Method and kit for detecting full-length mRNA of human cell telomerase subunit TERT transcript

Abstract

The invention provides a method and a kit for detecting full-length mRNA of a human cell telomerase subunit TERT transcript, and belongs to the technical field of biology. The invention provides a method for detecting human cell telomerase subunit TERT transcript full-length mRNA, a specific reverse transcription primer TERT rt1 is adopted for reverse transcription to obtain cDNA, and if a sixth exon and a seventh exon of the telomerase subunit TERT can be detected in the cDNA, it is judged that a sample to be detected contains the human cell telomerase subunit TERT transcript full-length mRNA. The method disclosed by the invention can be used for distinguishing the full-length mRNA of TERT mRNA and other shear isomer mRNA, and a new technical means is provided for more conveniently, accurately and indirectly evaluating the activity of telomerase in cells.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a method and a kit for detecting full-length mRNA of telomerase subunit TERT transcript in human cells. Background Art

[0002] Telomerase is a ribonucleoprotein complex composed of an RNA template (TERC) and a catalytic subunit (TERT). Its activity is closely linked to cell immortalization and cancer development. TERT expression is the primary rate-limiting factor in telomerase activity, making detection of TERT mRNA expression an important tool for assessing telomerase activity.

[0003] Currently, there are two main methods for detecting telomerase activity. One is the TRAP method, which extracts telomerase from cells, extends the telomere sequence in vitro, and then uses electrophoresis or qPCR to determine the extension efficiency of the telomere sequence and thus judge the activity of cellular telomerase. This is the most direct and accurate method for detecting the strength of telomerase activity, but its disadvantages are also obvious. The extraction process is very cumbersome, telomerase is easily inactivated by various factors, the operation time is long, and the technical requirements are high. It is difficult for inexperienced people to extract active telomerase; the second method is to indirectly determine the activity of telomerase by detecting the mRNA expression level of the telomerase catalytic subunit TERT through PCR or qPCR. Often, high expression of TERT mRNA means that the telomerase in the cell has high activity. This has been confirmed in many research reports. Many telomerase detection kits developed based on this method have been launched on the market and patent applications have been approved. Because in eukaryotic cells, the process from the production of precursor RNA to mature mRNA needs to go through a series of alternative splicing processes, most introns will be cut and deleted, and a small number of exons may also be cut and deleted. Only mRNA expressing full-length TERT protein has telomerase activity. However, these current detection technologies all design primers and probes on conserved sequences, which means that the TERT mRNA measured by these methods is the detection result of all TERT mRNA splicing isoforms and cannot directly detect full-length TERT mRNA. Summary of the Invention

[0004] In view of this, the present invention provides a method for detecting full-length mRNA of telomerase subunit TERT transcript in human cells.

[0005] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a method for detecting full-length mRNA of telomerase subunit TERT transcript in human cells, comprising the following steps: The reverse transcription primer TERT rt1 was designed based on exon 11 of the telomerase subunit TERT; Using human cell RNA in the sample to be tested as a template, reverse transcription was performed using the reverse transcription primer TERT rt1 to obtain cDNA. If exon 6 and exon 7 of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be tested contains the full-length mRNA of the human cell telomerase subunit TERT transcript.

[0006] The present invention provides a method for detecting the expression level of full-length mRNA of telomerase subunit TERT transcript in human cells, comprising the following steps: The reverse transcription primer TERT rt1 was designed based on exon 11 of the telomerase subunit TERT gene; Using human cell RNA in the sample to be tested as a template, reverse transcription is performed using the reverse transcription primer TERT rt1 to obtain cDNA. Using cDNA as a template, the expression levels of exons 6 and 7 of the telomerase subunit TERT are detected: A standard curve was drawn using a recombinant plasmid containing the full-length cDNA of the human telomerase subunit TERT transcript as a standard. The absolute expression levels of exon 6 and exon 7 were calculated based on the equation obtained from the standard curve to obtain the absolute expression level of the full-length mRNA of the human telomerase subunit TERT transcript. Or select the internal reference gene and use 2 -ΔΔCt The relative expression levels of exon 6 and exon 7 were calculated by the method to obtain the relative expression level of the full-length mRNA of the telomerase subunit TERT transcript in human cells.

[0007] The present invention provides a detection kit for implementing the method, comprising a reverse transcription primer TERT rt1 and primer probes for detecting exon 6 and exon 7; The nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO: 1; The primer probes for detecting exon 6 and exon 7 include an upstream primer TERT6-7 F having a nucleotide sequence as shown in SEQ ID NO: 2, a downstream primer TERT6-7 R having a nucleotide sequence as shown in SEQ ID NO: 3, and a probe TERT6-7 P having a nucleotide sequence as shown in SEQ ID NO: 4.

[0008] The present invention provides an application of the method and the kit in evaluating telomerase activity for non-diagnostic purposes.

