Breeding method of aromatic thermo-sensitive two-line rice sterile line

Abstract

The invention relates to a breeding method of a fragrant temperature-sensitive two-line rice sterile line. The breeding method comprises the following steps: step 1, parent selection; step 2, hybridization; step 2, F1-generation planting and selfing; 3, molecular detection and selection of the F2 generation; and 4, subsequent generation breeding. The fragrant two-line rice sterile line bred by the invention not only has a stable sterility characteristic, can be used for hybrid rice seed production, but also has unique fragrance, enriches the types of rice varieties, and meets the requirements of the market on high-quality fragrant rice.

Description

Technical Field

[0001] The present invention belongs to the technical field of rice genetic breeding, and in particular relates to a method for breeding aromatic and thermosensitive two-line rice sterile lines by combining molecular marker-assisted selection (MAS) technology. Background Art

[0002] Rice is a vital global staple crop. With improving living standards, the demand for high-quality rice is increasing. Aromatic rice, with its unique aroma, is highly sought after in the market. Two-line sterile lines play a crucial role in harnessing heterosis in rice, with their fertility regulated by light and temperature. However, traditional methods for breeding two-line sterile lines rely primarily on phenotypic selection, which is time-consuming and susceptible to environmental interference. Furthermore, selecting for fragrance traits is challenging, as it is difficult to accurately determine whether offspring carry the fragrance gene, and fragrance genes are easily lost during the breeding process. The development of molecular-assisted selection breeding technologies has provided new approaches to address these issues. Summary of the Invention

[0003] The purpose of the present invention is to provide a method for breeding aromatic thermosensitive two-line rice sterile lines. By combining conventional two-line sterile line breeding methods with molecular-assisted breeding technology, the problems of inefficient introduction and easy loss of aromatic traits in the breeding of two-line sterile lines are solved, and the breeding efficiency and accuracy of aromatic two-line rice sterile lines are improved.

[0004] To achieve the above-mentioned and other related objectives, the present invention provides a technical solution: a method for breeding a fragrant, thermosensitive, two-line sterile rice line, comprising the following steps: Step 1: Parent Selection Select a thermosensitive two-line sterile line with stable fertility as the female parent; A rice variety with a fragrance trait is selected as the male parent, and the male parent carries the badh2 fragrance gene and has agronomic traits that are complementary to those of the female parent; Step 2: Hybridization: Artificially hybridize the selected female and male parents to harvest F1 generation seeds; Step 2: F1 generation planting and self-pollination The F1 generation seeds were sown in the experimental field and field management was carried out according to conventional rice planting management methods. At the same time, isolation treatment was carried out and the F2 generation seeds were harvested; Step 3: F2 generation molecular detection and selection Molecular testing: When F2 seeds germinate and grow to the 3-4 leaf stage, leaf tissue is collected; leaf DNA is extracted and the badh2 gene is detected using SSR markers; individual plants carrying the fragrance gene are retained and transplanted into the field. At the mid-tillering stage, each selected individual plant is peeled and divided equally into two corresponding materials, A and B. Both A and B materials are transplanted into the field for continued growth. Part A is screened for sterile plants during the light and temperature sensitive period. Part B is placed in a cold water pool for 15 days during the fourth stage of rice panicle differentiation. The cold water pool temperature is controlled at 22°C. Low temperature stress is used to induce fruiting. F3 seeds are harvested from the sterile plants selected from Part A in Part B. Step 4: Subsequent generation breeding: The seeds selected in the previous generation are planted again to obtain F3 generation seeds; the molecular testing and fertility identification process is repeated in the F3 generation seeds; Step 5: Continuous self-pollination for multiple generations; molecular testing and fertility identification are performed on each generation, and the agronomic traits of the plants are observed and selected; plants with poor agronomic traits are eliminated, and plants with excellent agronomic traits, stable fertility and carrying fragrance trait genes are retained.

[0005] The preferred technical solution is: in step 2, during the specific operation of hybridization, pollen testing is performed on the female parent of the temperature-sensitive two-line sterile line under high temperature conditions in the middle of the season to ensure that the female parent is in sterile conditions; pollen from the male parent is collected for pollination, the hybridization process is completed, and F1 generation seeds are harvested.

[0006] Due to the use of the above technical solution, the present invention has the following advantages compared with the prior art: 1. This invention can enhance breeding accuracy: Traditional breeding methods rely primarily on sensory evaluation to determine aroma traits, which is highly subjective and easily affected by environmental factors. Molecular detection technology can accurately identify the genes at the genetic level, ensuring that the selected sterile lines truly carry the aroma trait gene. By integrating molecular marker-assisted selection throughout the entire sterile line breeding process, it prevents the loss of aroma genes and improves breeding accuracy.

