Method and kit for rapidly detecting beef quality traits assisted by SNP (Single Nucleotide Polymorphism) marker of ChREBP gene and application of method and kit

Abstract

The invention belongs to the field of molecular genetics, and particularly relates to screening and detection of Anhui local variety cattle gene single nucleotide polymorphism as a molecular genetic marker, in particular to a method for rapidly detecting beef quality traits based on assistance of a ChREBP gene SNP marker and application of the method. The nucleotide sequence of the SNP marker of the ChREBP gene is as shown in SEQ ID NO.1, and when the 152nd basic group from the 5'end of the SNP molecular marker is A, the meat color brightness and shearing force of beef are higher than those of beef when the 152nd basic group is G. The molecular marker provided by the invention can be used for assisted selective breeding, provides basic data for molecular marker assisted selective breeding of Anhui local variety cattle, and can promote the germplasm resource improvement process of Anhui local variety cattle.

Description

Technical Field

[0001] The present invention belongs to the field of molecular genetics, and specifically relates to the screening and detection of single nucleotide polymorphisms (SNPs) of Anhui local breed cattle genes as molecular genetic markers, and particularly relates to a method for detecting the genetic polymorphisms of Anhui local breed cattle genes. ChREBP A method and kit for detecting gene SNP and their application in beef quality traits. Background Art

[0002] Molecular remote markers, also known as molecular markers, are a type of biological genetic marker. Based on DNA fragment length polymorphism caused by species mutations, they can identify specific DNA fragments that reflect certain differences in the genomes of individuals or populations. They offer advantages such as high genetic diversity, strong stability, and minimal environmental impact, making them widely used in animal genetics and breeding.

[0003] Single nucleotide polymorphisms (SNPs) refer to alleles at the same locus that differ by only a few nucleotides, or by small insertions or deletions. By detecting differences in single nucleotides at the molecular level, SNP markers can help distinguish differences in the genetic material between two individuals. They are numerous, widely distributed, highly stable, high-throughput, and easily automated, enabling more accurate mapping of genetic diversity between individuals.

[0004] Sanger sequencing, based on the dideoxyribonucleotide (ddNTP) end-termination method, is a classic method for DNA sequence analysis, directly obtaining nucleic acid sequence information and serving as the "gold standard" for SNP detection. Furthermore, Sanger sequencing can identify unknown SNP sites and determine the mutation type and location, making it an irreplaceable, direct, and accurate method for SNP detection.

[0005] ChREBP is a transcription factor that is closely related to the body's glucose metabolism and lipid metabolism. ChREBP The research on gene polymorphism is mostly focused on glucose and lipid metabolism, health and other aspects, but the research on livestock is rare. ChREBP The expression of may affect meat quality by affecting the body's glucose and lipid metabolism. Summary of the Invention

[0006] The purpose of the present invention is to provide a ChREBP A method, a kit and an application for rapid detection of beef quality traits assisted by gene SNP markers can be used to selectively breed high-quality beef cattle using the molecular markers.

[0007] In order to achieve the above object, the specific technical solutions adopted by the present invention are as follows: The first aspect of the present invention provides an Anhui local breed cattle ChREBPThe method for detecting gene SNP comprises the following steps: The genomic DNA of Anhui local breed cattle was used as template to amplify the local breed cattle ChREBP The fragments amplified by PCR were sampled and cut into gels, and then the nucleic acid sequence of the target region was obtained by Sanger sequencing. ChREBP SNP genotype at position g.54440 in gene reference sequence 788534; The nucleotide sequence of the SNP molecular marker containing the g.54440 site was determined as shown in SEQ ID NO.1. The g.54440 site has three genotypes: GG, GA, and AA. Allele A is associated with meat quality traits of Anhui local cattle breeds, and the corresponding genotype can be used as a molecular genetic marker for early selection of meat color brightness and shear strength of beef.

[0008] As a preferred embodiment of the present invention, the reaction procedure of the PCR amplification is: pre-denaturation at 94-95°C for 5 min to 5 min 30 s; denaturation at 94°C for 30 s, annealing at 53-55°C for 30-45 s, extension at 70-75°C for 30-45 s, 30-40 cycles, and holding at 70-75°C for 10 min.