[0009] Compared with the prior art, the present invention has the following advantages: The present invention provides a method for detecting full-length mRNA of the telomerase subunit TERT transcript in human cells. The method uses a specific reverse transcription primer TERT rt1 for reverse transcription to obtain cDNA. If exon 6 and exon 7 of the telomerase subunit TERT can be detected in the cDNA, it is determined that the test sample contains full-length mRNA of the telomerase subunit TERT transcript in human cells. The present invention mainly improves the TERT mRNA RT-qPCR method. By designing a reverse transcription primer TERT rt1 based on exon 11 and detecting exon 7 and complete exon 6 in the TERT rt1 reverse transcription sample, the method can accurately distinguish between full-length TERT mRNA and other spliced ​​isoforms of TERT mRNA, providing a new technical means for more convenient and accurate indirect assessment of intracellular telomerase activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Schematic diagram of the five splice isoforms of TERT mRNA; Figure 2 Schematic diagram of the locations of various specific primers and probes designed for TERT mRNA; Figure 3 The figure shows the amplification results of three primer and probe combinations of pCDNA3.1(+)-hTERT; Figure 4 This is the result of reverse transcription test of HEK293T RNA TERT rt1 primer; Figure 5 This is the result of reverse transcription sample detection using TERT rt1 primer of SH-SY5Y RNA; Figure 6 This is the result of reverse transcription test of HUVEC RNA TERT rt1 primer.

[0011] Figure 7 This is the result of HEK293T RNA random primer reverse transcription sample detection; Figure 8 This is the result of reverse transcription test using random primers for SH-SY5Y RNA; Figure 9 This is the result of HUVEC RNA random primer reverse transcription sample detection; Figure 10 HEK293T RNA Oligo(dT) 18 Primer reverse transcription sample detection results diagram; Figure 11 SH-SY5Y RNA Oligo(dT) 18 Primer reverse transcription sample detection results diagram; Figure 12 HUVEC RNA Oligo(dT) 18 Primer reverse transcription sample detection results diagram; Figure 13 This is the hTERT primer probe amplification efficiency test and the absolute quantification graph of 293T reverse transcription samples; Figure 14 The figure shows the amplification efficiency test of TERT 6-7 primer probe and the absolute quantification of 293T reverse transcription samples. DETAILED DESCRIPTION

[0012] The present invention provides a method for detecting full-length mRNA of a telomerase subunit TERT transcript in human cells, comprising the following steps: designing a reverse transcription primer TERT rt1 based on exon 11 of the telomerase subunit TERT; using human cell RNA in a sample to be tested as a template, using the reverse transcription primer TERT rt1 to perform reverse transcription to obtain cDNA; if exon 6 and exon 7 of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be tested contains full-length mRNA of the telomerase subunit TERT transcript in human cells.

[0013] In the present invention, the telomerase subunit TERT has at least five alternative splicing isoforms (referred to as variants) in human cells, namely variant 1, variant 2, variant 3, variant 4 and variant 5 (see Figure 1), where variant 1 is the mRNA expressing the full-length TERT protein; variant 2 lacks exon 11 compared to variant 1, resulting in a shorter TERT polypeptide chain transcribed from it, thus producing inactive telomerase; variant 3 has a shorter exon 6 compared to variant 1, and lacks exons 7, 8, and 11; variant 4 lacks exons 7, 8, and 11 compared to variant 1. Variants 3 and 4 are not transcribed into protein in cells, making them non-coding RNAs (ncRNAs). These four TERT mRNA variants vary in their proportions in different cells, and even changing their culture conditions can alter their expression ratios within cells. Only variant 1 can produce TERT subunits with reverse transcriptase activity. Therefore, only the expression level of TERT variant 1 mRNA truly represents telomerase activity in cells. The present invention provides a method for effectively distinguishing variant 1 from the other four variant mRNAs. Specifically, since alternative splicing of TERT mRNA occurs primarily in exons 6, 7, 8, and 11, and exon 8 also undergoes alternative splicing when exon 7 undergoes alternative splicing, exon 7 and exon 8 are considered as a whole. Exon 7 is detected to determine whether exon 8 is spliced, and exon 6 and exon 7 are detected to determine whether exon 6, exons 7, and 8 in the TERT mRNA transcript are spliced. Exon 11 is detected to determine whether exon 11 is spliced. In order to effectively detect the full-length mRNA expression level of the telomerase subunit TERT transcript in human cells, in one embodiment of the present invention, a reverse transcription primer TERT rt1 is designed for exon 11, and reverse transcription is performed to obtain a TERT rt1 reverse transcription sample. The expression levels of exon 7 and the complete exon 6 in the TERT rt1 reverse transcription sample are detected to obtain the full-length mRNA expression level of the telomerase subunit TERT transcript in human cells. However, if TERT mRNA is directly determined by detecting exon 6, exon 7, and exon 11, it will lead to serious deviations, because the exon 6 detection primer and probe can simultaneously detect variant 1 and variant 2, and the exon 11 detection primer and probe can simultaneously detect variant 1 and variant 5, but they cannot distinguish between incomplete variant 2 and variant 5. In one embodiment of the present invention, by using random primers (Random Primer 6) and Oligo (dT) 18 Reverse transcription primers were used to obtain reverse transcribed samples, and exon 6, exon 7 and exon 11 in the reverse transcribed samples were detected. The results showed that this method could not effectively detect the full-length mRNA expression level of the telomerase subunit TERT transcript in human cells.

