Wx5-luc / Wx7-luk, and transform to obtain positive clones.
4. The method for preparing a rice mutant according to claim 3, characterized in that: The step S2-1 includes using the fragment Ubi+sacI_bamHI containing the Ubi promoter, the sequence of which is shown in SEQ ID NO.
9.
5. The method for preparing a rice mutant according to claim 3, wherein: The sequences of Wx5-luc and Wx7-luc in step S2-2 are shown in SEQ ID NO.12 and SEQ ID NO.
13.
6. The method for preparing a rice mutant according to claim 3, characterized in that: The sequences of the mutant connection fragments in step S2-3 are shown in SEQ ID NO.14 to SEQ ID NO.
33.
7. The method for preparing a rice mutant according to claim 3, wherein: The specific amplification primer sequences used for rice editing in step S3 are shown as SEQ ID NO.34 to SEQ ID NO.
39.
8. The method for preparing a rice mutant according to claim 7, characterized in that: The sequences of the 11 rice mutants in step S3 are shown as SEQ ID NO. 44 to SEQ ID NO.
62.
9. Use of the method for preparing a rice mutant according to any one of claims 1 to 8 in rice cultivation.
10. The use according to claim 9, characterized in that The application includes application in breeding new rice varieties and / or new strains with low amylose content and / or high gel consistency.