Composition and application thereof in DNA (deoxyribonucleic acid) conversion by hydrosulfite

By using a combination of bisulfite and oyster glycogen, combined with surfactants and nucleic acid protectants, the conversion and recovery processes were optimized, solving the problem of low DNA recovery efficiency and achieving efficient DNA recovery and methylation detection.

CN120683229APending Publication Date: 2025-09-23NANJING VAZYME BIOTECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410286111.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-13
Publication Date
2025-09-23

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention provides a composition and application of the composition in conversion of DNA (deoxyribonucleic acid) from hydrosulfite, and belongs to the technical field of biology. The oyster glycogen is added into the conversion liquid, so that the loss of DNA in the hydrosulphite conversion and recovery process can be effectively reduced, the recovery efficiency of DNA is improved, and hydrosulphite conversion and methylation detection of low-input DNA are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a composition and its application in bisulfite conversion of DNA. Background Art

[0002] 5-Methylcytosine (5mC) in DNA is a fundamental epigenetic marker that plays a crucial role in gene transcription regulation, cell differentiation, embryonic development, X chromosome inactivation, gene imprinting, and tumorigenesis. DNA methylation is a dynamic marker that can record the influence of environmental factors like tree rings, making it one of the most promising epigenetic markers. It is currently used as a biomarker for early cancer screening and prognosis.

[0003] U.S. Patent No. 9868756B2 protects a method for converting cytosine bases in nucleic acids to uracil bases, wherein the nucleic acids are incubated in the presence of sulfite ions, thereby deaminated. The deaminated nucleic acids are bound to a solid phase, and the deaminated solid-phase-bound nucleic acids are incubated under alkaline conditions, thereby desulfonating the deaminated nucleic acids, thereby converting the cytosine bases in the nucleic acids to uracil bases, and eluting the washed deaminated and desulfonated nucleic acids from the solid phase. The DNA after bisulfite conversion needs to be purified and eluted from the solid phase to obtain a pure sample, but current technology has limited efficiency in recovering nucleic acids from the solid phase. At the same time, in the application of bisulfite conversion technology, the sample input amount is generally low. The long reaction time in conventional bisulfite treatment causes most DNA to degrade during the conversion process, and the adsorption of consumables during the recovery process, the limited recovery efficiency of the column, etc., result in inevitable DNA loss. Summary of the Invention

[0004] Based on the existing technical methods, this application studies the reagents in the bisulfite conversion process after a large number of experimental explorations, and greatly improves the DNA recovery efficiency of the conversion kit while ensuring the efficiency of cytosine base conversion.

[0005] The present application aims to provide a composition and a bisulfite conversion method, which can reduce DNA loss during bisulfite conversion and recovery, improve DNA recovery efficiency, and is suitable for low-input DNA bisulfite conversion and methylation detection.

[0006] A first aspect of the present application provides a composition comprising bisulfite and oyster glycogen, wherein the pH of the composition is 4-7.

[0007] In some embodiments, the bisulfite is one or more, one, two, three, or four of sodium bisulfite, ammonium bisulfite, potassium bisulfite, and magnesium bisulfite.

[0008] In some embodiments, the bisulfite is 1-8 M ammonium bisulfite, including 1 M, 1.5 M, 2 M, 2.5 M, 3 M, 3.5 M, 4 M, 4.5 M, 5 M, 5.5 M, 6 M, 6.5 M, 7 M, 7.5 M, and 8 M within the range.

[0009] In some embodiments, the concentration of the oyster glycogen is 0.01-10 mg / ml, preferably 0.01-5 mg / ml, including 0.01 mg / ml, 0.02 mg / ml, 0.03 mg / ml, 0.04 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1 mg / ml, 1.5 mg / ml, 2 mg / ml, 2.5 mg / ml, 3 mg / ml, 4 mg / ml and 5 mg / ml within the range.

