Application of siRNA for targeted inhibition of rabies virus G gene and / or L gene in preparation of drugs for inhibiting rabies

Abstract

The invention discloses application of siRNA for targeted inhibition of rabies virus G gene and / or L gene in preparation of drugs for inhibiting rabies. SiRNA-G for targeted inhibition of a rabies virus G gene and siRNA-L for targeted inhibition of a rabies virus L gene are provided on the basis, the nucleotide sequence of a sense strand of the siRNA-G is as shown in SEQ ID NO: 1, and the nucleotide sequence of an antisense strand of the siRNA-G is as shown in SEQ ID NO: 2; the nucleotide sequence of the positive-sense strand of the siRNA-L is as shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of the siRNA-L is as shown in SEQ ID NO: 4. The siRNA-G and / or siRNA-L can effectively inhibit the expression of the G gene and the L gene of the rabies virus and reduce the proliferation of the rabies virus, and can be used as an effective small nucleic acid drug in the development process of anti-rabies virus drugs.

Description

[0001] This application is a divisional application of the invention patent application with the application date of August 12, 2024, application number 2024110990459, and the invention name "Application of siRNA targeting the inhibition of rabies virus G gene and / or L gene in the preparation of drugs for inhibiting rabies". Technical Field

[0002] The present invention relates to the field of biomedicine technology, and in particular to the use of siRNA that targets and inhibits the G gene and / or L gene of rabies virus in the preparation of a drug for inhibiting rabies. Background Art

[0003] Rabies is a zoonotic disease caused by the rabies virus (RABV). It can cause fatal meningitis in mammals, severe neurological symptoms such as convulsions and paralysis, and ultimately death. Currently, there is no effective treatment for rabies, and once clinical symptoms appear, the mortality rate is nearly 100%.

[0004] RNA interference (RNAi) is a relatively conserved gene regulation method in the evolution of organisms. It uses small fragments to silence the expression of specific mRNA. During the RNA interference process, long double-stranded RNA precursors are first cleaved into short interfering RNAs. Subsequently, the RNA-induced silencing complex binds to the siRNA and degrades one of the RNA chains. The other chain guides the RISC complex to specifically degrade the targeted mRNA sequence.

[0005] The high mutation rate of viruses makes it possible for them to evade the host's immune system, as well as the therapeutic effects of antiviral drugs and vaccines. Therefore, the development of new and alternative antiviral therapies is particularly important. In recent years, researchers have widely used cellular RNA interference technology to target a variety of viral genes. Short interfering RNA (siRNA) designed for different viral genes can significantly inhibit viral replication after infecting cells, thereby exerting a therapeutic effect.

[0006] Currently, the design of siRNA for rabies virus mainly focuses on targeting the N gene and P gene. The research on the targeted gene of rabies virus is particularly important, which can provide more targets for the prevention and treatment of rabies, thereby achieving the prevention and treatment of rabies virus. Summary of the Invention

[0007] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art and to provide the use of siRNA that targets and inhibits the rabies virus G gene and / or L gene in the preparation of drugs for inhibiting rabies.

[0008] The first object of the present invention is to provide the use of siRNA that targets and inhibits the G gene and / or L gene of rabies virus in the preparation of drugs for inhibiting rabies.

[0009] The second object of the present invention is to provide a siRNA-G that targets and inhibits the rabies virus G gene.

[0010] The third object of the present invention is to provide a siRNA-L that targets and inhibits the rabies virus L gene.

[0011] The fourth object of the present invention is to provide the use of the above-mentioned siRNA-G and / or the above-mentioned siRNA-L in the preparation of drugs for inhibiting rabies.

[0012] A fifth object of the present invention is to provide a pharmaceutical composition for inhibiting rabies.

[0013] In order to achieve the above object, the present invention is implemented through the following scheme:

[0014] The present invention seeks to protect the use of siRNA that targets and inhibits the G gene and / or L gene of rabies virus in the preparation of drugs for inhibiting rabies.

[0015] Preferably, the inhibition of rabies is the inhibition of the expression of the rabies virus G gene and / or L gene.

[0016] Preferably, the rabies virus is the rabies virus CVS-11 strain.

[0017] The present invention also claims protection for a siRNA-G targeting the rabies virus G gene, wherein the nucleotide sequence of the positive chain of the siRNA-G is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense chain of the siRNA-G is shown in SEQ ID NO: 2.

[0018] The present invention also claims protection for a siRNA-L that targets and inhibits the rabies virus L gene, wherein the nucleotide sequence of the positive chain of the siRNA-L is shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense chain of the siRNA-L is shown in SEQ ID NO: 4.

[0019] The present invention also seeks to protect the use of the above siRNA-G and / or the above siRNA-L in the preparation of drugs for inhibiting rabies.

[0020] Preferably, the rabies virus is the rabies CVS-11 strain.

[0021] Preferably, the inhibition of rabies is the inhibition of the expression of the rabies G gene and / or L gene.

[0022] The present invention also seeks to protect a pharmaceutical composition for inhibiting rabies, comprising the above-mentioned siRNA-G, the above-mentioned siRNA-L and / or any one of the above-mentioned delivery systems.

[0023] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0024] More preferably, the pharmaceutical composition is administered by intracranial administration, intramuscular injection and / or intravenous injection.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides the use of siRNA that targets and inhibits the rabies virus G gene and / or L gene in the preparation of a drug for inhibiting rabies. Based on this, siRNA-G that targets and inhibits the rabies virus G gene and siRNA-L that targets and inhibits the rabies virus L gene are provided, wherein the nucleotide sequence of the sense strand of siRNA-G is shown in SEQ ID NO: 1, and the nucleotide sequence of the antisense strand of siRNA-G is shown in SEQ ID NO: 2; the nucleotide sequence of the sense strand of siRNA-L is shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of siRNA-L is shown in SEQ ID NO: 4. The siRNA-G and / or siRNA-L can effectively inhibit the expression of the rabies virus G gene and L gene, reduce the proliferation of rabies virus, and can be used as effective small nucleic acid drugs in the development of anti-rabies virus drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Graphs showing the fluorescence microscopy observation results of each cell plate during direct immunofluorescence detection in Example 2;