[0009] As a preferred embodiment of the present invention, the PCR amplification system contains: 12-13 μL of 2×Taq PCR Mastermix, 1.5-2.5 μL of DNA template, 0.5-1.5 μL of each of 100 ng / μL upstream and downstream primers, and deionized water to 25 μL.

[0010] As a preferred embodiment of the present invention, the sequencing method used is first-generation sequencing.

[0011] In a second aspect, the present invention provides a primer pair for specifically amplifying the SNP molecular marker, comprising a forward primer and a reverse primer. Forward primer: 5′-GCTCCAGTTCAGCATTCTC-3′; Reverse primer: 5′-TCTGAGGCTTGGACACTCT-3′.

[0012] The third aspect of the present invention provides a detection reagent for detecting the SNP molecular marker, characterized in that it includes the primer pair.

[0013] In a fourth aspect, the present invention provides a kit comprising the primer pair, 2×Taq PCR Master mix and deionized water.

[0014] The fifth aspect of the present invention provides a use of the primer pair, the detection reagent or the kit in detecting the color and brightness trait of beef.

[0015] In a sixth aspect, the present invention provides a use of the primer pair, the detection reagent or the kit in detecting the shear force trait of beef.

[0016] Compared with the prior art, the beneficial effects of the present invention are: The present invention uses DNA sequencing technology to analyze the genetics of five local cattle breeds in Anhui Province. ChREBP Gene polymorphism analysis revealed that: ChREBP The SNP site screened at exon 13-14 of the gene is g.54440G>A 。 The least squares linear model was further used to fit the Dabie Mountain cattle. ChREBP The association analysis between gene polymorphic sites and meat quality traits showed that: ChREBP Gene g.54440G>A site, the meat color brightness (L*) of AA genotype is significantly higher than that of GG genotype ( P <0.01), the meat color brightness (L*) of AA genotype was significantly higher than that of GA genotype ( P <0.01), the shear force of GA genotype was significantly higher than that of GG genotype ( P <0.05), the shear force of AA genotype was significantly higher than that of GG genotype ( P <0.05), indicating that the g.54440G>A locus can be used as a molecular marker for breeding cattle with high meat color brightness traits or high shear force traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is the result of genomic DNA extraction; Figures 2 - 5 They are ChREBP Results of 1.5% agarose gel electrophoresis of the PCR amplification products of the gene with 8 primer pairs; Figure 6 yes ChREBP Gene sequencing analysis results. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0019] Meat quality evaluation indicators include color, pH, water holding capacity, drip loss, and marbling. Color is a key factor influencing the sales of fresh beef, with consumers typically viewing bright red and cherry-red colors as indicative of freshness. Shear force is also a key indicator of meat quality, closely related to appearance, juiciness, flavor, and tenderness. Therefore, both color and shear force are crucial indicators for assessing meat quality.

[0020] The present invention provides an Anhui local breed cattle ChREBP The method for detecting gene SNP comprises the following steps: The genomic DNA of Anhui local breed cattle was used as template to amplify the local breed cattle ChREBP The fragments amplified by PCR were sampled and cut into gels, and then the nucleic acid sequence of the target region was obtained by Sanger sequencing. ChREBP SNP genotype at position g.54440 in gene reference sequence 788534; The nucleotide sequence of the SNP molecular marker containing the g.54440 site was determined as shown in SEQ ID NO.1. The g.54440 site has three genotypes: GG, GA, and AA. Allele A is associated with meat quality traits of Anhui local cattle breeds, and the corresponding genotype can be used as a molecular genetic marker for early selection of meat color brightness and shear strength of beef.

[0021] Example 1 Anhui local breed cattle ChREBP Genetic diversity analysis 1. Test materials 1.1 Experimental Animals A total of 286 individuals of five local cattle breeds in Anhui Province (Wandong cattle, Wannan cattle, Dabieshan cattle, Dongliu buffalo, and Jianghuai buffalo) were sampled using a random representative sampling method. Detailed information is shown in Table 1.