[0014] The present invention designs a reverse transcription primer, TERT rt1, based on exon 11 of the telomerase subunit TERT. Using human cell RNA from a test sample as a template, reverse transcription is performed using the reverse transcription primer TERT rt1 to obtain cDNA. The present invention does not specifically limit the method for extracting human cell RNA; conventional methods for extracting human cell RNA in the art can be used. In the present invention, the human cells preferably include at least one of the following: HEK293T cells, SH-SY5Y cells, and HUVEC cells. In an embodiment of the present invention, human cell RNA is extracted using the TRIzol method. After extracting the human cell RNA, the human cell RNA is reverse transcribed using the reverse transcription primer TERT rt1 to obtain cDNA. The nucleotide sequence of the reverse transcription primer TERT rt1 is preferably as shown in SEQ ID NO: 1. The present invention designs a specific reverse transcription primer, TERT rt1, on exon 11, so that only TERT mRNA containing exon 11 will be reverse transcribed into cDNA. Because reverse transcriptase lacks proofreading functionality and there is a small chance that the reverse transcription primer will bind to other parts of the RNA during annealing, to verify the accuracy of reverse transcription, after reverse transcription, the expression level of exon 11 in the TERT rt1 reverse transcription sample is detected. The reverse transcription primer TERT rt1 is designed between the upstream primer F and the probe for detecting exon 11. If exon 11 cannot be detected in the product or the expression level of exon 11 is within 10% of the total TERT mRNA expression level, it indicates that the error is negligible and the accuracy of reverse transcription is high. The primer probe for detecting exon 11 includes an upstream primer TERT11 F, preferably having a nucleotide sequence as shown in SEQ ID NO: 8, a downstream primer TERT11 R, having a nucleotide sequence as shown in SEQ ID NO: 9, and a probe TERT11 P, having a nucleotide sequence as shown in SEQ ID NO: 10.

[0015] After obtaining cDNA, it is diluted 10-fold with sterile water or TE to obtain a PCR template. If exons 6 and 7 of the telomerase subunit TERT are detected in the cDNA, the sample is determined to contain full-length mRNA of the human telomerase subunit TERT transcript. In the present invention, the primer probe for detecting exons 6 and 7 preferably includes an upstream primer TERT6-7 F having a nucleotide sequence as set forth in SEQ ID NO: 2, a downstream primer TERT6-7 R having a nucleotide sequence as set forth in SEQ ID NO: 3, and a probe TERT6-7 P having a nucleotide sequence as set forth in SEQ ID NO: 4. The upstream primer TERT6-7 F is designed at the site of variable splicing of exon 6, the probe TERT6-7 P is designed at the constant region of exon 6, and the downstream primer TERT6-7 R is designed on exon 7. The primer probe for detecting exons 6 and 7 can detect whether TERT mRNA contains exons 6, 7, and 8. The exon 6 and exon 7 detection system is preferably composed of 10 μL of 2×qPCR Mix, 0.5 μL of TERT6-7 F, 0.5 μL of TERT6-7 R, 0.3 μL of TERT6-7 P, and 2 μL of TERT rt1 reverse transcription sample, and the volume is adjusted to 20 μL with sterile water. The detection procedure for exon 6 and exon 7 is preferably 95°C for 3 min; 95°C for 15 s, 60°C for 15 s, 72°C, collecting fluorescence for 20 s, and 40 cycles. After the reaction is completed, if a fluorescence signal can be detected, it means that TERT mRNA contains exons 6, 7, and 8 at the same time. The stronger the fluorescence signal, the higher the expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript. Based on the fact that only the full-length mRNA of the human cell telomerase subunit TERT transcript can produce TERT subunits with reverse transcriptase activity, high expression of TERT mRNA means that the telomerase in the cell has high activity. The present invention provides a new technical means for more convenient and accurate indirect evaluation of intracellular telomerase activity.

[0016] The present invention provides a method for detecting the expression level of full-length mRNA of telomerase subunit TERT transcript in human cells, comprising the following steps: Reverse transcription primer TERT rt1 was designed based on exon 11 of the telomerase subunit TERT gene. Using human cell RNA in the sample to be tested as a template, reverse transcription was performed using reverse transcription primer TERT rt1 to generate cDNA. Using cDNA as a template, the expression levels of exons 6 and 7 of the telomerase subunit TERT were detected: A standard curve was drawn using a recombinant plasmid containing the full-length cDNA of the human telomerase subunit TERT transcript as a standard. The absolute expression levels of exon 6 and exon 7 were calculated based on the equation obtained from the standard curve to obtain the absolute expression level of the full-length mRNA of the human telomerase subunit TERT transcript. Or select the internal reference gene and use 2 -ΔΔCt The relative expression levels of exon 6 and exon 7 were calculated by the method to obtain the relative expression level of the full-length mRNA of the telomerase subunit TERT transcript in human cells.

[0017] In the present invention, the method for designing the reverse transcription primer TERT rt1 based on exon 11 of the telomerase subunit TERT gene is preferably the same as that described above and is not further described here. The method for reverse transcription of human cell RNA from the test sample as a template using the reverse transcription primer TERT rt1 to obtain cDNA is preferably the same as that described above and is not further described here.