[0028] Figure 2It is a graph of the fluorescence quantitative PCR detection results in Example 2; A is a graph of the mRNA level of the L gene in si-L2157-NA fluorescent amplification product, si-L5055-NA fluorescent amplification product, si-L5773-NA fluorescent amplification product and siNC-NA fluorescent amplification product; B is a graph of the mRNAS level of the L gene in si-L2157-BHK fluorescent amplification product, si-L5055-BHK fluorescent amplification product, si-L5773-BHK fluorescent amplification product and siNC-BHK fluorescent amplification product; C is a graph of the mRNA level of the G gene in si-G997-NA fluorescent amplification product, si-G193-NA fluorescent amplification product, si-G672-NA fluorescent amplification product and siNC-NA fluorescent amplification product; D is a graph of the mRNA level of the G gene in si-G997-BHK fluorescent amplification product, si-G193-BHK fluorescent amplification product, si-G672-BHK fluorescent amplification product and siNC-BHK fluorescent amplification product;

[0029] Figure 3 TCID in Example 2 50 Detection results: A is the TCID in NA cells infected with si-G997-NA virus solution 50 TCID in NA cells infected with si-G193-NA virus solution 50 TCID in NA cells infected with si-G672-NA virus solution 50 TCID in NA cells infected with siNC-NA virus solution 50 The results are shown in Figure B, where TCID 50 TCID in NA cells infected with si-L2157-NA virus solution 50 TCID in NA cells infected with si-L5773-NA virus solution 50 TCID in NA cells infected with siNC-NA virus solution 50 The result graph;

[0030] Figure 4 3 is the identification result diagram of the expression plasmid in Example 3;

[0031] Figure 5 This is a diagram showing the identification results of the packaging plasmid in Example 3;

[0032] Figure 6 This is a fluorescence curve diagram of pAAV-EGFP with different copy numbers in Example 3;

[0033] Figure 7 It is the standard curve diagram in Example 3;

[0034] Figure 8 Figures 1 and 2 show the results of virus titer detection of cell supernatants at different times after inoculation with CVS-11 strain in Example 4 and the results of transcription level detection of each recombinant adeno-associated virus infection group; A shows the G gene transcription level results of the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; B shows the L gene transcription level results of the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; C shows the results of virus titer detection of cell supernatants at different times after inoculation with CVS-11 strain in the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; D shows the results of virus titer detection of cell supernatants at different times after inoculation with CVS-11 strain in the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group.

[0035] Figure 9 This is a graph showing the weight change rate of mice in each group 21 days after challenge with the poison in Example 5;

[0036] Figure 10 This is a graph showing the changes in survival rate of each group of mice in Example 5 21 days after infection. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below with reference to the accompanying drawings and specific examples. The examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are commercially available unless otherwise specified.

[0038] Example 1 Design and Synthesis of siRNA

[0039] 1. Experimental Methods

[0040] Based on the CDS region of the G gene of the rabies CVS-11 strain (accession number: GQ918139.1), sequences starting with "AA", containing 30% to 55% CG bases, with a single base repeated less than 4 times and a length of 21 bases were screened. The 19 bases after AA were used as the target sequence, and siRNAs targeting the G gene of the rabies CVS-11 strain were designed using online software (https: / / sidirect2.rnai.jp / ), including si-G997, si-G193, and si-G672.

[0041] Based on the CDS region of the L gene of the rabies CVS-11 strain (accession number: GQ918139.1), sequences starting with "AA", containing 30% to 55% CG bases, with <4 consecutive repeats of a single base and a length of 21 bases were screened. The 19 bases after AA were used as the target sequence, and siRNAs targeting the L gene of the rabies CVS-11 strain were designed using online software (https: / / sidirect2.rnai.jp / ), including si-L5055, si-L2157, and si-L5773.

[0042] siNC design: siNC uses the same base composition as si-G997, with AA fixed as the start and the remaining 19 bases randomly arranged. BLAST comparison was performed to determine the arrangement with no obvious homology to rabies virus and known genes in the GenBank database, which served as a negative control siNC.

[0043] 2. Experimental Results

[0044] The forward and reverse strands and nucleotide information of the siRNA designed in step 1 are shown in Table 1.

[0045] Table 1. Forward and reverse strands and nucleotide information of siRNA

[0046]

[0047] Example 2 Effect of siRNA on Rabies Virus in Cells

[0048] 1. Experimental Methods

[0049] 1. Construction of experimental group cells

[0050] (1) Construction of NA cell plates

[0051] 1) NA cells were seeded in a cell culture dish and cultured in RPMI-1640 medium until the NA cells covered the dish. The culture medium was discarded, and the dish was washed three times with PBS. The PBS was then discarded, and 2 mL of 0.25% (w / w) trypsin was added to digest the cells for 30 s. The trypsin was discarded, and complete culture medium was added to suspend the cells to obtain a cell suspension with a cell concentration of 200,000 cells / mL. The cell suspension was inoculated into a 12-well cell culture plate at 1 mL / well and cultured at 37°C, 5% (w / w) CO2 to obtain a NA cell plate to be transfected.

[0052] 2) Label two 1.5 mL EP tubes as Tube A and Tube B, add 100 μL of RPMI-1640 medium to Tube A and Tube B respectively, and then add 2 μL of Lipofectamine to Tube A. TM3000 transfection reagent and mix thoroughly, add 4 μL of si-G997 shown in Example 1 with a concentration of 20 μM to tube B and mix thoroughly, then add the liquid in tube B to tube A and mix evenly with the liquid in tube A, and let it stand at 25°C for 15 min to obtain si-G997 transfection complex.

[0053] The si-G997 shown in Example 1 in tube B was replaced with si-G193, si-G672, si-L5055, si-L2157, si-L5773 and siNC shown in Example 1, respectively, to obtain si-G193 transfection complex, si-G672 transfection complex, si-L5055 transfection complex, si-L2157 transfection complex, si-L5773 transfection complex and siNC transfection complex.

[0054] 3) si-G997-NA cell plate: Discard the liquid in the NA cell plate to be transfected obtained in step 1), wash twice with PBS, add 1640 culture medium at a rate of 500 μL / well, then add si-G997 transfection complex obtained in step 2) at a rate of 206 μL / well, and culture at 37°C, 5% (w / w) CO2 for 6 h. After the culture period, discard the liquid in the cell plate to obtain the si-G997-NA cell plate.

[0055] si-G193-NA cell plate: replace the si-G997 transfection complex in the si-G997-NA cell plate construction process with the si-G193 transfection complex obtained in step 2), and perform the remaining treatments in the same manner to obtain the si-G193-NA cell plate.

[0056] si-G672-NA cell plate: replace the si-G997 transfection complex in the si-G997-NA cell plate construction process with the si-G672 transfection complex obtained in step 2), and perform the remaining treatments in the same manner to obtain the si-G672-NA cell plate.

[0057] si-L5055-NA cell plate: replace the si-G997 transfection complex in the si-G997-NA cell plate construction process with the si-L5055 transfection complex obtained in step 2), and perform the remaining treatments in the same manner to obtain the si-L5055-NA cell plate.

