BR-responsive tea tree COR413 gene promoter and application thereof
By isolating and verifying the promoter of the COR413 gene in tea trees and using the BR transcription factor CsBZR2-1 to regulate the expression of the COR413 gene, the problem of insufficient cold resistance in tea trees was solved, the cold resistance of tea trees was improved, and the quality and yield of tea trees were promoted.
Patent Information
- Application Number
- CN202510859352.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-25
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies make it difficult to efficiently regulate the expression of the COR413 gene in tea trees, which affects the cold resistance of tea trees and leads to a decline in tea yield and quality.
The promoter sequence of the tea tree COR413 gene was isolated and verified, and efficient expression of the COR413 gene was achieved in tea trees and Arabidopsis thaliana through recombinant vectors. The expression of the COR413 gene was regulated by the BR transcription factor CsBZR2-1 and the promoter binding site, and the cold resistance of the plant was reduced through virus-induced gene silencing technology.
It achieved efficient expression of the COR413 gene in tea trees, improved the cold resistance of tea trees, ensured the yield and quality of tea, and provided an important tool for basic research and production practice in tea tree germplasm innovation.
Smart Images

Figure BDA0005466975020000031 
Figure BDA0005466975020000041 
Figure BDA0005466975020000042
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a tea tree COR413 gene promoter and its cold application. Background Art
[0002] A promoter is a key DNA sequence located upstream of a gene that is recognized and bound by RNA polymerase to initiate transcription. It is a core element in gene expression regulation. In eukaryotes, promoters consist of two main regions: the core promoter region and the upstream sequence region. The core promoter region contains the transcription start site and cis-acting elements such as the TATA-box; the upstream sequence region contains various regulatory expression elements that play a key role in the efficiency, specificity, and activity of gene transcription, ensuring its effectiveness and accuracy.
[0003] Tea (Camellia sinensis) is an important specialty cash crop in my country. During its growth, it is susceptible to low-temperature stress, which leads to reduced tea yield and quality. Low-temperature stress is a crucial environmental factor that significantly impacts plant growth, productivity, and survival. Prolonged exposure to freezing temperatures below 0°C can damage cell membranes and cause cell death. To cope with low-temperature stress, plants have evolved complex cold-resistance mechanisms, of which the inducible expression of cold-regulated proteins (CORs) is a core strategy. The COR gene family is activated during cold acclimation, and the proteins they encode enhance plant cold resistance through various mechanisms, including stabilizing cell membranes, regulating osmotic pressure, and inhibiting ice crystal formation. BZR2-1, a member of the brassinosteroid (BR) gene family, is a key transcription factor in the BR signaling pathway, regulating the expression of downstream genes and playing a crucial role in plant resistance to low-temperature stress. Therefore, studying the regulatory pattern of the COR413 gene promoter will help to more efficiently utilize the COR413 protein to improve the cold resistance of tea trees. Elucidating the cold resistance mechanism of tea trees is of great significance to the basic research and production practice of tea tree germplasm innovation. Summary of the Invention
[0004] The present invention aims to provide a BR-responsive tea plant COR413 gene promoter, which can efficiently initiate the expression of the COR413 gene.
[0005] To achieve the above object, the present invention also relates to a recombinant expression vector, which is obtained by recombining the promoter of the present invention with the pCAMBIA1391z Vector plasmid.
[0006] The present invention also relates to a recombinant cell, which contains the above promoter or recombinant vector.
[0007] Preferably, the recombinant cell is a recombinant Escherichia coli cell or a recombinant GV3101 Agrobacterium cell.
[0008] The nucleotide sequence of the tea plant BR transcription factor CsBZR2-1 is shown in SEQ ID No.2.
[0009] Furthermore, the present invention also relates to a method for directly verifying the binding of the BR key transcription factor CsBZR2-1 to the COR413 gene promoter.
[0010] The present invention also relates to the tea plant cold-regulated CsCOR413 gene.
[0011] A recombinant vector comprises the nucleotide sequence of the CsCOR413 gene.
[0012] A genetically engineered host cell contains the above recombinant vector.
[0013] The virus-induced gene silencing technology (VIGS) was further used to silence the specific sequence fragment of the tea tree gene CsCOR413, and it was transiently transformed into the tea tree through Agrobacterium-mediated transformation, reducing the plant's cold resistance.
[0014] Furthermore, the relative expression level of the CsCOR413 gene in the transgenic plant is reduced, the electrical conductivity is increased, and the cold resistance is reduced.