[0022] Table 1 Sample information of five local cattle breeds in Anhui Province 1.2 Preparation of main reagents and solutions (1) Main reagents Chloroform, isoamyl alcohol, double-distilled water (ddH2O), anhydrous ethanol, and ultrapure water (DI) were all provided by the university laboratory. DNA Marker (DL2000), 6x Loading Buffer, and 2× Taq PCR Master Mix were purchased from Sangon Biotech (Shanghai) Co., Ltd.; agarose was purchased from Mona Biotechnology Co., Ltd.; nucleic acid stain was purchased from Sevier Biotechnology Co., Ltd.; and a blood genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0023] (2) Preparation of reagents A: PBS buffer: NaCl 8g, KCl 0.2g, Na2HPO4•12H2O 3.58g, KH2PO4 0.27g, add ddH2O to 1L, adjust pH to 7.4, autoclave, and store at 4℃.

[0024] B: 50× TAE: Place 242 g of Tris and 100 mL of 0.5 mol / L EDTA in a 1 L beaker. Add 800 mL of ddH2O and stir thoroughly. Then, add 57.1 mL of glacial acetic acid and continue stirring. Finally, add enough deionized water to bring the total volume to 1 L.

[0025] C: 1×TAE electrode buffer: 20 mL 50×TAE, dilute to 1 L with 980 mL distilled water.

[0026] D: 1.5% agarose gel electrophoresis: Add 1.5g agarose to 100mL 1×TAE and heat in a microfuge until melted. When it cools to the touch, add 5µL nucleic acid dye and mix well.

[0027] 1.3 Main instruments The main instruments and equipment required for the present invention are shown in Table 2 below.

[0028] Table 2 Main instruments and equipment 2. Test methods 2.1. Blood sample collection Jugular vein blood was collected from five breeds of cattle in Anhui Province and placed in EDTA anticoagulant tubes. The blood was placed in an insulated box with crushed ice and brought back to the laboratory for storage at -80°C.

[0029] 2.2 Extraction of genomic DNA Genomic DNA was extracted from the blood of 286 cattle using an animal blood genomic DNA extraction kit. Specific steps were followed according to the kit instructions.

[0030] 2.3. Genomic DNA concentration and purity detection The DNA concentration was measured using Nanodrop one ultra-micro spectrophotometer. 260 : A 280 The range was 1.7 to 1.9, and then its integrity was further verified. 2 μL of DNA template was mixed with 3 μL of 6× Loading Buffer and tested by 1.5% agarose gel electrophoresis. If qualified, it was stored at -20°C until use.

[0031] 2.4 Primer design and synthesis According to the NCBI database ChREBP The gene (ID: 788534) sequence was analyzed. Primerpremier 5.0 software was used to design eight pairs of primers (C1–C8) targeting the exon and partial intron regions of the gene. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Details are shown in Table 3.

[0032] Table 3 Anhui local cattle breeds ChREBP Gene primer information Note: E: exon; i: intron 2.5 PCR amplification and sequencing The PCR amplification system consisted of 25 μL of the following: 12.5 μL of 2× Taq PCR Master Mix, 2 μL of DNA template, 1 μL of each upstream and downstream primer (100 ng / μL), and 8.5 μL of deionized water. Amplification conditions were as follows: 94°C initial denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing for 30 s (see Table 3 for annealing temperatures), and extension at 72°C for 30 s; a total extension at 72°C for 10 min, and storage at 4°C until use. PCR amplification products were checked by 1.5% agarose gel electrophoresis and sent to Universal Biosystems (Anhui) Co., Ltd. for sequencing.

[0033] 3. Data Analysis 3.1 Genotype frequency and allele frequency Genotype frequency = number of genotyped individuals / total number of measured populations Allele frequency = allele frequency in a population divided by allele frequency Pi: frequency of the i-th allele; i: homozygous multiple allele i1, j2, ... jn: the 1st to nth alleles co-dominant with i 3.2 Hardy-Weinberg equilibrium test Hardy-Weinberg equilibrium is the genotypic frequency state of the two alleles at an autosomal gene locus after random mating in an infinite population.

[0034] Where: Ei represents the theoretical value, Oi represents the actual observed value, and n represents the number of alleles.