[0058] si-L2157-NA cell plate: replace the si-G997 transfection complex used in the si-G997-NA cell plate construction process with the si-L2157 transfection complex obtained in step 2), and perform the remaining treatments in the same manner to obtain the si-L2157-NA cell plate.

[0059] si-L5773-NA cell plate: replace the si-G997 transfection complex in the si-G997-NA cell plate construction process with the si-L5773 transfection complex obtained in step 2), and perform the remaining treatments in the same manner to obtain the si-L5773-NA cell plate.

[0060] siNC-NA cell plate: replace the si-G997 transfection complex in the si-G997-NA cell plate construction process with the siNC transfection complex obtained in step 2), and perform the remaining treatments in the same manner to obtain the siNC-NA cell plate.

[0061] (2) Construction of BHK-21 cell plates

[0062] The NA cells in step (1) were replaced with BHK-21 cells and treated identically to obtain BHK cell plates to be transfected, si-G997-BHK cell plates, si-G193-BHK cell plates, si-G672-BHK cell plates, si-L5055-BHK cell plates, si-L2157-BHK cell plates, si-L5773-BHK cell plates, and siNC-BHK cell plates.

[0063] 2. Direct immunofluorescence detection

[0064] The HA cell plate to be transfected, si-G997-NA cell plate, si-G193-NA cell plate, si-G672-NA cell plate, si-L5055-NA cell plate, si-L2157-NA cell plate, si-L5773-NA cell plate, siNC-NA cell plate, BHK cell plate to be transfected, si-G997-BHK cell plate, si-G193-BHK cell plate, si-G672-BHK cell plate, si-L5055-BHK cell plate, si-L2157-BHK cell plate, si-L5773-BHK cell plate and siNC-BHK cell plate obtained in step 1 were inoculated with rabies virus CVS- at an MOI of 0.1. 11 strains, and cultured in RPMI-1640 medium for 48 h, then discarded the liquid, washed each cell plate once with PBS, added 80% (v / v) acetone to each cell plate at 500 μL / well, fixed at -20°C for 30 min, discarded the acetone, washed each cell plate three times with PBS, and added fluorescein isothiocyanate (FITC)-labeled anti-rabies virus N protein fluorescent antibody to each cell plate at 400 μL / well, incubated at 4°C for 16 h, discarded the fluorescein isothiocyanate (FITC)-labeled anti-rabies virus N protein fluorescent antibody after the incubation, washed three times with PBS, and added PBS to each cell plate at 1 mL / well, and observed each cell plate under a fluorescence microscope.

[0065] 3. Fluorescence quantitative PCR detection

[0066] The si-G997-NA cell plate, si-G193-NA cell plate, si-G672-NA cell plate, si-L5055-NA cell plate, si-L2157-NA cell plate, si-L5773-NA cell plate, siNC-NA cell plate, si-G997-BHK cell plate, si-G193-BHK cell plate, si-G672-BHK cell plate, si-L5055-BHK cell plate, si-L2157-BHK cell plate, si-L5773-BHK cell plate and siNC-BHK cell plate obtained in step 1 were inoculated with rabies virus CVS-11 strain at an MOI of 0.1 and cultured in RPMI-1640 medium. After 48 hours, the liquid in each cell plate was discarded, and the cells were washed once with PBS. Trizol was added to each cell plate at 1 mL / well. After blowing the cells, the supernatant in each cell plate was collected to obtain si-G997-NA supernatant, si-G193-NA supernatant, si-G672-NA supernatant, si-L5055-NA supernatant, si-L2157-NA supernatant, si-L5773-NA supernatant, siNC-NA supernatant, si-G997-BHK supernatant, si-G193-BHK supernatant, si-G672-BHK supernatant, si-L5055-BHK supernatant, si-L2157-BHK supernatant, si-L5773-BHK supernatant and siNC-BHK supernatant.

[0067] HiPure Universal RNAMini Kit (Magen, R4130-02) was used to extract si-G997-NA supernatant, si-G193-NA supernatant, si-G672-NA supernatant, si-L5055-NA supernatant, si-L2157-NA supernatant, si-L5773-NA supernatant, siNC-NA supernatant, si-G997-BHK supernatant, si-G193-BHK supernatant, si-G672-BHK supernatant, si-L5055-BHK supernatant, si-L2157-BHK supernatant, si-L5773-BHK supernatant and siNC-BHK supernatant respectively according to the kit instructions. RNA was obtained from the si-G997-NA RNA, si-G193-NA RNA, si-G672-NA RNA, si-L5055-NA RNA, si-L2157-NA RNA, si-L5773-NA RNA, siNC-NA RNA, si-G997-BHK RNA, si-G193-BHK RNA, si-G672-BHK RNA, si-L5055-BHK RNA, si-L2157-BHK RNA, si-L5773-BHK RNA and siNC-BHK RNA.

[0068] The RNA of si-G997-NA, si-G193-NA, si-G672-NA, si-L5055-NA, si-L2157-NA, si-L5773-NA, siNC-NA, si-G997-BHK, si-G193-BHK, si-G672-BHK, si-L5055-BHK, si-L2157-BHK, si-L5773-BHK and siNC-BHK were used as templates, respectively. The cDNA was quantified using EasyScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA The reverse transcription system shown in Table 2 was thoroughly mixed and incubated at 42°C for 15 min, followed by heating at 85°C for 5 s to obtain cDNA of si-G997-NA, cDNA of si-G193-NA, cDNA of si-G672-NA, cDNA of si-L5055-NA, cDNA of si-L2157-NA, cDNA of si-L5773-NA, cDNA of siNC-NA, cDNA of si-G997-BHK, cDNA of si-G193-BHK, cDNA of si-G672-BHK, cDNA of si-L5055-BHK, cDNA of si-L2157-BHK, cDNA of si-L5773-BHK, and cDNA of siNC-BHK.