[0015] Application of the tea plant COR413 gene promoter in efficiently initiating the expression of the tea plant COR413 gene.
[0016] In the application, the tea tree BR transcription factor CsBZR2-1 regulates the expression of the cold-regulated gene CsCOR413 by binding to the regulatory sites AAAACGT and TACTAGTGTA in the tea tree CsCOR413 promoter.
[0017] To achieve the above object, the present invention provides the following solutions:
[0018] 1) Using tea plant DNA as a template, two specific primer pairs were used for amplification to clone the COR413 promoter, the nucleic acid sequence of which is shown in SEQ ID No. 1;
[0019] 2) Insert it into the pCAMBIA1391z::GUS Vector plasmid, with the GUS gene connected downstream.
[0020] 3) It was genetically transformed into Arabidopsis thaliana through the floral infection method.
[0021] 4) Perform GUS staining on the transgenic plants obtained in step (3).
[0022] 5) Jaspar was used to predict key binding sites for the CsCOR413 promoter and the key BR transcription factor CsBZR2-1. Electrophoretic mobility shift assays (EMSA) were performed to validate the interaction between CsBZR2-1 and CsCOR413 and identify regulatory motifs.
[0023] 6) Using tea plant cDNA as a template, two specific primer pairs were used for amplification to clone the tea plant COR413 gene, the nucleic acid sequence of which is as follows Figure 7 shown.
[0024] 7) Using virus-induced gene silencing (VIGS) technology, a specific sequence fragment of the tea tree gene CsCOR413 was silenced and transiently transformed into tea plants through Agrobacterium-mediated transformation, reducing the plant's cold resistance.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] (1) The present invention provides a promoter derived from the COR413 gene of tea plant, which plays an important regulatory role in the expression of the COR413 gene. The promoter contains a motif that binds to the key BR transcription factor CsBZR2-1;
[0027] (2) The present invention is the first to isolate the upstream promoter sequence of the COR413 gene of tea plants. This promoter sequence can drive the expression of the GUS gene in Arabidopsis thaliana. It is an exogenous promoter with high expression efficiency and can be used in genetic transformation and transgenic plant cultivation.
[0028] (3) The promoter sequence provided by the present invention is located upstream of the COR413 gene of tea plant, which is of great significance for the basic research and production practice of using this gene for tea plant germplasm innovation in the future. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 This is the CsCOR413 gene promoter clone, where M: DL2000 marker; 1, 2: promoter CsCOR413 band, 1972 bp.
[0030] Figure 2 Schematic diagram of the construction of the expression vector pCAMBIA1391Z-CsCOR413p::GUS.
[0031] Figure 3 GUS histochemical staining of transgenic Arabidopsis thaliana.
[0032] Figure 4 This is the electrophoresis diagram of PCR amplification of CsBZR2-1 gene, where M: DL2000 marker; 1, 2: promoter CsCOR413 band, 528bp.
[0033] Figure 5 EMSA shows the binding of CsBZR2-1-GST to the CsCOR413 promoter motif.
[0034] Figure 6 This is the electrophoresis diagram of PCR amplification of the cold-regulated gene CsCOR413 in tea plants. M: DL2000 marker; 1, 2: promoter CsCOR413 band, 618 bp.
[0035] Figure 7 Schematic diagram of the plant VIGS vector TRV-CsCOR413.
[0036] Figure 8 is the expression level of CsCOR413 gene in TRV-CsCOR413 tea leaves.
[0037] Figure 9 This is the phenotype of tea plants under cold treatment after TRV-CsCOR413 silencing.
[0038] Figure 10 is the relative electrical conductivity of silent tea plants. DETAILED DESCRIPTION
[0039] The specific implementation methods of the present invention are described in detail below. The described embodiments are only some embodiments of the present invention. However, it should be understood that the protection scope of the present invention is not limited by the specific implementation methods and is not used as a basis for limiting the present invention.
[0040] The biological materials used in the embodiments of the present invention are all commercially available and are stored in the applicant's laboratory and can be publicly distributed.
[0041] Example 1: Cloning of the Camellia sinensis COR413 promoter
[0042] According to the 2000 bp reference sequence upstream of the CsCOR413 promoter in the tea plant genome database, the CsCOR413 promoter was amplified using the "Qiancha No. 1" DNA as a template. The PCR system is shown in Table 1.