[0010] In some embodiments, the composition further comprises a pH adjuster, which comprises, for example, one or more of an acid, a base, a weak acid salt, and a weak base salt, wherein the acid comprises, for example, citric acid or acetic acid, the base is, for example, NaOH, the weak acid salt comprises, for example, acetate, carbonate, or phosphate, and the weak base salt is, for example, an ammonium salt.

[0011] In some embodiments, the pH adjuster is NaOH.

[0012] In some embodiments, the pH of the composition is 4-7, including 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7 within the range.

[0013] In some embodiments, the composition further comprises a surfactant, such as a cationic surfactant, an anionic surfactant, or a nonionic surfactant. Preferably, the composition further comprises a nonionic surfactant, including but not limited to all nonionic surfactants known in the art, such as one or more of Tween, polyethylene glycol, and NP40. Preferably, the nonionic surfactant is Tween 20.

[0014] In some embodiments, the volume fraction of Tween 20 is 0.01%-10%, preferably 0.01%-5%, including 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5% and 5% within the range.

[0015] In some embodiments, the composition further comprises a nucleic acid protectant, including but not limited to all nucleic acid protectants known in the art that can protect nucleic acid activity and reduce the loss of DNA during bisulfite conversion, such as one or more of glycerol, dithiothreitol, BSA, hydroquinone, trehalose, water-soluble vitamin E, gallic acid, ascorbic acid, sodium ascorbate, lysine, polyvinyl alcohol and sorbitol.

[0016] In some embodiments, the concentration of each component in the composition is present in the form of 2-50 times the aforementioned concentration, for example, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 12 times, 15 times, 18 times, 20 times, 30 times, 40 times and 50 times.

[0017] A second aspect of the present application provides a bisulfite conversion method, the method comprising:

[0018] The composition of the first aspect is added to a DNA sample to carry out a conversion reaction to obtain a converted DNA sample; the converted DNA sample is adsorbed using a solid phase carrier; and the converted DNA sample is subjected to a desulfonation treatment and an elution treatment to obtain a DNA product.

[0019] In some embodiments, the DNA sample is from one or more of an animal, a plant, or a microorganism.

[0020] In some embodiments, the mass of the DNA is at least 10pg, 20pg, 30pg, 40pg, 50pg, 60pg, 70pg, 80pg, 90pg, 100pg, 200pg, 300pg, 400pg, 500pg, 600pg, 700pg, 800pg, 900pg, 1ng, 10ng, 20ng, 30ng, 40ng, 50ng, 60ng, 70ng, 80ng, 90ng, 100ng, 120ng, 150ng, 180ng, 200ng, 250ng, 300ng, 400ng, 500ng, 800ng, and 1μg.

[0021] In some embodiments, the working concentrations of bisulfite, oyster glycogen and pH regulator in the conversion reaction system are 0.5-1 times the concentrations of the components described in the first aspect, including 0.5 times, 0.55 times, 0.6 times, 0.65 times, 0.7 times, 0.75 times, 0.8 times, 0.85 times, 0.9 times, 0.95 times and 1 times within the range.

[0022] In some embodiments, the incubation temperature of the conversion reaction is 80-98°C, including 80°C, 81°C, 82°C, 83°C, 84°C, 85°C, 86°C, 87°C, 88°C, 89°C, 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, 96°C, 97°C and 98°C within the range.

[0023] In some embodiments, the incubation time for the conversion reaction is 1-20 min, including 1 min, 2 min, 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min and 20 min within the range.

[0024] In some embodiments, the conversion reaction is incubated at 80-98°C for 1-20 min, such as 82-98°C for 1-20 min, such as 85-98°C for 1-20 min, such as 85-98°C for 5-20 min, such as 85-98°C for 5-15 min, such as 90-98°C for 5-15 min, such as 90-98°C for 10-15 min, such as 95-98°C for 10 min, including but not limited to any combination of the foregoing incubation temperatures and incubation times of the conversion reactions.

[0025] In some embodiments, the converted DNA sample is a deaminated DNA sample.