[0069] Table 2 Reverse transcription system

[0070] Components Addition amount Template (RNA) 1 μg 5×EasyScript All-in-One SuperMix for qPCR 4μL gDNARemover 1 μL RNase-free Water Make up to 20 μL Total volume 20 μL

[0071] PerfectStart Green qPCR was used to amplify the expression of si-G997-NA cDNA, si-G193-NA cDNA, si-G672-NA cDNA, si-L5055-NA cDNA, si-L2157-NA cDNA, si-L5773-NA cDNA, siNC-NA cDNA, si-G997-BHK cDNA, si-G193-BHK cDNA, si-G672-BHK cDNA, si-L5055-BHK cDNA, si-L2157-BHK cDNA, si-L5773-BHK cDNA, and siNC-BHK cDNA as templates. The SuperMix Fluorescence Quantification Kit (Quanshijin Company, AQ601-01-V2) was used for qPCR fluorescence amplification according to the kit instructions to obtain si-G997-NA fluorescent amplification product (corresponding to the G gene of CVS-11), si-G193-NA fluorescent amplification product (corresponding to the G gene of CVS-11), si-G672-NA fluorescent amplification product (corresponding to the G gene of CVS-11), si-L5055-NA fluorescent amplification product (corresponding to the L gene of CVS-11), si-L2157-NA fluorescent amplification product (corresponding to the L gene of CVS-11), si-L5773-NA fluorescent amplification product (corresponding to the L gene of CVS-11), siNC-NA fluorescent amplification product, and si-G997- BHK fluorescent amplification product (corresponding to the G gene of CVS-11), si-G193-BHK fluorescent amplification product (corresponding to the G gene of CVS-11), si-G672-BHK fluorescent amplification product (corresponding to the G gene of CVS-11), si-L5055-BHK fluorescent amplification product (corresponding to the L gene of CVS-11), si-L2157-BHK fluorescent amplification product (corresponding to the L gene of CVS-11), si-L5773-BHK fluorescent amplification product (corresponding to the L gene of CVS-11) and siNC-BHK fluorescent amplification product. The Ct value of each fluorescent amplification product was observed using an inverted fluorescence microscope, and the transcription level (i.e., mRNA level) of the G gene or L gene of each fluorescent product was calculated according to the 2-ΔΔCt method.

[0072] When the cDNA of si-G997-NA, si-G193-NA, si-G672-NA, si-G997-BHK, si-G193-BHK or si-G672-BHK is used as a template, the nucleotide sequence of the forward primer CVS-GF in the qPCR fluorescence quantification process is shown in SEQ ID NO: 15, and the nucleotide sequence of the reverse primer CVS-GR is shown in SEQ ID NO: 16; when the cDNA of si-L5055-NA, si-L2157-NA, si-L5773-NA, si-L5055-BHK, si-L2157-BHK or si-L5773-BHK is used as a template, the nucleotide sequence of the forward primer CVS-LF in the qPCR fluorescence quantification process is shown in SEQ ID NO: NO: 17, the nucleotide sequence of the reverse primer CVS-LR is shown in SEQ ID NO: 18; when siNC-NA cDNA or siNC-BHK cDNA is used as a template, the nucleotide sequence of the forward primer GAPDH-F in the qPCR fluorescence quantification process is shown in SEQ ID NO: 19, and the nucleotide sequence of the reverse primer GAPDH-R is shown in SEQ ID NO: 20; the primer information used in the qPCR fluorescence quantification process is shown in Table 3.

[0073] Table 3 Primer information used in qPCR fluorescence quantification

[0074] name Nucleotide information (5'-3') CVS-GF (SEQ ID NO: 15) TCCCTGGAGCCCTATTGACA CVS-GR (SEQ ID NO: 16) ACCCGTTCACTTTGATGGCT CVS-LF (SEQ ID NO: 17) TCTCTCAAAGTGGGCGGAAC CVS-LR (SEQ ID NO: 18) ACATCTCCGGCTCCTGTTTG GAPDH-F (SEQ ID NO: 19) CGTCCCGTAGACAAAATGGT GAPDH-R (SEQ ID NO: 20) TTGATGGCAACAATCTCCAC

[0075] 4. TCID 50 Detection

[0076] The si-G997-NA cell plate, si-G193-NA cell plate, si-G672-NA cell plate, si-L5055-NA cell plate, si-L2157-NA cell plate, si-L5773-NA cell plate and siNC-NA cell plate obtained in step 1 were inoculated with rabies virus CVS-11 strain at MOI = 0.1, and cultured with RPMI-1640 medium for 48 hours, and then the supernatant of each cell plate was collected to obtain si-G997-NA virus liquid, si-G193-NA virus liquid, si-G672-NA virus liquid, si-L5055-NA virus liquid, si-L2157-NA virus liquid, si-L5773-NA virus liquid and siNC-NA virus liquid.

[0077] NA cells with good growth conditions were passaged into 96-well plates and cultured in a constant temperature incubator at 37° C. and 5% (w / w) CO 2 to obtain NA cell 96-well plates with a cell density of 10,000 cells / well.

[0078] Then, the si-G997-NA virus solution was diluted 10-fold using RPMI1640 medium (dilution was 10 -1 ~10 -8 ), si-G997-NA virus solution of each dilution was inoculated into 96-well NA cell plates at 100 μL / well (4 replicates for each dilution), and the plates were placed in a constant temperature incubator at 37°C and 5% (w / w) CO2, cultured in RPMI-1640 medium containing 5% (v / v) serum for 48 h, the medium was discarded, PBS was added at 100 μL / well for washing, PBS was discarded, and 80% (v / v) acetone was added at 100 μL / well. After fixing at -20°C for 30 min, the acetone was discarded, and the plates were washed three times with PBS. Anti-rabies virus N protein fluorescent antibody (Fujirebio) was added at 50 μL / well in the dark. Diagnostic Company, catalog number 800-092) diluent (fluorescent antibody and PBS are mixed at a volume ratio of 1:400), incubate at 4°C for 16 h, discard the supernatant, wash with PBS three times, add PBS at a rate of 100 μL / well, observe the fluorescence under a fluorescence microscope, record the wells where fluorescence is detected as positive wells, and calculate the virus titer (TCID) in NA cells infected with si-G997-NA virus solution according to the Karber method. 50 ).

[0079] The si-G997-NA virus solution was replaced with si-G193-NA virus solution, si-G672-NA virus solution, si-L5055-NA virus solution, si-L2157-NA virus solution, si-L5773-NA virus solution, and siNC-NA virus solution, respectively. The virus titer in NA cells infected with si-G193-NA virus solution, the virus titer in NA cells infected with si-G672-NA virus solution, the virus titer in NA cells infected with si-L5055-NA virus solution, the virus titer in NA cells infected with si-L2157-NA virus solution, the virus titer in NA cells infected with si-L5773-NA virus solution, and the virus titer in NA cells infected with siNC-NA virus solution were calculated according to the above method.