[0043] Table 1 PCR amplification system
[0044]
[0045]
[0046] Among them, the forward primer is TATGACCATGATTACGAATTCCATGTGCAGATAGTTCTATGAC, and the reverse primer is CGACGGCCAGTGCCAAGCTTCTGCATTGTCAGACAGATTAAAAGC.
[0047] The PCR products were analyzed by agarose gel electrophoresis. Figure 1 As shown in the figure, the electrophoresis results showed that a clear and single target band was amplified. The target band was purified using the Omega gel recovery kit and connected to PMD according to the connection system in Table 2. The ligated product was connected to the 18-T Vector vector, and the ligation product was transformed into Escherichia coli DH5α strain. The plasmid of the positive colony screened by Amp was extracted by alkaline lysis method. After verification by PCR experiment, it was sent to BGI for sequencing. After sequencing and splicing, the full-length gene sequence of 1972bp was obtained (see SEQ ID NO: 1).
[0048] Example 2: Construction of pCAMBIA1391Z-CsCOR413p::GUS recombinant vector
[0049] By analyzing the restriction sites of the vector, two restriction sites, Hind III and EcoR I, were selected. Cloning primers with homology arms identical to the empty vector pCAMBIA1391Z::GUS sequence containing the GUS reporter gene were designed. Using the plasmid of the pEG-T-CsBZR2-1 promoter as a template, the target fragment of the CsBZR2-1 promoter was amplified using PCR technology. According to the restriction sites, the empty vector pCAMBIA1391Z::GUS plasmid was double-digested. After the enzyme digestion was completed, it was purified. The target gene fragment product was connected and transformed with the linearized vector pCAMBIA1391Z. For the specific connection method, refer to the instructions of the HieffClone Plus oneStep Cloning Kit. The connection reaction system is as follows:
[0050] Table 2 Connection system
[0051]
[0052] After gently mixing the above system, connect at 50℃ for 10 minutes. Figure 2 The ligated product was transformed into Escherichia coli according to the following method.
[0053] Remove the prepared 50 μL E. coli DH5α competent cells from the -80°C refrigerator and thaw on ice; add 10 μL of the ligation product to the 50 μL E. coli DH5α competent cell suspension, mix gently, and place on ice for 30 minutes; incubate in a 42°C constant temperature water bath for 60 seconds, then quickly place in an ice bath for 2 minutes; add 400-450 μL SOC liquid culture medium to a centrifuge tube, activate it at 37°C for 10 minutes, and then culture it on a shaker at 37°C and 180 rpm for 45 minutes; add 14 μL IPTG and 80 μL X-Gal to the bacterial solution in a clean workbench, and spread 200 μL of the bacterial solution on LB solid culture medium containing 100 mg / L Amp; culture it upside down in a 37°C constant temperature incubator for 12-16 hours. Recombinant Escherichia coli containing the pCAMBIA1391Z-CsCOR413p::GUS cloning vector was obtained and named DH5αCOR413p. Shenzhen BGI Genomics Co., Ltd. sequenced the pCAMBIA1391Z-CsCOR413p::GUS cloning vector, as shown in SEQ ID NO: 1. The results demonstrated that the promoter sequence in the pCAMBIA1391Z-CsCOR413p::GUS cloning vector was correct. This recombinant expression vector was transformed into Agrobacterium using the following transformation method.
[0054] Remove competent Agrobacterium cells from a -80°C freezer, thaw on ice, and then add 2 μg of the recombinant plasmid pCAMBIA1391Z-CsCOR413p::GUS to each well. Gently flick to mix, and place on ice for 30 minutes. Quickly freeze with liquid nitrogen for 5 minutes, then quickly in a 37°C water bath for 5 minutes. Add 1 mL of YEP medium and incubate at 28°C at 200 rpm / min for 3-4 hours. Centrifuge the culture at 5000 rpm at 4°C for 1 minute, discard the supernatant, and retain the cells. Resuspend the cells in 200 μL of YEP liquid medium. Spread the suspension onto a YEP dish containing 100 mg / L Kan and 100 mg / L Rif, and incubate inverted at 28°C for 2-3 days. After Agrobacterium colonies grow on the culture dish, single colonies are picked into 15 mL centrifuge tubes containing 3 mL of YEP liquid medium (containing 100 mg / L Kan and 100 mg / L Rif) and shaken overnight in a shaker at 180 rpm / min and 28°C; Agrobacterium GV3101 competent cells are cultured and verified by colony PCR. The recombinant Agrobacterium GV3101-CsCOR413p cells are those with a band of approximately 1972 bp.