[0035] 3.3 Genetic homozygosity Ho ) Ho Indicates the degree of purity of a specific allele in a population. Its calculation formula is:

[0036] Where: Pi is the frequency of the i-th allele, and n is the number of alleles at a certain site.

[0037] 3.4. Heterozygosity He ) He It is the proportion of heterozygotes in a population at a certain locus, which measures the information content of the marker method. The calculation formula is:

[0038] Where: Pi is the frequency of the i-th allele, and n is the number of alleles at a certain site.

[0039] 3.5. Effective number of alleles Ne ) Ne It is also an indicator of the size of the genetic variation in a population and is expressed as the reciprocal of homozygosity. If the alleles in a population are more evenly distributed, the effective number of alleles will be closer to the actual number of alleles detected.

[0040] Where: i is the i-th allele; pi is the frequency of the i-th allele; n is the number of alleles.

[0041] 3.6、Polymorphic Information Content( PIC ) Polymorphism Information ContentPIC ) value is calculated based on the frequency of its allele in a population, indicating the high or low polymorphism of the site.

[0042] Where: pi and pj are the frequencies of the ith and jth alleles respectively; n is the number of alleles. PIC When >0.5, it is highly polymorphic; 0.25< PIC When <0.5, it is moderately polymorphic; PIC When <0.25, it is low polymorphism.

[0043] 3.7 Data Analysis Software Sequencing results were compared with reference sequences using DNAman software to screen for SNPs. Chromas software was used to analyze peaks in the sequencing results and further verify the identified SNPs.

[0044] 4. Results and Analysis 4.1. Genomic DNA quality testing The quality of the extracted genomic DNA was detected by NanoDrop One ultra-micro spectrophotometer, and the ratio A 260 / A 280 The DNA was analyzed by 1.5% agarose gel electrophoresis. The results are shown in Figure 1. The bands were bright and clear, with no tailing, and the integrity of the bands was good. These results indicate that the extracted DNA quality meets the requirements of subsequent experiments.

[0045] 4.2. Anhui local cattle breeds ChREBP Genetic diversity analysis of genes 4.2.1、 ChREBP Quality testing of gene PCR amplification products ChREBP The results of agarose gel electrophoresis of the PCR amplified products were shown in Figures 2 - 5 Amplification ChREBP The eight pairs of primers for the gene had good specificity, no dimers, and the amplified bands were bright, clear, and single. The fragment sizes were in line with expectations and could be sequenced directly.

[0046] 4.2.2、 ChREBP Analysis of gene sequencing results The expanded Anhui local cattle population of 5 breeds ChREBP Sequencing of some exons of the gene ChREBPThe gene sequencing results were compared with the cattle sequence published by NCBI. As shown in Figure 6, the SNP site discovered is g.54440G>A in exons 13-14.

[0047] The nucleotide sequence of the molecular marker containing the SNP site is shown in SEQ ID NO.1: GCTCCAGTTCAGCATTCTCATCCGGCCCCTGTTTGAGTCCTTCAACGGGA TGGTGTCTACAGCAAGCCTGCAGAGCCTCCGCCAGACCTCCCTGGCATGG CTGGACCAGTATTGTCCCCTGCCTGCTCTCCGACCAAGTATGTGCCTGCC CSGCAGAGTGTCCAAGCCTCAGA, where S is base G or base A.

[0048] 4.2.3 Anhui Local Cattle Breeds ChREBP Analysis of population genetic structure of genes (1) ChREBP Genetic polymorphism analysis of exons 13-14 of the gene Five local cattle breeds in Anhui ChREBP The gene and genotype frequencies of the variant site in exons 13–14 of the gene were analyzed (Table 4). At the g.5440G>A locus, three genotypes were detected: GG, CA, and AA. Only the AA genotype was detected in two buffalo breeds. The GG genotype was more frequent than the GA and AA genotypes in the three common cattle breeds, indicating it was the dominant genotype. The G allele was the dominant allele.