[0080] 2. Experimental Results

[0081] 1. Direct immunofluorescence test results

[0082] The fluorescence microscope observation results of each cell plate during direct immunofluorescence detection are shown in the figure below. Figure 1 As shown, the results showed that: whether in NA cells or BHK-21 cells, compared with the negative control (siNC, i.e., cell plates transfected with siNC) and the viral control (viral control, i.e., cell plates to be transfected), the fluorescent spots in the cell plates transfected with si-G997, si-G193, si-G672, and si-L5055 were significantly reduced, indicating that the transfected cells can significantly inhibit the proliferation of rabies virus (CVS-11 strain);

[0083] 2. Fluorescence quantitative PCR test results

[0084] Fluorescence quantitative PCR test results are shown in the figure Figure 2 As shown; A is a graph showing the mRNA level of the L gene in si-L2157-NA fluorescent amplification products, si-L5055-NA fluorescent amplification products, si-L5773-NA fluorescent amplification products, and siNC-NA fluorescent amplification products; B is a graph showing the mRNAS level of the L gene in si-L2157-BHK fluorescent amplification products, si-L5055-BHK fluorescent amplification products, si-L5773-BHK fluorescent amplification products, and siNC-BHK fluorescent amplification products; C is a graph showing the mRNA level of the G gene in si-G997-NA fluorescent amplification products, si-G193-NA fluorescent amplification products, si-G672-NA fluorescent amplification products, and siNC-NA fluorescent amplification products; D is a graph showing the mRNA level of the G gene in si-G997-BHK fluorescent amplification products, si-G193-BHK fluorescent amplification products, si-G672-BHK fluorescent amplification products, and siNC-BHK fluorescent amplification products.

[0085] The results showed that compared with the negative control (siNC), the mRNA levels of the rabies virus L gene in NA cells and BHK-21 cells transfected with si-L5055 were significantly decreased, while the mRNA levels of the rabies virus L gene in NA cells and BHK-21 cells transfected with si-L2157 or si-L5773 did not decrease and even increased.

[0086] Compared with the negative control (siNC), the mRNA levels of rabies virus G gene in NA cells and BHK-21 cells transfected with si-G193, si-G672 and si-G997 were significantly decreased.

[0087] The results showed that both si-G997 and si-L5055 could effectively interfere with the transcriptional expression of rabies virus genes in cells. Among them, si-G997 could significantly inhibit the transcriptional expression of rabies virus (CVS-11 strain) G gene, and si-L5055 could significantly inhibit the transcriptional expression of rabies virus (CVS-11 strain) L gene.

[0088] 3. TCID 50 Test results

[0089] TCID 50 The test results are shown in the figure Figure 3 As shown, A is the TCID in NA cells infected with si-G997-NA virus solution 50 TCID in NA cells infected with si-G193-NA virus solution 50 TCID in NA cells infected with si-G672-NA virus solution 50 TCID in NA cells infected with siNC-NA virus solution 50 The results are shown in Figure B, where TCID 50 TCID in NA cells infected with si-L2157-NA virus solution 50 TCID in NA cells infected with si-L5773-NA virus solution 50 TCID in NA cells infected with siNC-NA virus solution 50 Result graph.

[0090] The results showed that compared with the negative control (TCID 50 ), the virus titers in NA cells infected with si-G997-NA virus solution and si-L5055-NA virus solution were significantly decreased; while the virus titers in NA cells infected with other virus solutions did not show obvious changes.

[0091] The results showed that si-G997 and si-L5055 could significantly inhibit the replication of rabies virus (CVS-11 strain); while si-G193, si-G672, si-L2157 and si-L5775 could not inhibit the replication of rabies virus.

[0092] Example 3 Construction of siRNA-Packaged Lentivirus

[0093] 1. Experimental Methods

[0094] 1. Construction of lentivirus rAAV-G997 packaging si-G997 (siRNA-G)

[0095] (1) Construction of expression plasmid:

[0096] 1) Using the Xba I and Kpn I restriction sites of the pEU6 vector as insertion sites, si-G997-F with a nucleotide sequence as shown in SEQ ID NO: 21 and si-G997-R with a nucleotide sequence as shown in SEQ ID NO: 22 were synthesized; wherein the total amount of si-G997-F or si-G997-R was greater than or equal to 2 OD.

[0097] The structure of si-G997-F is: 5'-Xba I sticky end + sense + loop + antisense + transcription termination site + Kpn I sticky end-3';

[0098] The structure of si-G997-R is: 5'-Kpn I sticky end + transcription termination site complementary sequence + sense + loop + antisense + Xba I complementary sticky end-3'.

[0099] 2) Place the annealing system shown in Table 4 into a PCR tube, pipette to mix, and then anneal to obtain double-stranded DNA.

[0100] Table 4 Annealing system

[0101] Components volume si-G997-F (SEQ ID NO: 21, 100 μM) 5μL si-G997-R (SEQ ID NO: 22, 100 μM) 5μL T4 DNA Ligase 10× Buffer 5μL Deionized water 35μL Total volume 50μL

[0102] Annealing program: 95°C, 2 min; 95°C, 20 s, 70 cycles, decreasing 1°C each cycle.

[0103] The pEU6 vector was double-digested with Xba I endonuclease and Kpn I endonuclease to obtain a linearized pEU6 vector, which was then ligated according to the ligation system shown in Table 5 to obtain a recombinant pEU6 vector.

[0104] Table 5 Connection system

[0105]

[0106]

[0107] Connection procedure: 22℃, 30min; 65℃, 10min.

[0108] 3) 10 μL of the recombinant pEU6 vector obtained in step 2) was transformed into Escherichia coli competent cells DH5α and cultured. Five Escherichia coli DH5α monoclonal colonies transformed with the recombinant pEU6 vector were selected and identified using the U6 upstream identification primer with the nucleotide sequence shown in SEQ ID NO: 23 and the U6 downstream identification primer with the nucleotide sequence shown in SEQ ID NO: 24 (amplified fragment length: 666 bp). The electrophoresis bands were recorded, and the correctly identified recombinant pEU6 vector was the expression plasmid pEU6-si-G997.

[0109] (2) Construction of packaging plasmid

[0110] 1) Insert EGFP fluorescent protein into the Xba I site of the pAAV-CMV Verctor vector (Takara, Cat. No. 6230) to obtain the pAAV-EGFP vector.

[0111] The Hind III restriction site of the pAAV-EGFP vector was used as the insertion site to synthesize CMV-U6-G997-F with a nucleotide sequence as shown in SEQ ID NO: 25 and CMV-U6-G997-R with a nucleotide sequence as shown in SEQ ID NO: 26.

[0112] 2) The pAAV-EGFP vector was digested with Thermo Fisher Hind III fast endonuclease to obtain a linearized pAAV-EGFP vector.

[0113] The pEU6-si-G997 plasmid obtained in step (1) was used as a template and the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Novozymes) was used according to its instructions to combine the nucleotide sequence of CMV-U6-G997-F shown in SEQ ID NO: 25 and the nucleotide sequence of CMV-U6-G997-R shown in SEQ ID NO: 26 to amplify the G997 siRNA expression cassette.