[0055] Example 3: Genetic transformation of Arabidopsis thaliana by inflorescence dipping method
[0056] Arabidopsis thaliana seeds (Col-0) were washed three times with sterile water, sterilized in 75% alcohol for 30 seconds, and then washed three times with sterile water. Next, they were sterilized with 8% sodium hypochlorite for 10 minutes. After sterilization, the sodium hypochlorite was aspirated and rinsed again with sterile water three to five times. The sterilized Arabidopsis seeds were evenly plated on 1 / 2 MS solid culture medium. After sealing, the plates were placed in a vernalization environment at 4°C for three days. After vernalization, the plates were placed in a sterile plant culture chamber for incubation. Culture conditions included 16 hours of light and 8 hours of darkness, a light intensity of 6000-8000 lux, and a temperature of 22°C. When seedlings reached the four-leaf stage, they were transplanted into nutrient soil using a 3:1 mixture of vermiculite and soil until the Arabidopsis thaliana flower buds formed, preparing for subsequent transformation experiments. Wild-type Col-0 plants with good growth were selected and the main stem was cut off at the first bolting and flowering to increase the number of branches. When there were more side branches and green buds, the inflorescence was infected using the Agrobacterium-mediated method.
[0057] After sterilizing T0 seeds, they were evenly spread using a blue pipette tip onto 1 / 2 MS screening medium containing hygromycin (30 mg / mL). The seeds were incubated in a refrigerator at 4°C for 3 days before being removed and cultured under normal conditions. The growth of Arabidopsis seedlings on the hygromycin-containing medium was observed. During the cotyledon stage, non-transgenic seedlings gradually began to yellow, while transgenic plants continued to grow normally. When the seedlings had 4-6 true leaves, resistant seedlings were transplanted into a mixed medium. These were designated T1 plants. After positive results were obtained from GUS staining and PCR, T1 seeds were harvested and the above screening steps were repeated, allowing for the harvest of T2 seeds. The survival rate of the T2 seeds screened for resistance was calculated, and lines with a survival rate greater than 95% were selected for transplantation. After transplanting, the plants were identified as positive, and T3 seeds were harvested. Harvested seeds were screened again for resistance. If the survival rate was still greater than 95%, the line was considered homozygous and used in subsequent experiments.
[0058] Example 4: Verification of GUS gene expression in transgenic Arabidopsis thaliana
[0059] The Arabidopsis transformed with PCAMBIA1391Z-CsCOR413p::GUS was stained. The transformed Arabidopsis was placed in an appropriate amount of GUS staining solution at 37°C overnight. The tissue was then immersed in 75% alcohol until the green color of the tissue faded. The results were photographed using a stereoscope. Figure 3As shown in Figure 2, GV3101-mediated transformation of Arabidopsis thaliana containing the recombinant vector pCAMBIA1391Z-CsCOR413p::GUS resulted in blue staining, while wild-type Arabidopsis thaliana tissue did not. The results demonstrate that the promoter of this invention can drive GUS gene expression in Arabidopsis roots, stems, and leaves, with no significant difference in staining intensity, suggesting that the CsCOR413 promoter may not be tissue-specific in Arabidopsis thaliana.
[0060] Example 5: EMSA verification of the binding site between the BR transcription factor CsBZR2-1 and the CsCOR413 promoter
[0061] According to the reference sequence of CsBZR2-1 gene in the tea transcriptome database, the CsBZR2-1 gene was amplified using the cDNA of “Qiancha No. 1” as a template. The PCR system is shown in Table 3.
[0062] Table 3 PCR amplification system
[0063]
[0064] Among them, the forward primer is ATGGCAGAAGAGAAGAAGAGGAGTGCCATG, and the reverse primer is CTAAAAATGTGATAATGACATCG.
[0065] The PCR products were analyzed by agarose gel electrophoresis. Figure 4 As shown in the figure, the electrophoresis results showed that a clear and single target band was amplified. The target band was purified using the Omega gel recovery kit and connected to PMD according to the connection system in Table 2. The ligated product was connected to the 18-T Vector vector, and the Escherichia coli DH5α strain was transformed. The plasmid of the positive colony screened by Amp was extracted by alkaline lysis method. After verification by PCR experiment, it was sent to BGI for sequencing. After sequencing and splicing, the full-length gene sequence of 528bp was obtained (see SEQ ID NO: 2).