[0026] In some embodiments, the solid support is an adsorption column, preferably a silicon-based adsorption column, such as a silica gel adsorption column.

[0027] In some embodiments, when the solid phase carrier is an adsorption column, the step of using the solid phase carrier to adsorb the transformed DNA sample comprises adding the transformed DNA sample and binding solution to the adsorption column, mixing, and centrifuging.

[0028] In some embodiments, the binding solution includes a guanidine salt and a buffer component.

[0029] In some embodiments, the guanidine salt is, for example, one or more of guanidine hydrochloride, guanidine thiocyanate, and guanidine isothiocyanate; preferably, the guanidine salt is guanidine hydrochloride, preferably 5-10M guanidine hydrochloride, including 5M, 6M, 7M, 8M, 9M, and 10M within the range.

[0030] In some embodiments, the buffer component is, for example, any one of a phosphate buffer, a MES buffer, a HEPES buffer, and a citric acid buffer; preferably, the buffer component is a citric acid buffer, preferably a 10-200 mM citric acid buffer, including 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 110 mM, 120 mM, 130 mM, 140 mM, 150 mM, 160 mM, 170 mM, 180 mM, 190 mM, and 200 mM within the range.

[0031] In some embodiments, the pH of the binding fluid is 4-6, including 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, and 6 within the range.

[0032] In some embodiments, the desulfonation treatment includes adding a desulfonation solution, which includes an alkaline solution, such as a strong base or a weak base, such as one or more of NaOH, KOH and Ca(OH)2, preferably 10-200 mM NaOH or KOH.

[0033] In some embodiments, the desulfonation solution further comprises a buffer component, such as one or more of Tris, Triton, PBS buffer, and HEPES buffer, preferably Tris, and more preferably 10-200 mM Tris.

[0034] In some embodiments, the desulfonation solution further includes alcohol, such as ethanol and / or isopropanol, for example, 20%-80% ethanol and / or 1%-50% isopropanol, for example, 20%-60% ethanol and / or 1%-30% isopropanol, for example, 20%-50% ethanol and / or 5%-30% isopropanol, for example, 30%-50% ethanol and / or 5%-20% isopropanol, for example, 40% ethanol and / or 10% isopropanol.

[0035] In some embodiments, the desulfonation solution further comprises a metal salt, such as Na + Salt and / or K + Salt, such as NaCl and / or KCl, e.g. 10-20 mM NaCl.

[0036] In some embodiments, the desulfonation treatment further includes a washing treatment.

[0037] In some embodiments, a washing treatment is further included between the desulfonation treatment and the elution treatment.

[0038] In some embodiments, the washing treatment comprises adding a washing solution, which is an alcohol, preferably ethanol and / or isopropanol, more preferably 50%-95% ethanol, including 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% and 95% within the range.

[0039] In some embodiments, the elution treatment includes adding an elution buffer, such as nuclease-free water or TE buffer.

[0040] In some embodiments, the solid phase carrier is a magnetic adsorption medium, such as magnetic beads, such as super-cis ferroferric oxide magnetic beads or super-cis ferric oxide magnetic beads.

[0041] In some embodiments, the solid support is an anion exchange material, such as an anion exchange resin, such as a magnetic anion exchange resin.

[0042] The third aspect of the present application provides a DNA methylation detection method, which comprises performing bisulfite conversion on a DNA sample using the method described in the second aspect to obtain a DNA product; and performing qPCR amplification on the DNA product.

[0043] The fourth aspect of the present application provides a DNA methylation detection method, which uses the method described in the second aspect to perform bisulfite conversion on a DNA sample to obtain a DNA product; and constructs a library for the DNA product.

[0044] In some embodiments, the method further comprises sequencing the library.

[0045] The fifth aspect of the present application provides a kit comprising the composition described in the first aspect.

[0046] In some embodiments, the kit further comprises a solid phase carrier, which is one or more of an adsorption column, magnetic beads, or an anion exchange material.