[0114] The G997 siRNA expression cassette and the linearized pAAV-EGFP vector were ligated using T4 DNA ligase to obtain the recombinant pAAV-EGFP vector.

[0115] 3) 10 μL of the recombinant pAAV-EGFP vector obtained in step 2) was transformed into Escherichia coli DH5α competent cells and cultured. Eight Escherichia coli DH5α monoclonal colonies transformed with the recombinant pAAV-EGFP were selected and identified using a CMV-U6-siRNA upstream identification primer with a nucleotide sequence as shown in SEQ ID NO: 27 and a CMV-U6-siRNA downstream identification primer with a nucleotide sequence as shown in SEQ ID NO: 28 (amplified fragment length was 934 bp). The correctly identified recombinant pAAV-EGFP vector was the packaging plasmid pAAV-si-G997.

[0116] (3) Construction of recombinant adeno-associated virus rAAV-G997

[0117] 1) Escherichia coli DH5α monoclonal colonies transformed with recombinant pAAV-EGFP were cultured in LB medium at 37°C for 16 h to obtain a bacterial suspension. The bacterial suspension was then inoculated into 200 mL of ampicillin-resistant LB medium at a volume ratio of 1:100 and cultured on a shaker at 37°C for 16 h. The plasmid was extracted from the cultured bacterial suspension using a plasmid extraction kit (OMEGA) according to the manufacturer's instructions to obtain 300 μg of pAAV-si-G997 plasmid.

[0118] 2) Prepare two 50 mL centrifuge tubes, designated Tube A and Tube B. Add 120 μg of pAAV-si-G997 (from Step 2), 120 μg of pHelper, and 120 μg of pRC2-mi342 to Tube A. Bring the volume of the solution in Tube A to 15 mL with high-glucose DMEM and mix thoroughly.

[0119] Add 720 μL of transfection reagent lipo293TM to tube B, and use high-glucose DMEM to make the liquid volume in tube B to 15 mL, and mix well.

[0120] Pour the liquid in tube B into tube A, mix well, and place it at 25°C for 15 minutes to obtain 30 mL of transfection complex. Then, add the transfection complex to 10 15 mm culture dishes seeded with HEK-293T cells (cell density ≥ 90%) at a rate of 3 mL / dish, and culture in a 37°C, 5% (v / v) CO2 incubator for 72 hours. After the culture is completed, collect the culture fluid in each culture dish into different 50 mL centrifuge tubes, use trypsin to digest the attached cells at the bottom of each culture dish, discard the trypsin, blow off the attached cells in each culture dish with a pipette, and mix them evenly with the culture fluid in each culture dish. Centrifuge at 800 r / min for 5 minutes, discard the supernatant, and use the precipitate. Purification Kit (AAV2) (TAKARA) was used to purify and collect the recombinant adeno-associated virus rAAV-G997 according to its instructions.

[0121] (4) Virus titer test of recombinant adeno-associated virus rAAV-G997

[0122] Mix 1 μL of rAAV-G997 obtained in step (3) with 6 μL of deionized water, then add 1 μL of DNase and 1 μL of RNase, mix well, and digest at 37°C for 30 minutes. After digestion, denature at 100°C for 10 minutes, then add 1 μL of proteinase K, digest at 56°C for 1 hour, and then centrifuge at 10,000 r / min for 10 minutes. Collect the supernatant, which is the rAAV-G997 nucleic acid sample.

[0123] Using pAAV-EGFP plasmid as a standard, the copy number of pAAV-EGFP plasmid was diluted to 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL and 10 4 copies / μL to obtain pAAV-EGFP plasmids with different copy numbers.

[0124] Using pAAV-EGFP plasmids with different copy numbers as templates, AAV titer-EGFP-F with a nucleotide sequence as shown in SEQ ID NO: 29 and AAV titer-EGFP-R with a nucleotide sequence as shown in SEQ ID NO: 30 were used to perform fluorescent quantitative PCR amplification according to the fluorescent quantitative PCR amplification system shown in Table 6 to obtain fluorescent quantitative PCR products of pAAV-EGFP plasmids with different copy numbers, and the Ct values ​​of the fluorescent quantitative PCR products of the pAAV-EGFP plasmids with different copy numbers were detected. A standard curve was drawn with the Ct values ​​of the fluorescent quantitative PCR products of the pAAV-EGFP plasmids with different copy numbers as the ordinate and the copy number as the abscissa, and the standard curve equation was calculated.

[0125] Table 6 Fluorescence quantitative PCR amplification system

[0126] Components volume template 1 μL AAV titer-EGFP-F (SEQ ID NO: 29, 10 μM) 1 μL AAV titer-EGFP-R (SEQ ID NO: 30, 10 μM) 1 μL 2×PerfectStart Green qPCR SuperMix 10 μL Nuclease-free Water 7μL Total volume 20 μL

[0127] Amplification program: 94°C, 30 s; 94°C, 5 s, 60°C, 30 s, 40 cycles; 95°C, 10 s; 65-95°C, heating rate of 0.5°C / 0.05 s, melting curve.

[0128] The rAAV-G997 nucleic acid sample was used as a template for the fluorescent quantitative PCR amplification system described in Table 6 to perform fluorescent quantitative PCR amplification to obtain the fluorescent quantitative PCR amplification product of the rAAV-G997 nucleic acid sample. The Ct value of the fluorescent quantitative PCR amplification product of the rAAV-G997 nucleic acid sample was detected, and the copy number (vg / mL) of the rAAV-G997 nucleic acid sample was calculated based on the standard curve.

[0129] 2. Construction of recombinant adeno-associated virus rAAV-L5055 packaging si-L5055 (siRNA-L)

[0130] The nucleotide sequences in step 1(1), such as si-G997-F shown in SEQ ID NO: 21 and si-G997-R shown in SEQ ID NO: 22, were replaced with si-L5055-F shown in SEQ ID NO: 31 and si-L5055-R shown in SEQ ID NO: 32, and pEU6-si-L5055 was prepared according to the method shown in step 1(1).

[0131] The nucleotide sequences of CMV-U6-G997-F as shown in SEQ ID NO: 25 and CMV-U6-G997-R as shown in SEQ ID NO: 26 in step 1(2) were replaced with the nucleotide sequences of CMV-U6-L5055-F as shown in SEQ ID NO: 33 and CMV-U6-L5055-R as shown in SEQ ID NO: 34, and pEU6-si-G997 was replaced with pEU6-si-L5055. According to the method shown in step 1(2), pAAV-si-L5055 was prepared.

[0132] The pAAV-si-G997 in step 1(3) was replaced with pAAV-si-L5055, and the recombinant adeno-associated virus rAAV-L5055 was prepared according to the method shown in step 1(3).