[0049] Ne, Ho, He, PIC, and Hardy-Weinberg equilibrium were calculated based on gene and genotype frequencies (Tables 4 and 5). At the g.5440G>A locus, both buffalo populations have only one allele, so Ne is 1, and homozygosity is higher than heterozygosity. At the g.54440G>A locus, the polymorphic information content is low in Wandong cattle ( PIC <0.25), and Southern Anhui cattle and Dabieshan cattle were moderately polymorphic (0.25< PIC <0.5). Wandong cattle are in a state of extreme Hardy-Weinberg disequilibrium ( P <0.01), and the Wannan cattle and Dabieshan cattle were in Hardy-Weinberg equilibrium ( P >0.05).

[0050] Table 4 Anhui local cattle breeds ChREBP Gene and genotype frequencies of exons 13-14 Table 5 Anhui local cattle breeds ChREBP Genetic variation parameters of exons 13 to 14 of the gene Example 2 Dabie Mountain Cattle ChREBP Correlation analysis between gene polymorphism and meat quality 1. Experimental materials and methods 1.1 Sample Collection Fifty-six healthy, disease-free, fattened Dabie Mountain cattle of similar weight, aged 24 to 30 months, were selected (Jiuhong Agricultural Comprehensive Development Co., Ltd., Taihu County, Anqing City). They were prohibited from feeding for 24 hours before slaughter and underwent a sanitary inspection. After slaughter, 500 g of the longissimus dorsi muscle from the 12th and 13th thoracic vertebrae was removed, washed with saline to remove blood, and stored at -20°C until further use.

[0051] 1.2 Determination of beef quality (1) Crude fat: The fat content of the longissimus dorsi muscle of Dabie Mountain cattle was determined by Soxhlet extraction according to GB / T5009.6-2003 “Determination of fat in foods”.

[0052] (2) Meat color: The cross-section of the collected longissimus dorsi muscle was exposed to air oxygenation for 40 minutes, and the color difference was measured using a Canon CR-S400w handheld colorimeter. The brightness (L*), redness (a*), and yellowness (b*) of the longissimus dorsi muscle were measured. Each sample was measured three times, and the average value was taken for analysis.

[0053] (3) Drip loss: Remove the surrounding muscle membrane from the meat sample and cut it into approximately 5cm×3cm×2cm meat samples along the direction of the muscle fibers. Take 3 pieces of each meat sample and record the weight (m1). Bend the wire into a hook shape, hook one end, and place it in an air-filled plastic bag to prevent it from falling and contacting the plastic bag. Hang the meat sample in a refrigerator at 4℃ for 24 hours. After that, remove the plastic bag, wipe the juice on the surface of the meat sample with filter paper, and reweigh it (m2). Calculate according to the following formula:

[0054] Drip loss (%) = (m1-m2) / m1×100% (4) Cooking loss: After removing the connective tissue and fat on the surface of the muscle, cut it into slices approximately 2 cm thick and weigh them (recorded as W1). Place the meat in a high-temperature vacuum bag and insert a thermometer into the center of the muscle. Seal the bag tightly and heat it in a constant temperature water bath at 80°C until the core temperature of the meat sample reaches 70°C. Then remove the meat sample from the water bath and let it cool naturally at room temperature. Then use absorbent paper to gently absorb the moisture on the surface of the meat sample and weigh it (recorded as W2). Calculation formula:

[0055] Cooking loss (%) = (W1-W2) / W1×100% (5) Shear force: Place the meat sample in a water bath preheated to 80°C for cooking. Continue heating until the temperature at the center of the meat sample reaches 70°C. Remove the meat sample and allow it to cool to room temperature. Ten cylindrical specimens with a diameter of 1.27 cm are removed from the meat sample along the direction of the muscle fibers. Shear force is tested using a tenderizer and the average shear force value is calculated.

[0056] (6) Water loss rate: Cut the meat sample into 2 cm pieces, weigh the weight of the meat sample, record it as W1, and then wrap it with gauze. After that, place the wrapped meat sample between two layers of filter paper (18 layers in total), place the meat sample on the pressure gauge, apply 25 kg of pressure for 5 minutes, and then remove the pressure. Then reweigh the meat sample and record it as W2. The weight before pressure (W1) minus the weight after pressure (W2) is the difference between the weight before pressure (W1) and the weight after pressure (W2). The calculation formula is:

[0057] Water loss rate (%) = (W1-W 2) / W1×100% (7) pH: Insert the electrode of the pH meter into the meat sample and perform three repeated measurements on each meat sample. Then calculate the average value of these three measurements as the pH value of the meat sample.

