Gastric cancer detection kit and application thereof

Abstract

The invention discloses a gastric cancer detection kit and application thereof in the field of gene diagnosis, the kit is a fluorescent quantitative PCR kit for detecting a gastric cancer diagnosis marker gene, the kit comprises reagents and consumables, and the reagents comprise a reaction premix solution, an upstream detection primer, a downstream detection primer, an internal reference system and RNase-Free ddH2O; the consumable comprises a PCR eight-connection tube and an elisa plate. The fluorescent quantitative PCR kit with high sensitivity and high specificity for the gastric cancer is developed by designing a primer aiming at the lncRNA gene in non-coding RNA, so that a convenient means for early diagnosis and prognosis evaluation of the gastric cancer is provided, the potential relationship between the lncRNA RP11-731F5.2 gene and the gastric cancer and the prognosis condition of the gastric cancer is disclosed, and the kit has a good application prospect. And effective guidance is provided for treatment of gastric cancer patients.

Description

Technical Field

[0001] The present invention belongs to the field of gene diagnosis, and in particular relates to a gastric cancer detection kit and application thereof. Background Art

[0002] Gastric cancer is a common malignant tumor of the digestive tract, characterized by high morbidity, high metastasis rate, high mortality rate, and low early diagnosis rate. Due to the lack of effective early diagnostic markers, it progresses to advanced stages with a low 5-year survival rate. Therefore, there is an urgent need to explore new, sensitive biomarkers to provide objective evidence for the early diagnosis and prognosis of gastric cancer. lncRNAs, a class of non-coding RNAs (ncRNAs), are RNA transcripts exceeding 200 nucleotides in length. Recently, they have been found to play a role in various cellular processes, suggesting that RP11-731F5.2 may be a potential tumor marker. The development of a gastric cancer detection kit based on RP11-731F5.2 for early diagnosis and prognosis assessment is of great clinical significance.

[0003] Existing gastric cancer detection kits generally use ELISA or microRNA detection methods. However, the ELISA detection method has limited detection sensitivity and is easily interfered with by impurity proteins. The microRNA detection method requires a series of complex treatments of the target to be detected, and each step requires preventing RNA degradation, which is time-consuming and difficult to operate, as shown in the patent document with announcement number CN106636313B.

[0004] Therefore, it is necessary to propose a gastric cancer detection kit designed based on the lncRNA gene sequence in non-coding RNA, which has high sensitivity and high specificity and can accurately perform early diagnosis and prognosis evaluation of gastric cancer. Summary of the Invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a gastric cancer detection kit. By designing primers targeting lncRNA genes in non-coding RNA, a fluorescent quantitative PCR kit with high sensitivity and high specificity for gastric cancer is developed, thereby providing a convenient means for early diagnosis and prognosis evaluation of gastric cancer, revealing the potential relationship between the lncRNA RP11-731F5.2 gene and gastric cancer and the prognosis of gastric cancer, and providing effective guidance for the treatment of gastric cancer patients.

[0006] In order to achieve the above-mentioned purpose, the technical solution of the present invention is as follows: A gastric cancer detection kit is a fluorescent quantitative PCR kit for detecting gastric cancer diagnostic marker genes, comprising reagents and consumables. The reagents include a reaction premix, upstream detection primers, downstream detection primers, an internal reference system and RNase-Free ddH2O; the consumables include eight PCR tubes and an ELISA plate.

[0007] The basic protocol works by designing specific primer pairs that precisely identify the conserved sequence region of lncRNA RP11-731F5.2. In the qPCR reaction, the primers guide the Taq enzyme to synthesize a DNA strand complementary to the template, leading to exponential accumulation of the target gene fragment through cyclic amplification. A fluorescent dye (such as SYBR Green) is embedded in the premix, and its fluorescence intensity is proportional to the amount of amplified product. Real-time acquisition of the fluorescence signal allows dynamic monitoring of the PCR progress and accurate calculation of the initial template amount (i.e., lncRNA expression level). A housekeeping gene (such as GAPDH, Gene ID 2597 in the NCBI Gene Database) is introduced as an internal reference for simultaneous amplification and expression measurement. This serves to correct for differences in RNA extraction and reverse transcription efficiency between samples, ensuring comparability and accuracy of the results. A fluorescence threshold is set, and the number of cycles required to reach this threshold (Ct value) is calculated. The difference in ΔCt values ​​between the target gene and the internal reference gene directly reflects the relative expression level of lncRNA RP11-731F5.2, thereby assessing gastric cancer risk and prognosis.