[0066] Electrophoretic mobility shift assay (EMSA): The CsBZR2-1 gene was codon-optimized according to the codon preference of the Escherichia coli expression host. After artificial synthesis, it was constructed in the vector PGEX-4T-GST, and then transformed into Escherichia coli for induced expression and protein purification was performed. Six possible binding sites were predicted using the prediction website (https: / / jaspar.elixir.no / ), and double-stranded primers (primers 1-12) containing transcription factor binding sites were designed. The probes were formed by annealing, and the probes were labeled with biotin or radioactive isotopes. The purified protein was mixed with the labeled probes and incubated at room temperature for a period of time to form a protein-probe complex. Polyacrylamide gel electrophoresis was performed under non-denaturing conditions to separate the protein-probe complex and the unbound probes. The gel after electrophoresis was transferred to a PVDF membrane and detected using streptavidin-peroxidase (HRP) and chemiluminescent substrates. The results showed (see Figure 5 )CsBZR2-1 binds to the CsCOR413 promoter through its specific binding sites AAAACGT and TACTAGTGTA motifs.
[0067] Primer 1: CCATTTTAAGGACAAAAACGTCAATTTGAT
[0068] Primer 2: ATCAAATTGACGTTTTTGTCCTTAAAATGG
[0069] Primer 3: GTGTTTAGATAATGATCATGTAATGGGT
[0070] Primer 4: ACCCATTACATGATCATTATCTAAACAC
[0071] Primer 5: AATTGAAAAGTCAGAAACTAAACTGACACA
[0072] Primer 6: TGTGTCAGTTTAGTTTCTGACTTTTCAATT
[0073] Primer 7: TAGGGACTACTAGTGTAATTCGCCCATAAAAC
[0074] Primer 8: GTTTTATGGGCGAATTACACTAGTAGTCCCTA
[0075] Primer 9: AACTATTTACGCACTCATGGAGAAGTTCATG
[0076] Primer 10: CATGAACTTCTCCATGAGTGCGTAAATAGTT
[0077] Primer 11: TTCTATGACTGCTTCGTGAGAAGTATACC
[0078] Primer 12: GGTATACTTCTCACGAAGCAGTCATAGAA
[0079] Example 6: Cloning of the Tea Plant Cold-Regulating Gene CsCOR413
[0080] According to the reference sequence of CsCOR413 in the tea plant transcriptome database, the CsCOR413 gene was amplified using the cDNA of "Qiancha No. 1" as a template. The PCR system is shown in Table 4.
[0081] Table 4 PCR amplification system
[0082]
[0083]
[0084] Among them, forward primer: ATGGTTAAGAACAATTATTT
[0085] Anti-primer: CTATAGAAAGTCATTAAACAAAG
[0086] The PCR products were analyzed by agarose gel electrophoresis. Figure 6 As shown in the figure, the electrophoresis results showed that a clear and single target band was amplified. The target band was purified using the Omega gel recovery kit and connected to PMD according to the connection system in Table 2. The ligated product was connected to the 18-T Vector vector, and the Escherichia coli DH5α strain was transformed. The plasmid of the positive colony screened by Amp was extracted by alkaline lysis method. After verification by PCR experiment, it was sent to BGI for sequencing. After sequencing and splicing, the full-length gene sequence of 618bp was obtained (see SEQ ID NO: 3).
[0087] Example 7: Construction of pTRV2-CsCOR413 recombinant vector and VIGS silencing of tea leaves
[0088] The VIGS experiment of tea plant was carried out using tobacco rattle virus (TRV) vector. The 75bp to 444bp fragment of CsCOR413 gene, totaling 370bp, was selected to construct VIGS vector. Figure 7), the transformation of Escherichia coli and GV3101 was carried out according to the method of Example 2. Tea branches grown to 10 cm in length were selected, the terminal buds were removed, 1-2 intact leaves were left, and they were immersed in a heavy suspension containing the empty vector TRV-EV and the experimental group pTRV2-CsCOR413 for 20 minutes, and vacuumed for 4 minutes at 0.7 KPa, and repeated once. The infected branches were hydroponically cultured in Hogland's nutrient solution, cultured in the dark in an artificial climate chamber at 24°C for 4 days, and then taken out and cultured in an artificial climate chamber at 24°C and 16h / 8h of light. Among them, TRV-EV infected with an empty vector was a negative control. According to the operating manual of the Huayueyang Polysaccharide and Polyphenol Plant RNA Extraction Kit, wild-type, TRV-EV and silenced tea leaf RNA were extracted and reversed into cDNA. The relative quantitative analysis of the gene was performed using qRT-PCR technology. After exporting the data, the relative expression of the CsCOR413 gene was statistically analyzed using the ΔΔCT method.