[0007] 2. The present invention can improve breeding efficiency: through molecular-assisted breeding technology, plants carrying fragrance trait genes can be accurately screened in the early generations, avoiding a large amount of ineffective field phenotypic selection work in traditional methods, greatly shortening the breeding cycle and improving breeding efficiency. 3. The present invention can enrich rice variety resources: the fragrant two-line rice sterile line bred by the present invention not only has stable sterility characteristics and can be used for hybrid rice seed production, but also has a unique fragrance, enriching the types of rice varieties and meeting the market demand for high-quality fragrant rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1Flow chart of the method of the present invention. DETAILED DESCRIPTION

[0009] The following describes the implementation of the present invention through specific embodiments. People skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in these embodiments.

[0010] See also Figure 1 . It should be noted that the structures, proportions, sizes, etc. illustrated in the drawings of this specification are only used to match the contents disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the limiting conditions for the implementation of the present invention. Therefore, they have no technical substantive significance. Any modification of the structure, change in the proportional relationship or adjustment of the size. The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional consumables and biochemical reagent stores.

[0011] Example 1: A method for breeding a fragrant thermosensitive two-line sterile rice line Parent selection: A thermosensitive two-line sterile line with excellent agronomic traits and stable fertility was selected as the female parent. A rice variety with a strong aroma trait was selected as the male parent. The male parent carried the badh2 aroma gene, and its agronomic traits were complementary to those of the female parent. Hybridization: Hybridization is performed to obtain a hybrid population. The selected female and male parents are artificially hybridized. Specifically, under high temperatures during the mid-season, pollen from the sterile line is tested to ensure the female parent is sterile. Pollen from the male parent is collected for pollination, completing the hybridization process and harvesting F1 generation seeds. F1 generation planting and self-pollination: The F1 generation seeds were sown in the experimental field and field management was carried out according to conventional rice planting management methods. At the same time, isolation treatment was carried out and the F2 generation seeds were harvested.

[0012] F2 generation molecular testing and selection: Molecular testing: When F2 seeds germinate and grow to the 3-4 leaf stage, leaf tissue is collected. Leaf DNA is extracted and the badh2 gene is detected using SSR markers. Individual plants carrying the fragrance gene are retained and transplanted into the field. At mid-tillering, each selected plant is split equally into two corresponding materials, A and B. Both A and B are transplanted into the field for further growth. Sterile plants are selected for A during the light and temperature sensitive period. During the fourth stage of rice panicle differentiation, B is placed in a cold water pool for 15 days. The pool temperature is controlled at 22°C to induce seed set under low temperature stress. F3 seeds are harvested from the sterile plants selected from A in Pool B.

[0013] Subsequent generation breeding: The seeds selected in the previous generation are then planted to obtain the F3 generation, in which the molecular testing and fertility identification process is repeated.

[0014] Following this method, multiple generations of continuous self-pollination (typically 5-8 generations) are propagated. Each generation undergoes rigorous molecular testing and fertility assessment, while the agronomic traits of the plants are observed and selected. Plants with poor agronomic traits are eliminated, while those with excellent agronomic traits, stable fertility, and genes for aroma traits are retained.

[0015] Stability test: After multiple generations of breeding, the final two-line male sterile rice lines with a strong aroma were tested for stability. These lines were planted in different ecological environments and observed over multiple growing seasons. Fertility stability was assessed by observing pollen fertility and self-pollination fruit set rates. The stability of the aroma trait was also verified by measuring the content of 2-acetyl-1-pyrroline (2-AP), a rice aroma compound, in the grains of the selected individual plants. Ultimately, a two-line male sterile rice line with a strong aroma was successfully bred.

[0016] Example 2: A method for breeding a fragrant thermosensitive two-line sterile rice line Parent selection The female parent was the two-line sterile line 1892S. This sterile line exhibits excellent agronomic traits, including a compact plant shape and strong tillering ability. It also exhibits stable fertility transition characteristics, complete sterility during the sterility period, and stable sterility, with a 100% sterile plant rate. The sterility threshold temperature is relatively low (23.5°C), and the sterility period is stable for more than 30 days in Hefei. It also exhibits good flowering habits and a high outcrossing fruit set rate exceeding 60%. Its plant height is approximately 100 cm, its ear length is approximately 22 cm, and each ear contains approximately 150 grains. Its fruit set rate can reach over 85% under fertility transition conditions.