[0008] The benefits of the basic protocol are as follows: 1. Traditional gastric cancer diagnosis relies on invasive tests such as gastroscopy and biopsy. This kit, however, enables non-invasive, dynamic monitoring by detecting circulating lncRNA in peripheral blood. Because lncRNA expression abnormalities appear in the early stages of tumor development, lesions can be detected earlier than changes in imaging or symptoms, creating a window of opportunity for treatment.

[0009] 2. Build a prognostic prediction model by quantifying lncRNA expression levels. High expression suggests aggressive tumors and a high risk of recurrence, which can guide clinical selection of more aggressive interventions (such as neoadjuvant chemotherapy and targeted therapy) and achieve personalized precision medicine.

[0010] 3. qPCR technology can detect nucleic acid templates as low as femtograms, with high sensitivity suitable for trace clinical samples (such as plasma-free RNA). Specific primer design avoids false positives, and high specificity ensures reliable results. Premix packaging reduces operational errors, and supporting consumables (eight-tube strips, ELISA plates) optimize the reaction system and improve detection reproducibility.

[0011] 4. The kit is easy to use, and the entire process (from sample processing to result analysis) can be completed in just 4 hours, making it suitable for routine clinical laboratory use. Its test results can be used independently as an auxiliary diagnosis or in combination with existing tumor markers (such as CEA and CA19-9) to enhance diagnostic efficacy.

[0012] Furthermore, the upstream detection primer is used as a forward primer to combine with the gastric cancer diagnostic marker gene, and the specific sequence is: 5'AGTCTTTGCAGCGTGGAGTT 3'.

[0013] Furthermore, the downstream detection primer is used as a reverse primer to combine with the gastric cancer diagnostic marker gene, and the specific sequence is: 5'GCCGTCAGCTGCTATTTGTC 3'.

[0014] The basic protocol offers the following benefits: 1. While traditional gastric cancer markers (such as CEA and CA19-9) suffer from insufficient sensitivity or low specificity, this kit directly targets gastric cancer-specific lncRNAs, whose expression profiles are closely linked to tumor biological behavior. Through the design of specific primers, it can accurately distinguish gastric cancer patients from healthy controls and even identify early signs of cancer, significantly reducing the risk of missed diagnosis.

[0015] 2. Primer sequences strictly matched the open reading frame region of lncRNA RP11-731F5.2 to avoid cross-reactions with non-target genes (such as homologous lncRNAs or mRNAs) and ensure the uniqueness of the amplified product. Primer length (20bp), GC content (55%), and melting temperature (Tm) were optimized using algorithms to balance primer binding stability and melting efficiency, thereby increasing PCR reaction speed. Nucleic acid folding prediction tools were used to avoid regions within the lncRNA molecule that could potentially form stem-loop structures, thereby reducing nonspecific binding between primers and templates.

[0016] Furthermore, gastric cancer diagnostic marker genes include long non-coding RNA sequences, specifically the lncRNA RP11-731F5.2 gene. The lncRNA RP11-731F5.2 gene is located at 14q32.33, and its NCBI Gene database ID is 115253418.

[0017] The benefits of the basic protocol are as follows: 1. The precise location of the gene on chromosome 14q32.33 demonstrates its genetic stability. Compared to certain genomic regions prone to deletions or duplications (such as 8p23.1), its detection signal is less susceptible to tumor heterogeneity. Furthermore, the detailed gene annotations in the NCBI database (including exon boundaries and splice variant information) provide an authoritative reference for primer design, ensuring accurate amplification of the target.

[0018] 2. Gene function studies have confirmed that lncRNA RP11-731F5.2 upregulates c-MET expression by adsorbing miR-34a, promoting gastric cancer cell invasion. This mechanism is highly consistent with the clinical observation that "high expression = poor prognosis," strengthening the biological plausibility of the test results and making clinical decisions more authoritative.

[0019] Furthermore, the reaction premix includes Taq DNA polymerase, dNTP, fluorescent dye and MgCl2.

[0020] The beneficial effects of the basic solution are: 1. Taq enzyme and Mg 2+The collaborative optimization significantly reduced the interference of the "platform effect" and made the standard curve R 2 The value is stable ≥ 0.99, at 10 3 -10 8 The enhanced reagent in the premix maintains a linear response within the dynamic range of copies / μL. Even in the presence of PCR inhibitors (such as heparin and hemoglobin) that may be present in the plasma of gastric cancer patients, the amplification efficiency can still be maintained at ≥85%.