[0018] The present invention uses a recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript as a standard to draw a standard curve, calculates the absolute expression levels of exon 6 and exon 7 according to the equation obtained from the standard curve, and obtains the absolute expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript. In the present invention, the accession number of the full-length cDNA of the human cell telomerase subunit TERT transcript in NCBI is NM_198253.3. The recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript is preferably obtained by inserting the full-length cDNA of the human cell telomerase subunit TERT transcript into the multiple cloning site of the backbone plasmid. The backbone plasmid is preferably pCDNA3.1(+), purchased from Wuhan Miaoling Biotechnology Co., Ltd., and the multiple cloning site of the backbone plasmid is Nhe I and Xba I. Primers for amplifying the full-length cDNA of the human telomerase subunit TERT transcript included an upstream primer F with a nucleotide sequence as set forth in SEQ ID NO:11 and a downstream primer R with a nucleotide sequence as set forth in SEQ ID NO:12. The amplification system consisted of 1 μL of Phanta Flash Super-Fidelity DNA Polymerase, 25 μL of 2 × Phanta Flash Buffer, 2 μL each of upstream primer F and downstream primer R, 10 μL of 293T cDNA template, and 10 μL of sterile water. The amplification program was 98°C for 30 s; 35 cycles of 98°C for 10 s, 65°C for 5 s, and 72°C for 1 min; 72°C for 2 min; and 4°C for 10 min.

[0019] Or select the internal reference gene and use 2-ΔΔCt The relative expression levels of exon 6 and exon 7 are calculated by the method to obtain the relative expression level of the full-length mRNA of the telomerase subunit TERT transcript in human cells. The present invention does not specifically limit the internal reference gene, and the internal reference gene commonly used in the art can be selected. For example, ACTB or GAPDH, etc. In the embodiment of the present invention, the exon 2 of the constant region of TERT mRNA is used as the internal reference gene to design primer probes to illustrate the relative expression level of the telomerase subunit TERT gene. In the embodiment of the present invention, the primer probe is designed using exon 2 as the internal reference gene to illustrate the relative expression level of the telomerase subunit TERT gene. The primer probe for detecting the exon 2 preferably includes an upstream primer hTERT F having a nucleotide sequence as shown in SEQ ID NO: 5, a downstream primer hTERT R having a nucleotide sequence as shown in SEQ ID NO: 6, and a probe hTERT P having a nucleotide sequence as shown in SEQ ID NO: 7. The internal reference gene is in the constant region of TERT mRNA, and the relative expression level of the full-length TERT mRNA can be evaluated by detecting the expression level of the constant region. In addition to exon 2, exon 1, exon 3, exon 4, exon 5, exon 9 or exon 10 can also be selected. Since only the TERT mRNA containing exon 11 will be reverse transcribed into cDNA during reverse transcription, the relative expression level is the expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript relative to the TERT mRNA containing exon 11. In order to eliminate the error caused by the different amplification efficiencies of primers designed for different regions in the present invention, a recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript is constructed to correct the error caused by the different amplification efficiencies of the primers. The recombinant plasmid containing the full-length cDNA of the human telomerase subunit TERT transcript is preferably the same as the above-mentioned recombinant plasmid containing the full-length cDNA of the human telomerase subunit TERT transcript, and will not be described in detail here.

[0020] The present invention provides a detection kit for implementing the method, comprising a reverse transcription primer TERT rt1 and primer probes for detecting exon 6 and exon 7; The nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO: 1; The primer probes for detecting exon 6 and exon 7 include an upstream primer TERT6-7 F having a nucleotide sequence as shown in SEQ ID NO: 2, a downstream primer TERT6-7 R having a nucleotide sequence as shown in SEQ ID NO: 3, and a probe TERT6-7 P having a nucleotide sequence as shown in SEQ ID NO: 4.

[0021] In the present invention, it is preferred to further include a primer probe for internal reference gene detection and / or a recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript; The primer probe for internal reference gene detection includes an upstream primer hTERT F with a nucleotide sequence as shown in SEQ ID NO: 5, a downstream primer hTERT R with a nucleotide sequence as shown in SEQ ID NO: 6, and a probe hTERT P with a nucleotide sequence as shown in SEQ ID NO: 7; The accession number of the full-length cDNA of the human cell telomerase subunit TERT transcript in NCBI is NM_198253.3.

[0022] Based on the fact that only the full-length mRNA of the telomerase subunit TERT transcript in human cells can produce TERT subunits with reverse transcriptase activity, high expression levels of TERT mRNA mean that the telomerase in the cell has high activity. The present invention provides a method or a kit for use in evaluating telomerase activity for non-diagnostic purposes.

[0023] In the present invention, the expression level of the full-length mRNA of the human cell telomerase subunit TERT transcript is positively correlated with the telomerase activity.