[0017] The male parent was the fragrant, high-quality restorer line R2106. Its fragrance is controlled by the known badh2 gene, which is recessive and homozygous in R2106, ensuring stable inheritance of the fragrance trait. In normal planting years, this restorer line produces a head rice rate exceeding 70%, a chalky kernel rate below 10%, a chalkiness level less than 2%, an amylose content between 16% and 20%, and a gel consistency exceeding 70 mm, achieving rice quality that meets the national standard for high-quality rice, Grade II or higher. Furthermore, it exhibits excellent combining ability, complementing the agronomic traits of the female parent, 1892S. Plant height is approximately 110 m, ear length is approximately 24 cm, and there are approximately 180 grains per ear. Under normal conditions, the seed set rate can exceed 88%.

[0018] hybridization Adjusting the sowing period: Adjust the sowing period based on local climate conditions and the growth period of the parent strains. Arrange the female strain, 1892S, to head during a long-day, high-temperature period (late July to early August) to ensure sterility under high-temperature conditions. Adjust the sowing period to ensure the flowering periods of the parent strains coincide, with the flowering period within three days.

[0019] Isolation and Pollination: 3 days before heading, the female parent, 1892S, was bagged with parchment paper to prevent contamination from foreign pollen. On the same day, pollen was collected from the male parent, R2106, before flowering and pollination. After pollination under strict isolation conditions, the female parent was bagged again and labeled, recording the pollination date and the parent and female parent IDs. F1 seeds were harvested upon maturity.

[0020] F1 generation planting and self-pollination Planting: In the winter of the same year, F1 seeds were sown in the experimental fields. Seedlings were raised and transplanted according to conventional rice cultivation practices, with a high density of 20 cm row spacing and 15 cm plant spacing. During the growing season, appropriate fertilization, irrigation, and pest and disease control measures were implemented. Field pest and disease conditions were regularly observed, and biological control or low-toxic pesticides were promptly used to control pests and diseases.

[0021] Self-pollination: When the F1 generation plants reach the heading stage, remove the pseudohybrid bags (200-mesh individual bags) and allow them to self-pollinate. When the seeds mature, harvest the F2 generation seeds.

[0022] F2 generation molecular detection and selection Planting and Sampling: Harvested F2 seed plants were transplanted. Leaf DNA was extracted at the seedling stage (three-leaf stage) and tested for the badh2 gene using SSR markers. DNA extracted earlier was also tested for the badh2 gene using SSR markers. The SSR marker sequence is GTTAGGTTGCATTTACTGGGAG, followed by GAATGATGCTCAAAGTGTCT. The fragment containing the fragrance gene is 198 bp, while the fragment without the fragrance gene is 206 bp. Plants carrying the fragrance gene were selected for transplanting into the field. At mid-tillering, each selected plant was stripped and divided equally into two corresponding pools, A and B. Both pools were transplanted into the field for further growth. Pool A was screened for sterile plants during the light-temperature sensitive period. Pool B was placed in a cold water tank at the fourth stage of panicle differentiation for 15 days. The pool temperature was maintained at 22°C to induce seed set under low-temperature stress. F3 seed was harvested from pool B, corresponding to the sterile plants selected from pool A. Leaf DNA was extracted using the CTAB method to a concentration of 50-100 ng / μL, with an A260 / A280 ratio between 1.8 and 2.0. Specific SSR primers were used to amplify the badh2 gene. The PCR reaction system consisted of 1 μL of each primer at 10 nmol / L, 2 μL of 200 μmol / L dNTPs, 2.5 μL of 10× PCR buffer, 2 μL of 2.5 mmol / L MgCl2, 0.2 μL of 1 U Taq enzyme, and 1 μL of template DNA, brought to 25 μL with double-distilled water. The PCR reaction conditions were: 94°C pre-denaturation for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 45 s. PCR products were analyzed by gel electrophoresis to determine if they carried the badh2 gene.

[0023] Screening and processing: In the middle of tillering, each selected individual plant that passed the fragrance gene test in the F2 population was peeled and divided into two corresponding materials, A and B. Both A and B materials were transplanted into the field for continued growth. Infertile plants were selected in the A part during the light and temperature sensitive period. In the fourth stage of rice panicle differentiation, the B part was moved into a cold water pool for cold water treatment. The treatment temperature was set at 22°C to control low temperature stress and fruiting. The sterile plants selected in the A part of the material and the corresponding B part were bagged to harvest the F3 generation seeds.