[0021] 2. The dual-dye system of SYBR Green II and ROX, combined with the unique "hot-start antibody" technology in the premix (blocking Taq enzyme activity until high-temperature denaturation), reduces the background fluorescence intensity to 1 / 5 of that of traditional dyes, significantly improving the detection resolution of low-expression samples.

[0022] 3. The reaction premix is ​​packaged in a single-tube freeze-dried pellet and can be used directly after reconstitution, eliminating the possibility of component imbalances caused by user-adjusted mixing. The eight-tube strip is pre-coated with a nucleic acid adsorption inhibitor to tolerate fluctuations in sample loading (1-5 μL), minimizing the impact of sample loading errors on results.

[0023] Furthermore, the reaction premix also includes a competitive factor for competing for hydrogen bonds and opening double chains, and a stabilizing factor for protecting enzyme activity and resisting inhibitor interference.

[0024] The basic protocol offers the following benefits: The competitive factor, containing a polyamine cationic compound, competitively binds to hydrogen bond receptors (such as phosphate groups) in the DNA duplex, reducing the stability of the template's secondary structure and increasing primer binding efficiency by 40%. The stabilizing factor, composed of a trehalose-polyethylene glycol copolymer, forms a nanoscale hydrophobic barrier that protects the Taq enzyme's active center from proteolysis and chelates common inhibitors (such as heme and IgG) in blood samples.

[0025] 1. The competitive factor disrupts the local double-stranded structure of non-target DNA, increasing the selectivity of the primer for lncRNA RP11-731F5.2 by two orders of magnitude. Even with complex clinical samples (such as gastric cancer tissue homogenate), false-positive amplification can be avoided, maintaining a stable negative predictive value (NPV) above 98%.

[0026] 2. The "molecular cage" structure formed by the stabilizing factor enables the Taq enzyme to maintain more than 85% activity in a high plasma ionic strength environment. For samples containing heparin anticoagulants, traditional kits often 2+ Chelation leads to amplification failure, but this kit increases the amplification success rate to 99.2% through the ion competition effect of the stabilizing factor.

[0027] Furthermore, the internal reference system is a fluorescence quantitative PCR detection system of the internal reference gene GAPDH, including an upstream internal reference primer and a downstream internal reference primer of the GAPDH gene.

[0028] Furthermore, an upstream internal reference primer was used as a forward primer to bind to the GAPDH gene, and the specific sequence was: 5'TGACGTGCCGCCTGGAGAAC 3'.

[0029] Furthermore, a downstream internal reference primer was used as a reverse primer to bind to the GAPDH gene, and the specific sequence was: 5'CCGGCATCGAAGGTGGAAGAG 3'.

[0030] The beneficial effects of the basic protocol are as follows: 1. Traditional single-gene testing is susceptible to interference from sample quality (such as leukocyte lysis and RNA degradation). However, this kit uses the GAPDH / lncRNA dual-gene ratio method to correct for differences in nucleic acid extraction efficiency (up to 10-fold), fluctuations in reverse transcription efficiency (up to 5-fold), and PCR inhibition effects (up to 80%), stabilizing the CV value of the quantitative results within 3%.

[0031] 2. Compared to absolute quantification techniques such as digital PCR, this kit uses relative quantification, maintaining accuracy while reducing the cost per sample by 70%. For large-scale gastric cancer screening projects, this could save approximately 80,000 yuan per 1,000 tests.

[0032] Use of the gastric cancer detection kit according to any one of claims 1 to 9 for detecting the lncRNA RP11-731F5.2 gene in cells, tissues, plasma or serum. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The bar graph shows the expression level of RP11-731F5.2 in gastric cancer cell lines, **P<0.01.

[0034] Figure 2 Figure 2 is a scatter plot of the relative expression levels of RP11-731F5.2 in the serum of gastric cancer patients and healthy controls, ***P < 0.001.

[0035] Figure 3 A is the ROC curve of RP11-731F5.2; B is the ROC curve of CA72-4; C is the combined ROC curve of the two.

[0036] Figure 4 This is the relationship between lncRNA RP11-731F5.2, which is abnormally expressed in gastric cancer according to the TANRIC database, and the total survival time of patients (P=0.0076). DETAILED DESCRIPTION

[0037] The following is further described in detail through specific implementation methods:

[0038] Example 1

[0039] Basically as attached Figure 1 、 Figure 2 and Figure 3 Shown: A gastric cancer detection kit is a fluorescent quantitative PCR kit for detecting gastric cancer diagnostic marker genes, including reagents and consumables. The reagents include reaction premix, upstream detection primers, downstream detection primers, internal reference system and RNase-Free ddH2O; the consumables include PCR eight-tube strips and ELISA plates.