[0133] According to the method shown in step 1(4), the viral titer of recombinant adeno-associated virus rAAV-L5055 was obtained.

[0134] 3. Construction of recombinant adeno-associated virus rAAV-NC packaging si-NC (siNC)

[0135] The nucleotide sequences in step 1(1) such as si-G997-F shown in SEQ ID NO: 21 and si-G997-R shown in SEQ ID NO: 22 were replaced with si-NC-F shown in SEQ ID NO: 35 and si-NC-R shown in SEQ ID NO: 36, and pEU6-si-NC was prepared according to the method shown in step 1(1).

[0136] The nucleotide sequences CMV-U6-G997-F as shown in SEQ ID NO: 25 and CMV-U6-G997-R as shown in SEQ ID NO: 26 in step 1 (2) were replaced with the nucleotide sequences CMV-U6-NC-F as shown in SEQ ID NO: 37 and CMV-U6-NC-R as shown in SEQ ID NO: 38, and pEU6-si-G997 was replaced with pEU6-si-NC. According to the method shown in step 1 (2), pAAV-si-NC was prepared.

[0137] The pAAV-si-G997 in step 1(3) was replaced with pAAV-si-NC, and the recombinant adeno-associated virus rAAV-NC was prepared according to the method shown in step 1(3).

[0138] According to the method shown in step 1(4), the viral titer of recombinant adeno-associated virus rAAV-NC is obtained.

[0139] 2. Experimental Results

[0140] The identification results of the expression plasmid are shown in Figure 2. Figure 4 As shown, lanes 1 to 5 are the identification results of pEU-si-L5055, lanes 6 to 10 are the identification results of pEU6-si-G997, and lanes 11 to 15 are the identification results of pEU6-si-NC.

[0141] The results showed that the electrophoresis identification results of the expression plasmids pEU6-si-G997, pEU6-si-5055 and pEU6-si-NC all showed a 666bp electrophoresis band, which was the same size as the amplified fragments of U6 upstream identification primer (SEQ ID NO: 23) and U6 downstream identification primer (SEQ ID NO: 24), indicating that pEU6-si-G997, pEU6-si-5055 and pEU6-si-NC were successfully constructed.

[0142] The identification results of the packaging plasmid are shown in the figure Figure 5 As shown, lanes 1 to 8 are the identification results of pAAV-si-G997, lanes 9 to 16 are the identification results of pAAV-si-L5055, and lanes 17 to 24 are the identification results of pAAV-si-NC.

[0143] The results showed that the electrophoresis identification results of the packaging plasmids pAAV-si-G997, pAAV-si-L5055 and pAAV-si-NC all showed a 934 bp electrophoresis band, which was the same size as the amplified fragments of the CMV-U6-siRNA upstream identification primer (SEQ ID NO: 27) and CMV-U6-siRNA (SEQ ID NO: 28), indicating that pAAV-si-G997, pAAV-si-L5055 and pAAV-si-NC were successfully constructed.

[0144] The fluorescence curves of pAAV-EGFP with different copy numbers are shown in Figure 2. Figure 6 As shown; the standard curve is as shown Figure 7 shown.

[0145] The results showed that the standard curve was as shown in Formula I;

[0146] Formula I: y = -0.3223x + 11.338; x is the ct value, and the copy number is 10 y copies / μL.

[0147] The results showed that the copy number of recombinant adeno-associated virus rAAV-G997 was 4.9×10 11 vg / mL, and the copy number of recombinant adeno-associated virus rAAV-L5055 was 2.5×10 11 vg / mL, and the copy number of recombinant adeno-associated virus rAAV-NC was 4×10 10 vg / mL.

[0148] Example 4 Testing the Effect of Lentivirus on RABV Replication Ability

[0149] 1. Experimental Methods

[0150] rAAV-G997 recombinant adeno-associated virus infection group: NA cells were placed in a 12-well plate and cultured until the cell density in each well was 80% to 90%. After discarding the liquid in the well plate, serum-free RPMI-1640 medium was added at 500 μL / well, and then the rAAV-G997 prepared in Example 3 was added at MOI = 1000 (100 vg / cell). The cells were placed in a 37°C, 5% (v / v) CO2 incubator for adsorption for 2 hours, and then the complete medium was replaced. After further culture for 24 hours, the liquid was discarded, 500 μL of serum-free medium was added, and the CVS-11 strain was inoculated into the culture medium at MOI = 0.1. The cells were placed in a 37°C, 5% (v / v) CO2 incubator for adsorption for 1 hour, and then the complete medium was replaced and cultured to obtain NA cells in the rAAV-G997 recombinant adeno-associated virus infection group.

[0151] rAAV-L5055 recombinant adeno-associated virus infection group: rAAV-G997 in the rAAV-L5055 recombinant adeno-associated virus infection group was replaced with rAAV-L5055 prepared in Example 3, and the remaining treatments were exactly the same to obtain rAAV-L5055 recombinant adeno-associated virus infection group NA cells.

[0152] rAAV-NC recombinant adeno-associated virus infection group: rAAV-G997 in the rAAV-NC recombinant adeno-associated virus infection group was replaced with rAAV-NC prepared in Example 3, and the remaining treatments were exactly the same to obtain rAAV-NC recombinant adeno-associated virus infection group NA cells.

[0153] The cell supernatants in the culture medium of the rAAV-G997 recombinant adeno-associated virus infection group, the rAAV-L5055 recombinant adeno-associated virus infection group, and the rAAV-NC recombinant adeno-associated virus infection group were collected 24 h, 48 h, 72 h, and 96 h after inoculation with the CVS-11 strain, and the TCID values ​​were calculated according to the method shown in step 1 of Example 1. 50 The virus titer of the cell supernatant at different times after inoculation with the CVS-11 strain was detected by the "detection" method.

[0154] NA cells in the culture medium of the rAAV-G997 recombinant adeno-associated virus infection group, the rAAV-L5055 recombinant adeno-associated virus infection group, and the rAAV-NC recombinant adeno-associated virus infection group were collected at 24 h, 48 h, 72 h, and 96 h after inoculation with the CVS-11 strain. The transcription levels of each recombinant adeno-associated virus infection group were detected according to the "fluorescence quantitative PCR detection" method shown in step 1 of Example 1, including the transcription level of the G gene in the rAAV-G997 recombinant adeno-associated virus infection group, the transcription level of the L gene in the rAAV-L5055 recombinant adeno-associated virus infection group, and the transcription levels of the G gene and L gene in the rAAV-NC recombinant adeno-associated virus infection group.