[0089] Real-time PCR analysis used the CsGAPDH gene as a control. The reaction procedure was as follows: PCR reaction system: 5.0 μL SYBR Premix ExTaq enzyme, 0.2 μL upstream and downstream primers, 1.0 μL cDNA, 3.6 μL ddH2O, for a final system of 10.0 μL. The reaction procedure was 95°C pre-denaturation for 3 min; 95°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 30 sec, for 40 cycles. CsGAPDH forward primer: CACGGTCAATGGAAGCATCAT,
[0090] Reverse primer: GCAGCAGCCTTATCCTTATCAG;
[0091] CsCOR413 forward primer: CATGTGCAGATAGTTCTATG
[0092] Reverse primer: GTCGTCTTCATTGCCAAATA.
[0093] Fluorescence quantitative results showed that (see Figure 8 ), compared with the control group, the expression of CsCOR413 gene in the TRV:CsCOR413 treatment group was significantly decreased.
[0094] Example 8: Observation of cold-resistance phenotype of VIGS-silenced tea leaves
[0095] The leaves of WT, TRV:EV and TRV:CsCOR413 tea plants were subjected to a 4°C cold treatment. The results showed that the leaves of WT and TRV:EV plants exhibited a freezing phenotype but survived after returning to normal temperature conditions. In contrast, the leaves of TRV:CsCOR413 plants showed severe browning and increased sensitivity to chilling damage, indicating that the cold resistance ability was weakened after silencing the CsCOR413 gene (see Figure 9 ).
[0096] Example 9: Determination of relative conductivity of tea trees after freezing damage
[0097] About 0.1g of tea leaves from the treatment group and the control group, with the central vein removed, were placed in a clean test tube containing 10mL of deionized water. The samples were vacuum treated for 30 minutes using a vacuum pump, then shaken at room temperature for 1 hour. The conductivity was measured using a conductivity meter and labeled S1. Next, all samples were placed in boiling water and boiled for 20 minutes. After cooling to room temperature, the conductivity value was measured as S2. The relative conductivity was calculated as (S1 / S2) × 100%. The results showed (see Figure 10 ), after cold treatment, the relative conductivity of CsCOR413-silenced plants increased significantly compared with the control plants, indicating that the membrane permeability was enhanced and the cold resistance was weakened.
[0098] The above is a further detailed description of the present invention in conjunction with specific embodiments, and the specific implementation of the present invention cannot be considered to be limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention.
Claims
1. The tea plant COR413 gene promoter, the nucleotide sequence of which is shown in SEQ ID No.
1.
2. A recombinant expression vector comprising the promoter according to claim 1.
3. The recombinant expression vector according to claim 2 is obtained by recombination of the promoter according to claim 1 and the original vector pCAMBIA1391z Vector.
4. The method for cloning the tea plant COR413 gene promoter according to claim 1, characterized in that: The promoter cloning method comprises: using young leaves of tea plants as materials, extracting DNA by using the CTAB method, and designing specific primer pairs to amplify the tea plant COR413 gene promoter.
5. The cloning method according to claim 4, wherein the nucleotide sequence of the specific primer pair is as follows: The upstream primer CsCOR413p-F is TATGACCATGATTACGAATTCCATGTGCAGATAGTTCTATGAC, and the downstream primer CsCOR413p-R is ACGACGGCCAGTGCCAAGCTTCTGCATTGTCAGACAGATTAAAAGC.
6. The COR413 gene of tea plant, whose nucleotide sequence is shown in SEQ ID No.
3.
7. A recombinant expression vector comprising the tea plant COR413 gene according to claim 6.
8. Tea plant BR transcription factor CsBZR2-1, whose nucleotide sequence is shown in SEQ ID No.
2.
9. Use of the tea plant COR413 gene promoter according to claim 1 in efficiently initiating the expression of the tea plant COR413 gene.
10. The use according to claim 9, wherein the tea plant BR transcription factor CsBZR2-1 according to claim 8 regulates the expression of the cold-regulated gene CsCOR413 by binding to the regulatory sites AAAACGT and TACTAGTGTA in the tea plant CsCOR413 promoter.