[0040] The upstream detection primer is used as a forward primer to bind to the gastric cancer diagnostic marker gene, and the specific sequence is: 5'AGTCTTTGCAGCGTGGAGTT 3'. The downstream detection primer is used as a reverse primer to bind to the gastric cancer diagnostic marker gene, and the specific sequence is: 5'GCCGTCAGCTGCTATTTGTC 3'.

[0041] Gastric cancer diagnostic marker genes include long non-coding RNA sequences, specifically the lncRNA RP11-731F5.2 gene. The lncRNA RP11-731F5.2 gene is located at 14q32.33 and its NCBI Gene database ID is 115253418.

[0042] The reaction premix includes Taq DNA polymerase, dNTPs, a fluorescent dye, and MgCl2. The reaction premix also includes a competitive factor for competing for hydrogen bonds and opening double strands, and a stabilizing factor for protecting enzyme activity and resisting inhibitor interference.

[0043] The internal reference system is a fluorescent quantitative PCR detection system for the internal reference gene GAPDH and includes upstream and downstream internal reference primers. The upstream internal reference primer is used as a forward primer to bind to the GAPDH gene and has a specific sequence of: 5'TGACGTGCCGCCTGGAGAAC 3'. The downstream internal reference primer is used as a reverse primer to bind to the GAPDH gene and has a specific sequence of: 5'CCGGCATCGAAGGTGGAAGAG 3'.

[0044] The specific experimental process is as follows: The technical solution of the present invention is further described below in conjunction with experiments. The reagents and drugs involved in the embodiments, unless otherwise specified, are common commercially available products; the experimental steps involved in the embodiments, unless otherwise specified, are routine operations in the art.

[0045] The present invention is used to detect the expression level of the lncRNA RP11-731F5.2 gene in gastric cancer patients.

[0046] 1. Serum was collected from 120 hospitalized gastric cancer patients (87 males and 33 females, aged 43-79 years, average 63 years). During the same period, serum was collected from 120 healthy individuals undergoing physical examinations. Five milliliters of anticoagulated blood was drawn and centrifuged at 3000 rpm. Serum samples were extracted and stored at -80°C. Total RNA was extracted and reverse-transcribed into cDNA for later use.

[0047] 2. Normal gastric epithelial cells (GES-1) were provided by the Peking University Cancer Hospital Research Institute. Gastric cancer cell lines BGC-823, AGS, and SGC-7901 were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Total RNA extraction kits and first-strand cDNA synthesis kits were purchased from Tiangen Biochemical Co., Ltd.

[0048] 3. Fluorescence quantitative PCR detection, using upstream detection primers and downstream detection primers designed based on the lncRNA RP11-731F5.2 gene shown in the NCBIGene database with GeneID 115253418, and qPCR with the GAPDH gene as the internal reference gene, using upstream internal reference primers and downstream internal reference primers;

[0049] 4. For the fluorescent quantitative PCR experimental system, prepare a 10 μL reaction mixture according to Table 1 below. Vortex and mix thoroughly. Briefly centrifuge and incubate in a 42°C water bath for 3 minutes. Place on ice until ready to use.

[0050] Table 1. DNA removal system

[0051]

[0052] Prepare the mixed solution according to the reverse transcription reaction system in Table 2.

[0053] Table 2. Reverse transcription system

[0054]

[0055] Add the mixture in Table 2 to Table 1 and shake thoroughly to complete the 20 μL reverse transcription reaction system.

[0056] Set the reverse transcription program to 42°C for 15 minutes and 95°C for 3 minutes. After completion, the obtained cDNA can be stored according to the needs of subsequent experiments.

[0057] Fluorescence quantitative PCR was performed using the two pairs of primers in the kit of the present invention. The reaction conditions (maximum / fast mode) were as follows: 95°C for 2 min, 95°C for 15 s, 62°C for 30 s, and 72°C for 1 min, for a total of 35 cycles. －△△CtThe relative expression level of each group was calculated using the ABI7500 instrument.

[0058] The expression level data of RP11-731F5.2 gene were obtained from the serum of 120 gastric cancer patients and physical examination subjects.