[0058] 2. Data Analysis 2.1 Statistical Analysis Model The GLM (General linear model) procedure of SAS software was used in combination with the least squares variance analysis model to compare the differences in meat quality traits between different genotypes.

[0059] Significant differences and multiple comparisons were performed on the meat quality traits among different genotypes, and the results were presented as mean ± standard deviation.

[0060] The statistical model is: Yij=μ+GENi+GROj+eij Yij is the phenotypic value of a certain trait of an individual; μ is the population mean; GENi is the genotype effect; GROj is the group effect; and eij is the random error.

[0061] 3. Results and Analysis Using SAS software to ChREBP The correlation analysis between the genotype of the polymorphic locus and nine indicators of Dabie Mountain cattle, including intramuscular fat, shear force, drip loss, pH, and water holding capacity, was conducted (Table 6). The results showed that the g.54440G>A locus had a significantly higher meat color brightness (L*) than the GG genotype ( P <0.01), the AA genotype was significantly higher than the GA genotype ( P <0.01), the shear force of GA genotype was significantly higher than that of GG genotype ( P <0.05), the shear force of AA genotype was significantly higher than that of GG genotype ( P <0.05).

[0062] Table 6 ChREBP Association analysis between gene SNPs and beef quality in Dabie Mountains Note: When comparing different genotypes at the same locus, data with different lowercase letters indicate significant differences ( P <0.05, different capital letters indicate extremely significant differences ( P <0.01).

[0063] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. An Anhui local breed of cattle ChREBP A method for detecting gene SNPs, characterized by: The following steps are involved: The genomic DNA of Anhui local breed cattle was used as template to amplify the local breed cattle ChREBP The fragments amplified by PCR were sampled and cut into gels, and then the nucleic acid sequence of the target region was obtained by Sanger sequencing. ChREBP SNP genotype at position g.54440 in gene reference sequence 788534; The nucleotide sequence of the SNP molecular marker containing the g.54440 site was determined as shown in SEQ ID NO.

1. The g.54440 site has three genotypes: GG, GA, and AA. Allele A is associated with meat quality traits of Anhui local cattle breeds, and the corresponding genotype can be used as a molecular genetic marker for early selection of meat color brightness and shear strength of beef.

2. The Anhui local breed cattle according to claim 1 ChREBP A method for detecting gene SNP, characterized in that: The PCR amplification reaction procedure is as follows: pre-denaturation at 94-95°C for 5 min to 5 min 30 s; denaturation at 94°C for 30 s, annealing at 53-55°C for 30-45 s, extension at 70-75°C for 30-45 s, 30-40 cycles, and holding at 70-75°C for 10 min.

3. The Anhui local breed cattle according to claim 1 ChREBP A method for detecting gene SNP, characterized in that: The PCR amplification system contains: 12-13 μL of 2×Taq PCR Master mix, 1.5-2.5 μL of DNA template, 0.5-1.5 μL of each of 100 ng / μL upstream and downstream primers, and deionized water to 25 μL.

4. The Anhui local breed cattle according to claim 1 ChREBP A method for detecting gene SNP, characterized in that: The sequencing method used was first-generation sequencing.

5. A primer pair for specifically amplifying the SNP molecular marker according to claim 1, characterized in that: It includes a forward primer and a reverse primer. Forward primer: 5′-GCTCCAGTTCAGCATTCTC-3′; Reverse primer: 5′-TCTGAGGCTTGGACACTCT-3′.

6. A detection reagent for detecting the SNP molecular marker according to claim 1, characterized in that: It comprises the primer pair according to claim 5.

7. A kit, characterized in that The method comprises the primer pair according to claim 5, 2×Taq PCR Master mix and deionized water.

8. Use of the primer pair according to claim 5, the detection reagent according to claim 6, or the kit according to claim 7 in detecting the color and brightness trait of beef.

9. Use of the primer pair according to claim 5, the detection reagent according to claim 6, or the kit according to claim 7 in detecting shear force properties of beef.

Images