[0047] In some embodiments, the kit further comprises at least one of a binding solution, a desulfonation solution, a washing solution, and an elution solution.

[0048] The sixth aspect of the present application provides the use of the composition described in the first aspect in improving the recovery rate of DNA bisulfite conversion.

[0049] Specific implementation (embodiment)

[0050] The technical solution of the present application is further illustrated below through specific implementation methods. However, the following examples are merely simplified examples of the present application and do not represent or limit the scope of protection of the present application. The scope of protection of the present application shall be subject to the claims.

[0051] In the following examples, unless otherwise specified, all reagents and consumables used were purchased from conventional reagent manufacturers in the field; unless otherwise specified, all experimental methods and technical means used were conventional methods and means in the field.

[0052] Example 1

[0053] The experimental reagents were prepared as follows:

[0054] Blank control group methylation conversion solution: 4M ammonium bisulfite, pH adjusted to 4.5 with sodium hydroxide;

[0055] Test group 1 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen (V900925, Sigma), pH adjusted to 4.5 with sodium hydroxide;

[0056] Test group 2 methylation conversion solution: 4 M ammonium bisulfite, 0.2 mg / ml oyster glycogen, pH adjusted to 4.5 with sodium hydroxide;

[0057] Test group 3 methylation conversion solution: 4 M ammonium bisulfite, 0.3 mg / ml oyster glycogen, pH adjusted to 4.5 with sodium hydroxide;

[0058] Test group 4 methylation conversion solution: 4 M ammonium bisulfite, 0.4 mg / ml oyster glycogen, pH adjusted to 4.5 with sodium hydroxide;

[0059] Test group 5 methylation conversion solution: 4 M ammonium bisulfite, 0.5 mg / ml oyster glycogen, pH adjusted to 4.5 with sodium hydroxide;

[0060] DNA binding solution: 7 M guanidine hydrochloride, 100 mM citrate buffer, pH adjusted to 4.6 with sodium hydroxide;

[0061] Washing solution: 80% ethanol;

[0062] Desulfonation solution: 100 mM sodium hydroxide, 50 mM sodium chloride, 40% anhydrous ethanol, 10% isopropanol, 200 mM Tris buffer solution;

[0063] Eluent: enzyme-free water.

[0064] 1. Bisulfite Conversion

[0065] 1. DNA preparation: NA12878 DNA standard, input 100pg genomic DNA.

[0066] 2. Prepare new PCR tubes. Add 20 μl DNA and 130 μl blank control group methylation conversion solution to the blank control group, and add 20 μl DNA and 130 μl test group methylation conversion solution 1-6 to test groups 1-6 respectively. Set up 4 replicates for each control group and test group. Vortex or pipette to mix, then briefly centrifuge to collect the reaction solution at the bottom of the tube.

[0067] 3. Place the PCR tube in a PCR instrument and perform the following reaction: 95°C for 10 min, hold at 20°C.

[0068] 4. Add 600 μl of DNA binding solution to an adsorption column (Vazyme #EM102), transfer the converted reaction product to the adsorption column, gently invert the column 6-8 times to mix the reaction product and DNA binding solution completely, and centrifuge at 12,000 rpm (13,400 × g) for 2 min.

[0069] 5. Discard the filtrate, add 100 μl of washing solution to the adsorption column along the wall of the tube, and centrifuge at 12,000 rpm (13,400 × g) for 1 min.

[0070] 6. Add 200 μl of desulfonation solution to the adsorption column along the tube wall, let it react at room temperature (15-25°C) for 15 minutes, and centrifuge at 12,000 rpm (13,400 × g) for 1 minute.

[0071] 7. Add 200 μl of washing solution to the adsorption column along the tube wall and centrifuge at 12,000 rpm (13,400 × g) for 1 min.

[0072] 8. Repeat step 7, discard the filtrate, and centrifuge the empty column at 12,000 rpm (13,400 × g) for 2 min.