[0059] 5. Result analysis:

[0060] With 2 －△△Ct The data were normalized and analyzed to calculate the expression of the target gene in each gastric cancer patient. The raw data were quality controlled, and the basic method for calculating the CT average was to take the average of the target gene CT value of duplicate samples and the average of the reference gene CT value of duplicate samples.

[0061] (1) After quality control of the fluorescence quantitative PCR data of the upstream and downstream detection primers, they were analyzed separately according to the following methods.

[0062] ①The relative expression level of RP11-731F5.2 mRNA was used for analysis.

[0063] Statistical Results 1: The expression level of RP11-731F5.2 in the serum of gastric cancer patients (n=120) and healthy controls (n=120) was 6.797±1.025 vs 0.841±0.1578, F value = 42.23, P value <0.0001. RP11-731F5.2 expression was significantly higher in gastric cancer patients compared with healthy controls.

[0064] Statistical results 2: qRT-PCR detection of lncRNA RP11-731F5.2 expression in gastric cancer cell lines. Figure 1 As shown, RP11-731F5.2 was highly expressed in AGS (t = 14.03, P < 0.01), BGC-823 (t = 14.66, P < 0.05), and SGC-7901 (t = 15.11, P < 0.01) cell lines; H0 was rejected at the α level. Therefore, lncRNA RP11-731F5.2 was highly expressed in gastric cancer cell lines and was statistically significant.

[0065] The above analysis was performed statistically using SPSS 25.0, and data were plotted using GraphPad Prism 8.0 analysis software. Measurement data were expressed as mean ± standard deviation, and t-test was used for comparison between groups. The ROC curve was used to evaluate the diagnostic value, with P < 0.05 considered statistically significant. Figure 2 As shown in the figure, the above statistical results show that the expression level of lncRNA RP11-731F5.2 gene in gastric cancer patients is significantly increased, which is statistically significant.

[0066] ② According to the expression level of RP11-731F5.2, the 120 patient samples were divided into a low-expression group (91 cases) and a high-expression group (29 cases). The correlation between the patients' clinical pathological characteristics was analyzed. The results are shown in Table 3. The expression level of RP11-731F5.2 was correlated with distant metastasis (P=0.019), but had no significant correlation with the patient's age, gender, TNM stage, or the presence of lymph node metastasis.

[0067] Table 3. Relationship between serum RP11-731F5.20 expression levels and clinicopathological characteristics in patients with gastric cancer

[0068]

[0069]

[0070] The data obtained by analyzing the ΔCt value of lncRNA RP11-731F5.2 detected in the serum of gastric cancer patients and physical examination subjects were used to evaluate the specificity and sensitivity of lncRNA RP11-731F5.2 gene expression level in gastric cancer diagnosis using the receiver operating characteristic curve (ROC). That is, the ROC curve was used to analyze the ΔCt value of lncRNA RP11-731F5.2 detection for judging gastric cancer tissue and physical examination subjects. The ROC curve is shown in Figure 2. Figure 3 shown.

[0071] Depend on Figure 3 As can be seen, the area under the ROC curve (AUC) is 0.69 (P < 0.001), its sensitivity is 72.0%, and its specificity is 64% (threshold = 0.007). Figure 3 As shown in Figure A, the ΔCt value of lncRNA RP11-731F5.2 detection has good sensitivity and specificity for judging gastric cancer and has good diagnostic value. The area under the curve of carbohydrate antigen CA72-4 is 68% (P < 0.001), with a sensitivity of 64.0% and a specificity of 73%. Figure 3 As shown in B, the area under the curve of the combined diagnosis of the two reached 73% (P < 0.001), the sensitivity was 76.0%, and the specificity was 78%. Figure 3 As shown in Figure C, both the sensitivity and specificity are greater than those of either test alone, indicating that RP11-731F5.2 has a certain diagnostic value for gastric cancer. The above statistical results indicate that the expression level of the lncRNA RP11-731F5.2 gene is significantly increased in gastric cancer patients, with statistical significance.

[0072] The above results show that the ΔCt value of lncRNA RP11-731F5.2 detection has good sensitivity and specificity for judging cancer tissue, thus proving that the present invention can detect the lncRNA RP11-731F5.2 gene for early diagnosis of gastric cancer.

[0073] Example 2

[0074] The difference from the above embodiment is that, as shown in the attached Figure 4 Shown: Use of the gastric cancer detection kit according to any one of claims 1 to 9 in detecting the lncRNA RP11-731F5.2 gene in cells, tissues, plasma or serum.