[0024] In order to further illustrate the present invention, the solutions provided by the present invention are described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0025] Example 1 Primer probe design method 1. Design method of TERT6-7 primer probe Since the alternative splicing of TERT mRNA mainly occurs in exon 6, exon 7, exon 8 and exon 11, and when exon 7 undergoes alternative splicing, exon 8 will also undergo alternative splicing at the same time, these two exons are regarded as a whole. By detecting exon 7, it is determined whether exon 8 is spliced. By detecting exon 6 and exon 7, it is determined whether the TERT mRNA transcript contains the complete exon 6 and exons 7 and 8. That is, a specific upstream detection primer TERT6-7 F: gctgtactttgtcaaggtggatgtg (SEQ ID NO: 2) is designed at the alternative splicing site of exon 6, and a specific probe TERT6-7 P: cggtatgccgtggtccagaaggccgc (SEQ ID NO: 3) is designed at the constant region of exon 6. NO:3), design a specific downstream detection primer TERT6-7 R: ggctggaggtctgtcaaggtag (SEQ ID NO:4) on exon 7. If the fluorescent signal of this probe can be detected, it means that TERT mRNA contains exons 6, 7, and 8 at the same time; 2. Design of TERT 11 Primer Probe Specific detection primer TERT11 F: tgcgtggtgaacttgcggaag (SEQ ID NO: 8) and probe TERT11 P: cctggtgcggcctgctgctggat (SEQ ID NO: 9) were designed on exon 11, and specific downstream detection primer TERT11 R: gaaggtgagactggctctgatgga (SEQ ID NO: 10) was designed on exon 12. If exon 11 is cut out, the fluorescent signal cannot be detected.

[0026] 3. Design of reverse transcription primer TERT rt1 If the above primer and probe combination is directly used to detect exon 6 and exon 11 to judge TERT mRNA, it will lead to serious deviation, because the exon 6 detection primer and probe can simultaneously detect variant 1 and variant 2, and the exon 11 detection primer and probe can simultaneously detect variant 1 and variant 5. They cannot distinguish between incomplete variant 2 and variant 5. For this reason, a specific reverse transcription primer TERT rt1: gccggcatctgaacaaaagcc (SEQ ID NO: 1) was designed, that is, a specific reverse transcription primer was designed on exon 11. Only TERT mRNA containing exon 11 will be reverse transcribed into cDNA, and then the exon 6 specific primer and probe are used to detect the presence of exons 6 and 7 to indirectly judge the relative expression level of full-length TERT mRNA.

[0027] Therefore, the expression level of full-length TERT mRNA can be more accurately detected by combining a TERT-specific reverse transcription primer and an exon 6-specific primer and probe.

[0028] 4. Design of primer probes for hTERT (internal reference gene) Specific detection primers hTERT F: aacgaacgccgcttcctcag (SEQ ID NO: 5) and hTERT R: cagtcccgcacgctcatctt (SEQ ID NO: 6) for detecting the entire TERT mRNA, as well as a specific probe hTERT P: cctgcagcgagagcttggcatgcttccc (SEQ ID NO: 7) were designed at exon 2 of the constant region of TERT mRNA to serve as internal reference genes to evaluate the relative expression level of full-length TERT mRNA.

[0029] The specific primers and probes for different regions are designed as follows Figure 2 shown.

[0030] Example 2 Reverse transcription sample preparation method 1. RNA extraction and Random Primer6 reverse transcription sample, Oligo (dT) 18 Preparation of reverse transcription samples and TERT rt1 reverse transcription samples (1) Culture HEK293T, SH-SY5Y, and HUVEC cells in a 6 cm culture dish. When the confluence reaches 80% to 90%, remove the culture medium and add 1 mL of TRIzol reagent to the cells. Vortex and mix. Let stand at room temperature for 5 minutes to fully lyse the cells. Add 200 μL of chloroform to the cell lysate, vortex and mix thoroughly, and let it stand at room temperature for 5 min; (2) Centrifuge at 12,000 × g for 10 min at 4°C, transfer the supernatant to a new centrifuge tube, add 500 μL of isopropanol, mix thoroughly by inversion, and let stand at room temperature for 10 min; (3) Centrifuge at 12,000 × g for 15 min at 4°C, discard the supernatant, add 800 μL of 75% ethanol to the tube, and gently invert to mix; (4) Centrifuge at 7500 × g for 5 min at 4°C, discard the supernatant, add 800 μL of 75% ethanol, and gently invert to mix; (5) Centrifuge at 7500 × g for 5 min at 4°C, discard the supernatant, place the empty tube in a sealed environment to dry, add 100 μL of sterile water treated with DEPC, thoroughly pipette to dissolve the precipitate, and then measure the RNA concentration using an ultra-micro UV spectrophotometer; (6) Perform electrophoresis with 1× TBE to check the integrity of the RNA. Only RNA that has not been degraded can be used for subsequent experiments. (7) Prepare the DNA digestion system according to the system in Table 1 and incubate at 37°C for 15 min; Table 1 DNA digestion reagent ratio

[0031] (8) Take 1 mL of TRIzol reagent and add it to the RNA after DNA removal. Repeat steps (1) to (6) to re-extract RNA. (9) Prepare the RNA denaturation system according to the system in Table 2, incubate at 65°C for 5 minutes, and then quickly place on ice; TERTrt1 in Table 2 is the reverse transcription primer TERT rt1 in Example 1; Table 2 Ratio of RNA denaturation system

[0032] (10) Prepare RNA reverse transcription premix according to the system in Table 3, and then take 6 μL of each and add it to the denaturation system in Table 2. After mixing evenly, reverse transcribe at 50℃ for 60 minutes, and finally inactivate at 95℃ to obtain Random Primer6 reverse transcription sample, Oligo(dT) 18 reverse transcription samples and TERT rt1 reverse transcription samples.