[0024] Subsequent generation breeding Following the above method and incorporating established breeding parameters, selection was continued until the F6 generation. Each generation was tested and screened using a combination of molecular detection techniques to ensure that the aroma gene was not lost. Fertility and agronomic trait selection were also rigorously performed. Fertility was assessed using pollen staining and self-fertility rate determination. Pollen staining uses an iodine-potassium iodide solution to stain pollen. Fertile pollen appears spherical and dark blue, while sterile pollen appears irregularly shaped and light yellow or unstained. The self-fertility rate was calculated by calculating the ratio of the number of fruiting grains to the total number of spikelets in bagged self-pollinated progeny. Agronomic selection focused on plant height, ear length, number of grains per ear, and fruit set rate. Plant height was required to be between 75-80 cm, ear length between 20-25 cm, and number of grains per ear between 140-200. A fruit set rate exceeding 80% during the fertility transition period was also achieved. Selection was continued for two generations, ultimately resulting in a stable sterile line, designated Taoxiang S. It has excellent agronomic traits, stable fertility and stable aroma traits.

[0025] Stability testing The sterile line Taoxiang S was planted in Hainan and Anhui for two consecutive years. Selected plants underwent molecular testing to determine the stable inheritance of the badh2 gene. Using PCR-SSR markers, the results demonstrated stable inheritance of the badh2 gene throughout both years, with genotype homozygosity exceeding 99%. Pollen fertility and self-fertility rates were also observed, and the content of the aroma compound 2-AP was measured using gas chromatography-mass spectrometry. Observations and testing revealed that Taoxiang S exhibited stable fertility. Under high temperatures (average daily temperature ≥ 23°C), sterility remained at 100%. Under low temperatures, fertility transitions were normal, with self-fertility rates exceeding 82%, and aroma traits remained stable.

[0026] The above description is only used to explain the preferred embodiments of the present invention and is not intended to limit the present invention in any form. Therefore, any modifications or changes made to the present invention under the same inventive spirit should still be included in the scope of protection intended by the present invention.

Claims

1. A method for breeding aromatic thermosensitive two-line sterile rice, characterized by: The following steps are involved: Step 1: Parent Selection Select a thermosensitive two-line sterile line with stable fertility as the female parent; A rice variety with a fragrance trait is selected as the male parent, and the male parent carries the badh2 fragrance gene and has agronomic traits that are complementary to those of the female parent; Step 2: Hybridization: Artificially hybridize the selected female and male parents to harvest F1 generation seeds; Step 2: F1 generation planting and self-pollination The F1 generation seeds were sown in the experimental field and field management was carried out according to conventional rice planting management methods. At the same time, isolation treatment was carried out and the F2 generation seeds were harvested; Step 3: F2 generation molecular detection and selection Molecular testing: When F2 seeds germinate and grow to the 3-4 leaf stage, leaf tissues are collected; Leaf DNA was extracted and the badh2 gene was detected using SSR markers. Individual plants carrying the fragrance gene were retained and transplanted into the field. At mid-tillering stage, each selected individual plant was peeled and divided equally into two corresponding materials, A and B. Both materials A and B were transplanted into the field for continued growth. Infertile plants were selected for the A material during the light and temperature sensitive period. In the fourth stage of rice panicle differentiation, the B material was placed in a cold water pool for 15 days. The temperature of the cold water pool was controlled at 22°C. Low temperature stress was used to induce fruiting. F3 generation seeds were harvested from the individual plants in the B material corresponding to the sterile plants selected from the A material. Step 4: Subsequent Generation Breeding The seeds selected in the previous generation are planted again to obtain F3 generation seeds; the molecular testing and fertility identification process is repeated in the F3 generation seeds; Step 5: Continuous self-pollination for multiple generations; molecular testing and fertility identification are performed on each generation, and the agronomic traits of the plants are observed and selected; plants with poor agronomic traits are eliminated, and plants with excellent agronomic traits, stable fertility and carrying fragrance trait genes are retained.

2. The method for breeding aromatic thermosensitive two-line rice sterile lines according to claim 1, characterized in that: In step 2, during the specific operation of hybridization, pollen testing is performed on the female parent of the temperature-sensitive two-line sterile line under high temperature conditions in the middle of the season to ensure that the female parent is in sterile conditions; pollen from the male parent is collected for pollination, the hybridization process is completed, and F1 generation seeds are harvested.

Images