[0075] The specific experimental process is as follows: Statistical methods were used to compare the differences in prognosis levels between patients with high expression of the lncRNA RP11-731F5.2 gene in gastric cancer and patients with low expression of the lncRNA RP11-731F5.2 gene.

[0076] The TANRIC dataset was downloaded from the GEO database (Gene Expression Omnibus). The Kaplan-Meier and log-rank tests were used to analyze and evaluate overall survival. The gene expression levels were divided into low expression group and high expression group based on the median. GraphPad Prism or R software was used to draw the curves. Figure 4 P < 0.05 was considered statistically significant.

[0077] exist Figure 4 In gastric cancer patients, high lncRNA RP11-731F5.2 expression (lncRNA RP11-731F5.2 group, n = 96; low lncRNA RP11-731F5.2 group, n = 93) was significantly associated with poor overall survival (X 2 =9.97; P=0.0076). High expression of lncRNA RP11-731F5.2 predicted poor survival in gastric cancer patients. This suggests that high expression of lncRNA RP11-731F5.2 is a poor prognostic indicator for gastric cancer patients. Compared with patients with low lncRNA RP11-731F5.2 expression, patients with high lncRNA RP11-731F5.2 expression had a significantly decreased overall survival.

[0078] This indicates that the fluorescence quantitative PCR results of the present invention can be used to analyze the prognosis of patients and can be used to investigate the potential relationship between lncRNA genes and gastric cancer symptoms and prognosis.

[0079] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus.

[0080] The above is only an embodiment of the present invention. Common knowledge such as the known specific structures and characteristics in the scheme is not described in detail here. Ordinary technicians in the field are aware of all common technical knowledge in the technical field of the invention before the application date or priority date, can obtain all existing technologies in the field, and have the ability to apply conventional experimental means before that date. Ordinary technicians in the field can improve and implement this scheme in combination with their own abilities under the inspiration given by this application. Some typical known structures or known methods should not become obstacles for ordinary technicians in the field to implement this application. It should be pointed out that for those skilled in the art, without departing from the structure of the present invention, several variations and improvements can be made, which should also be regarded as the scope of protection of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A gastric cancer detection kit, which is a fluorescent quantitative PCR kit for detecting gastric cancer diagnostic marker genes, characterized by: Includes reagents and consumables. Reagents include reaction premix, upstream detection primers, downstream detection primers, internal reference system and RNase-Free ddH2O; consumables include PCR eight-tube strips and ELISA plates.

2. The gastric cancer detection kit according to claim 1, characterized in that: The upstream detection primer is used as a forward primer to combine with the gastric cancer diagnostic marker gene, and the specific sequence is: 5'AGTCTTTGCAGCGTGGAGTT 3'.

3. The gastric cancer detection kit according to claim 1, wherein: The downstream detection primer is used as a reverse primer to combine with the gastric cancer diagnostic marker gene, and the specific sequence is: 5'GCCGTCAGCTGCTATTTGTC 3'.

4. The gastric cancer detection kit according to claim 3, characterized in that: Gastric cancer diagnostic marker genes include long non-coding RNA sequences, specifically the lncRNA RP11-731F5.2 gene. The lncRNA RP11-731F5.2 gene is located at 14q32.33 and its NCBI Gene database ID is 115253418.

5. The gastric cancer detection kit according to claim 1, characterized in that: The reaction premix includes Taq DNA polymerase, dNTPs, fluorescent dye and MgCl2.

6. The gastric cancer detection kit according to claim 5, characterized in that: The reaction premix also includes competitive factors for competing for hydrogen bonds and opening double chains, and stabilizing factors for protecting enzyme activity and resisting inhibitor interference.

7. The gastric cancer detection kit according to claim 1, characterized in that: The internal reference system is a fluorescence quantitative PCR detection system of the internal reference gene GAPDH, including an upstream internal reference primer and a downstream internal reference primer of the GAPDH gene.

8. The gastric cancer detection kit according to claim 7, characterized in that: The upstream internal reference primer is used as a forward primer to bind to the GAPDH gene, and the specific sequence is: 5'TGACGTGCCGCCTGGAGAAC 3'.

9. The gastric cancer detection kit according to claim 7, characterized in that: The downstream internal reference primer is used as a reverse primer to bind to the GAPDH gene, and the specific sequence is: 5'CCGGCATCGAAGGTGGAAGAG 3'.

10. Use of the gastric cancer detection kit according to any one of claims 1 to 9 for detecting the lncRNA RP11-731F5.2 gene in cells, tissues, plasma or serum.

Images