[0033] Table 3 Ratio of RNA reverse transcription system

[0034] 2. Construction of recombinant plasmid pCDNA3.1(+)-hTERT The amplification efficiency of primers designed in different regions may vary greatly. To eliminate the errors caused by different amplification efficiencies, a recombinant plasmid pCDNA3.1(+)-hTERT containing the full-length TERT mRNA sequence was designed and constructed. The amplification effect of the recombinant plasmid was used to correct the errors caused by the different primer amplification efficiencies.

[0035] The construction method of the recombinant plasmid is as follows: SH-SY5Y cell cDNA was used as a template to amplify the full-length TERT upstream primer F:ACCCAAGCTGGCTAGCctctcctcgcggcgcga (SEQ ID NO: 11), downstream primer R:GGGCCCTCTAGAtttttttcaaaactgaaaaactcatatattcagtattttactcccac (SEQ ID NO: 12), and amplified using Novozymes' high-fidelity enzyme (Cat. No. P521-D1). The PCR product was purified using a PCR product purification kit. The pCDNA3.1(+) plasmid (purchased from Wuhan Miaoling Biotechnology) was used as the backbone vector. Nhe I and Xba I restriction enzyme site, respectively, to the PCR product and pCDNA3.1 (+) vector. After the completion of enzyme digestion, the PCR product was purified and recovered using a PCR product purification kit. Then, the target fragment and the digested vector were ligated with T4 DNA ligase at a molar ratio of 5:1 overnight and transformed. The plates were spread on LB plates containing ampicillin antibiotics and inverted to culture overnight. After PCR identification of positive clones, the colonies were expanded and the plasmids were extracted and sent for sequencing. The pCDNA3.1 (+)-hTERT plasmid with accurate sequencing results was used as the recombinant plasmid for backup.

[0036] Example 3 qPCR detection 1. The hTERT primer probe, TERT6-7 primer probe, and TERT11 primer probe in Example 1 were used to detect the recombinant plasmid pCDNA3.1(+)-hTERT and TERT rt1 reverse transcription samples respectively; the qPCR reaction system is shown in Table 4, and the reaction procedure is shown in Table 5.

[0037] The concentration of the recombinant plasmid pCDNA3.1(+)-hTERT was 0.3 ng / μL.

[0038] Take 180 μL of sterile 1× TE solution and add it to the TERT rt1 reverse transcription sample and mix well.

[0039] Table 4 qPCR reaction system

[0040] Table 5 qPCR reaction procedure

[0041] 2. Adjust all thresholds (fluorescence intensity) to 50, then export the data for statistical analysis of relative expression.

[0042] (1) pCDNA3.1(+)-hTERT plasmid detection results The amplification results of pCDNA3.1(+)-hTERT are as follows Figure 3 As shown in Table 6, the amplification efficiencies of TERT6-7 primers and TERT11 primers were almost identical, but the amplification efficiency of hTERT primers for amplifying total TERT mRNA was significantly lower. This was because the GC content in the exon 2 sequence was significantly higher than that in exon 6 and exon 11. Therefore, this result was used to eliminate the differences caused by different amplification efficiencies in subsequent sample analysis.

[0043] Table 6 Amplification results of three primer and probe combinations for pCDNA3.1(+)-hTERT

[0044] (2) TERT rt1 reverse transcription sample test results The amplification results of the sample after TERT rt1 reverse transcription are as follows Figure 4 As shown, the relative expression level of TERT6 in HEK293T samples is 0.38 times that of total TERT mRNA, and the relative expression level of TERT11 is only 0.046 times that of total TERT mRNA. Our TERT rt1 reverse transcription primer is designed between the upstream primer F and the probe of TERT exon 11. In theory, no fluorescent signal of TERT11 should be detected. However, because reverse transcriptase lacks proofreading function and there is a small chance that the reverse transcription primer will bind to other parts of the RNA during annealing, a very small amount of cDNA containing TERT exon 11 will be generated in the product. However, the amount of these non-specific products is extremely small and does not affect the accuracy of the test results. The analysis results of SH-SY5Y cell and HUVEC cell samples are shown in Figure 2. Figure 5 and Figure 6 As shown, the relative expression level of TERT6 in SH-SY5Y cells was approximately 0.72-fold of the total TERT mRNA, while TERT11 was only 0.022-fold of the total TERT mRNA; the relative expression level of TERT6 in HUVEC cells was approximately 0.47-fold of the total TERT mRNA, while TERT11 was only 0.071-fold of the total TERT mRNA.

[0045] From this, it can be concluded that reverse transcription using a specific reverse transcription primer for TERT exon 11 and combined with a TERT6-7 primer and probe combination and an hTERT primer and probe combination can effectively distinguish between TERT full-length mRNA and other variants, and can more accurately quantify the expression level of the telomerase subunit TERT with reverse transcriptase activity.

[0046] In addition, based on the principles of this method, it can also be expanded to detect the content and changes of different variants of other RNAs, providing support for the study of RNA variable splicing.