[0155] 2. Experimental Results

[0156] The viral titer detection results of the cell supernatant at different times after inoculation of CVS-11 strain and the transcription level detection results of each recombinant adeno-associated virus infection group are shown in the figure below. Figure 8As shown; A is the G gene transcription level results of the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; B is the L gene transcription level results of the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group; C is the virus titer detection results of the cell supernatant at different times after the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group were inoculated with the CVS-11 strain; D is the virus titer detection results of the cell supernatant at different times after the rAAV-L5055 recombinant adeno-associated virus infection group and the rAAV-NC recombinant adeno-associated virus infection group were inoculated with the CVS-11 strain.

[0157] The results showed that: (1) the viral titers of NA cells in the rAAV-G997 recombinant adeno-associated virus infection group and the rAAV-L5055 recombinant adeno-associated virus infection group at each time point after inoculation with the CVS-11 strain were significantly lower than those in the rAAV-MC recombinant adeno-associated virus infection group;

[0158] (2) The transcription level (mRNA level) of the G gene of rabies CVS-11 in the NA cells of the rAAC-G997 recombinant adeno-associated virus infection group was significantly lower than that of the G gene of rabies CVS-11 in the NA cells of the rAAC-NC recombinant adeno-associated virus infection group; the transcription level (mRNA level) of the L gene of rabies CVS-11 in the NA cells of the rAAC-L5055 recombinant adeno-associated virus infection group was significantly lower than that of the L gene of rabies CVS-11 in the NA cells of the rAAC-NC recombinant adeno-associated virus infection group.

[0159] This indicates that both recombinant adeno-associated virus rAAV-G997 and recombinant adeno-associated virus rAAV-L5055 can significantly inhibit the replication of rabies virus and reduce the virus titer;

[0160] The NA cells in the rAAV-G997 recombinant adeno-associated virus infection group were not infected by rabies virus or the replication of rabies virus in the cells was significantly inhibited; the NA cells in the rAAV-G997 recombinant adeno-associated virus infection group were not infected by rabies virus or the replication of rabies virus in the cells was significantly inhibited.

[0161] Example 5 Protection test of recombinant adeno-associated virus against RABV infection in mice

[0162] 1. Experimental Methods

[0163] Thirty SPF Kunming mice weighing 20 g were randomly divided into rAAV-G997 group, rAAV-L5055 group and rAAV-NC group at a rate of 10 mice per group; a control group consisting of 10 SPF Kunming mice weighing 20 g was also set up.

[0164] rAAV-G997 group: The recombinant adeno-associated virus rAAV-G997 prepared in Example 3 was injected at 2×10 11 vg / kg was injected into SPF Kunming mice via intracranial injection. 48 hours after the injection, the SPF Kunming mice were challenged with rabies virus CVS-11 strain at an MOI of 0.1 via intramuscular injection.

[0165] rAAV-L5055 group: The recombinant adeno-associated virus rAAV-G997 in the rAAV-G997 group was replaced with rAAV-L5055 prepared in Example 3, and the remaining treatments were the same.

[0166] rAAV-NC group: The recombinant adeno-associated virus rAAV-G997 in the rAAV-G997 group was replaced with the rAAV-NC prepared in Example 3, and the rest of the treatments were the same.

[0167] Control group: SPF Kunming mice were challenged with rabies virus CVS-11 strain at MOI=0.1 by intramuscular injection.

[0168] After the SPF-grade Kunming mice in each group were challenged with the virus, the average weight and number of deaths of mice in each group were recorded every day for 21 days, and the weight change rate and survival rate of mice in each group were calculated.

[0169] 2. Experimental Results

[0170] The weight change rate of mice in each group 21 days after infection is shown in the figure Figure 9 As shown, the results showed that the onset time of SPF Kunming mice in the rAAV-G997 group was 9 days after the virus challenge, the onset time of SPF Kunming mice in the rAAV-L5055 group was 9 days after the virus challenge, and the onset time of SPF Kunming mice in the rAAV-NC group was 8 days after the virus challenge;

[0171] The weight of the SPF-grade Kunming mice in the rAAV-G997 group and the rAAV-L5055 group increased steadily over time without drastic fluctuations; while the weight of the SPF-grade Kunming mice in the rAAV-NC group and the control group fluctuated significantly within 21 days, and the weight of the mice was significantly lower than that of the SPF-grade Kunming mice in the rAAV-G997 group and the rAAV-L5055 group.

[0172] The results show that after mice were challenged with recombinant adeno-associated virus rAAV-G997 packaged with si-G997 (siRNA-G) and recombinant adeno-associated virus rAAV-L5055 packaged with si-L5055 (siRNA-L), their weight increased steadily without drastic fluctuations after being infected with rabies virus CVS-11 strain.

[0173] The survival rate changes of mice in each group 21 days after infection are shown in the figure below. Figure 10 As shown, the results showed that 21 days after the infection, the survival rate of mice in the rAAV-G997 group was 90%, the survival rate of mice in the rAAV-L5055 group was 90%, the survival rate of mice in the rAAV-NC group was 50%, and the survival rate of mice in the control group was 60%.

[0174] The results showed that the recombinant adeno-associated virus rAAV-G997 packaged with si-G997 (siRNA-G) and the recombinant adeno-associated virus rAAV-L5055 packaged with si-L5055 (siRNA-L) could protect mice from the rabies virus CVS-11 strain.

[0175] Finally, it should be noted that the above embodiments are intended only to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art will readily appreciate that other variations or modifications may be made based on the above descriptions and concepts. It is not necessary and impossible to provide an exhaustive list of all possible implementations. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the claims of the present invention.

Claims

1. Application of siRNA targeting the rabies virus L gene in the preparation of drugs for inhibiting rabies.

2. The use according to claim 1, characterized in that The rabies is caused by the rabies virus CVS-11 strain.

3. A siRNA-L targeting and inhibiting the rabies virus L gene, characterized in that: The nucleotide sequence of the sense strand of the siRNA-L is shown in SEQ ID NO: 3, and the nucleotide sequence of the antisense strand of the siRNA-L is shown in SEQ ID NO:

4.

4. Use of the siRNA-L according to claim 3 in the preparation of a drug for inhibiting rabies.

5. The use according to claim 4, characterized in that The rabies virus is the rabies CVS-11 strain.

6. The use according to claim 4, characterized in that The inhibition of rabies is to inhibit the expression of L gene.

7. A pharmaceutical composition for inhibiting rabies, characterized in that: Contains the siRNA-L shown in claim 3.

8. The pharmaceutical composition according to claim 7, characterized in that Pharmaceutically acceptable excipients are also included.

9. The pharmaceutical composition according to claim 8, characterized in that The pharmaceutical composition is administered by intracranial administration, intramuscular injection and / or intravenous injection.

Images