[0047] Comparative Example 1 Random Primer6 reverse transcription sample and Oligo(dT) 18 Reverse transcription sample test results The hTERT primer probe, TERT6-7 primer probe and TERT11 primer probe in Example 1 were used to detect Random Primer6 reverse transcription sample, Oligo (dT) 18 The reverse transcription sample, reaction system and reaction procedure were the same as those in Example 3.

[0048] Random Primer 6 and Oligo(dT) 18 The reverse transcription mechanism of reverse transcription primers is different. Random primers can randomly and arbitrarily bind to any part of RNA, whether it is mRNA, miRNA or LncRNA. Under the action of reverse transcriptase, they can produce cDNAs of various lengths, including complete cDNAs. Oligo(dT) 18 It will only bind to mRNA containing Poly(A) sequences, and the cDNA produced by transcription is the complete complementary chain cDNA of all mRNAs. These two different products may lead to inconsistent quantitative results. Therefore, these two methods are used to compare with each other to verify whether the results are reliable.

[0049] The amplification results of HEK293T cell RNA reverse transcribed with random primers (Random Primer 6) are as follows: Figure 7 As shown, according to the detection results of the pCDNA3.1(+)-hTERT plasmid in Example 3, the error was eliminated. After deducting the error caused by the amplification efficiency through the internal reference, the detection results of the total TERT cDNA were used as the internal control gene for normalization. The results showed that the expression level of TERT exon 11 was much higher than that of exon 6, and the detection results of SH-SY5Y cells and HUVEC cells also showed the same results, that is, the expression level of TERT exon 11 was much higher than that of exon 6, as shown in FIG. Figure 8 and Figure 9 shown.

[0050] Oligo(dT) 18 Reverse transcribed HEK293T cell RNA, SH-SY5Y cell RNA, and HUVEC cell RNA also showed that the expression level of TERT exon 11 was much higher than that of exon 6, such as Figure 10 、 Figure 11 and Figure 12 shown.

[0051] The above results show that no matter random primers or oligo(dT) 18 In samples reverse transcribed with the primers, the expression level of TERT exon 11 is much higher than that of exon 6, which fully demonstrates that different TERT mRNA variants exist in cells, and the total amount of variants containing exon 11 is much higher than that containing exon 6. The position of random primer binding is uncertain, so some areas that are easy to reverse transcribe are more likely to obtain cDNA, while those with more complex secondary structures are more difficult to transcribe into cDNA, resulting in significant differences in the test results of different regions. 18 It can only detect the entire mRNA and cannot distinguish variants. The method of designing detection primers in the TERT constant sequence region to indirectly assess the activity of the telomerase subunit TERT is subject to large errors.

[0052] Example 4 Detection of absolute expression of TERT mRNA by qPCR 1. Detection of Oligo(dT) in HEK293T cells using the hTERT primer probe in Example 1 18 The reverse transcription sample, TERTrt1 reverse transcription sample and gradient dilution recombinant plasmid pCDNA3.1 (+) -hTERT, the reaction system and reaction procedure are the same as Example 3. According to the detection results of gradient dilution recombinant plasmid pCDNA3.1 (+) -hTERT, a standard curve was prepared to calculate Oligo (dT) 18 Total TERT mRNA expression in reverse-transcribed samples and TERT rt1 reverse-transcribed samples. The absolute quantification standard curve formula for hTERT is y = -0.3025x + 12.127, where y is the Ct value and x = 1 g (copy number).

[0053] Test results are shown in Figure 13and Table 7, where Std represents the recombinant plasmid pCDNA3.1(+)-hTERT standard. The results showed that the amplification efficiency of the hTERT primer probe reached 100.7%. The efficiency of reverse transcription of TERET mRNA using Oligo(dT) was slightly lower than that of the specific reverse transcription primer TERT rt1. 18 After reverse transcription of 293T RNA, TERT rt1 reverse transcription sample and Oligo(dT) 18 The average total TERT mRNA expression levels in the reverse transcribed samples were 272 copies / well and 197 copies / well, respectively.

[0054] Table 7 hTERT primer probe amplification efficiency test and 293T reverse transcription sample absolute quantification data

[0055] 2. Use the TERT6-7 primer probe in Example 1 to detect the TERT rt1 reverse transcription sample of HEK293T, Oligo (dT) 18 The reverse transcription sample and the gradient dilution recombinant plasmid pCDNA3.1 (+) -hTERT, the reaction system and reaction procedure are the same as Example 3. A standard curve was prepared based on the results of the gradient dilution recombinant plasmid pCDNA3.1 (+) -hTERT, and the TERTrt1 reverse transcription sample and Oligo (dT) were calculated. 18 The expression level of TERT mRNA containing TERT exon 6 in the reverse transcribed sample. The absolute quantification formula for TERT 6 is y = -0.2829x + 11.472, where y is the Ct value and x = lg (copy number).

[0056] Test results are shown in Figure 14 As shown in Table 8, the results show that the amplification efficiency of TERT 6-7 primer probe reached 92.1%, the reverse transcription efficiency of TERT rt1 was higher than that of Oligo(dT), and the reverse transcription efficiency of TERT rt1 and Oligo(dT) was higher than that of 18 After reverse transcription of 293T RNA, TERT rt1 reverse transcription sample and Oligo(dT) 18 The average expression levels of TERT mRNA containing exon 6 in the reverse transcription samples were 123 copies / well and 100 copies / well, respectively.

[0057] Table 8 TERT 6-7 primer probe amplification efficiency test and 293T reverse transcription sample absolute quantification data

[0058] 3. Calculate the ratio of the average expression level of TERT mRNA containing exon 6 to the total expression level of TERT mRNA. The ratio of TERT 6 mRNA / hTERT in the TERT rt1 reverse transcription sample is about 0.45, which is consistent with the above results in Example 3. Figure 4 The difference in the test results was small, indicating that the data obtained using the TERT rt1 reverse transcription primer was more stable.

[0059] The ratio of TERT 6 mRNA / hTERT in the Oligo(dT) reverse transcription sample was about 0.51, which was different from that in Comparative Example 1. Figure 10 The test results vary greatly, indicating that the test results are unstable.

[0060] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A method for detecting full-length mRNA of telomerase subunit TERT transcript in human cells, characterized in that: The following steps are involved: The reverse transcription primer TERT rt1 was designed based on exon 11 of the telomerase subunit TERT; Using human cell RNA in the sample to be tested as a template, reverse transcription was performed using the reverse transcription primer TERT rt1 to obtain cDNA. If exon 6 and exon 7 of the telomerase subunit TERT can be detected in the cDNA, it is determined that the sample to be tested contains the full-length mRNA of the human cell telomerase subunit TERT transcript.

2. The method according to claim 1, characterized in that The nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO:

1.

3. The method according to claim 1 or 2, characterized in that The primer probes for detecting exon 6 and exon 7 include an upstream primer TERT6-7 F having a nucleotide sequence as shown in SEQ ID NO: 2, a downstream primer TERT6-7 R having a nucleotide sequence as shown in SEQ ID NO: 3, and a probe TERT6-7 P having a nucleotide sequence as shown in SEQ ID NO:

4.

4. A method for detecting the expression level of full-length mRNA of telomerase subunit TERT transcript in human cells, characterized in that: The following steps are involved: The reverse transcription primer TERT rt1 was designed based on exon 11 of the telomerase subunit TERT gene; Using human cell RNA in the sample to be tested as a template, reverse transcription is performed using the reverse transcription primer TERT rt1 to obtain cDNA. Using cDNA as a template, the expression levels of exons 6 and 7 of the telomerase subunit TERT are detected: A standard curve was drawn using a recombinant plasmid containing the full-length cDNA of the human telomerase subunit TERT transcript as a standard. The absolute expression levels of exon 6 and exon 7 were calculated based on the equation obtained from the standard curve to obtain the absolute expression level of the full-length mRNA of the human telomerase subunit TERT transcript. Or select the internal reference gene and use 2 -ΔΔCt The relative expression levels of exon 6 and exon 7 were calculated by the method to obtain the relative expression level of the full-length mRNA of the telomerase subunit TERT transcript in human cells.

5. The method according to claim 4, characterized in that: The accession number of the full-length cDNA of the human cell telomerase subunit TERT transcript in NCBI is NM_198253.

3.

6. The method according to claim 4, characterized in that: The internal reference gene includes exon 2; The primer probe for detecting exon 2 includes an upstream primer hTERTF whose nucleotide sequence is shown in SEQ ID NO: 5, a downstream primer hTERT R whose nucleotide sequence is shown in SEQ ID NO: 6, and a probe hTERT P whose nucleotide sequence is shown in SEQ ID NO:

7.

7. The method according to any one of claims 1 to 6, characterized in that The human cells include at least one of the following: HEK293T cells, SH-SY5Y cells and HUVEC cells.

8. A detection kit for implementing the method according to any one of claims 1 to 7, characterized in that: Includes reverse transcription primer TERT rt1 and primer probes for detection of exon 6 and exon 7; The nucleotide sequence of the reverse transcription primer TERT rt1 is shown in SEQ ID NO: 1; The primer probes for detecting exon 6 and exon 7 include an upstream primer TERT6-7 F having a nucleotide sequence as shown in SEQ ID NO: 2, a downstream primer TERT6-7 R having a nucleotide sequence as shown in SEQ ID NO: 3, and a probe TERT6-7 P having a nucleotide sequence as shown in SEQ ID NO:

4.

9. The detection kit according to claim 8, characterized in that Also included are primer probes for internal reference gene detection and / or a recombinant plasmid containing the full-length cDNA of the human cell telomerase subunit TERT transcript; The primer probe for internal reference gene detection includes an upstream primer hTERTF with a nucleotide sequence as shown in SEQ ID NO: 5, a downstream primer hTERT R with a nucleotide sequence as shown in SEQ ID NO: 6, and a probe hTERT P with a nucleotide sequence as shown in SEQ ID NO: 7; The accession number of the full-length cDNA of the human cell telomerase subunit TERT transcript in NCBI is NM_198253.

3.

10. Use of the method according to any one of claims 1 to 7 or the kit according to claim 8 or 9 in evaluating telomerase activity for non-diagnostic purposes.

Images