[0073] 9. Transfer the adsorption column to a new 1.5ml nuclease-free centrifuge tube and add 10μl of elution buffer to the center of the adsorption column membrane. Let it stand at room temperature for 1-2 minutes, then centrifuge at 12,000 rpm (13,400 × g) for 2 minutes.

[0074] 10. Discard the adsorption column and store the DNA product at -30 to -15°C.

[0075] 2. qPCR detection

[0076] The bisulfite-converted products were subjected to qPCR detection, and the primers and probes could specifically bind to the methylated sequences.

[0077] Detection system: qPCR amplification solution (Vazyme#EM701) 10 μl, upstream primer (10 μm) 0.4 μl, probe (10 μm) 0.2 μl, downstream primer (10 μM) 0.4 μl, sample (conversion product) 1 μl, total volume 20 μl.

[0078] The upstream primer SEQ ID NO.1: F (5'-3'): CGCGTTTGTAATTTTAGTTATTCG The downstream primer SEQ ID NO.2: R (5'-3'): ATACAATAACGCGATCTCGAC

[0079] Probe SEQ ID NO. 3: 5'VIC-CACTACAACCTCCGCCTCC-3'BHQ1

[0080] The qPCR reaction conditions are shown in Table 1 below:

[0081] Table 1

[0082]

[0083] 3. Results Analysis

[0084] The CT value results of qPCR detection are shown in Table 2.

[0085] Table 2 qPCR detection CT values ​​of transformation products from different transformation solutions

[0086]

[0087] As shown in Table 2, when tested at an input of 100 pg, the addition of methylation conversion reagents with different concentrations of additives can effectively improve the DNA recovery efficiency compared with the blank control group. Among them, test group 4 had the best effect, with a CT value difference of 0.97 compared with the blank control group, which has a nearly 2-fold improvement in recovery efficiency (according to the qPCR test principle, the difference CT value is 0.97, and 2 to the power of 0.97 is approximately 2 times).

[0088] Example 2

[0089] Control methylation conversion solution: 4 M ammonium bisulfite, 0.4 mg / ml oyster glycogen, pH adjusted to 4.5 with sodium hydroxide;

[0090] Test group 1 methylation conversion solution: 4 M ammonium bisulfite, 0.4 mg / ml oyster glycogen, 0.01% (volume fraction) Tween 20, pH adjusted to 4.5 with sodium hydroxide;

[0091] Test group 2 methylation conversion solution: 4 M ammonium bisulfite, 0.4 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 4.5 with sodium hydroxide;

[0092] Test group 3 methylation conversion solution: 4 M ammonium bisulfite, 0.4 mg / ml oyster glycogen, 0.5% Tween 20, pH adjusted to 4.5 with sodium hydroxide;

[0093] DNA binding solution: 7 M guanidine hydrochloride, 100 mM citrate buffer, pH adjusted to 4-6 with sodium hydroxide;

[0094] Washing solution: 80% ethanol;

[0095] Desulfonation solution: 100 mM sodium hydroxide, 50 mM sodium chloride, 40% anhydrous ethanol, 10% isopropanol, 200 mM Tris buffer solution;

[0096] Eluent: enzyme-free water

[0097] 1. Bisulfite Conversion

[0098] 1. DNA preparation: NA12878 DNA standard, input 100pg genomic DNA.

[0099] 2. Two replicates were set for each control group and test group, and the other steps and methods were the same as those in the first part of Example 1.

[0100] 2. qPCR detection

[0101] The same as in Example 1, the CT value detection results are shown in Table 3.

[0102] 3. Results Analysis

[0103] Table 3 CT values ​​of transformation products detected by qPCR in different transformation solutions

[0104]

[0105] As shown in Table 3, when tested at an input of 100 pg, the CT values ​​of the methylation conversion reagents with different concentrations of additives were basically the same as those of the control group.

[0106] Example 3

[0107] Methylation conversion solution for the control group: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 4.5 with sodium hydroxide;

[0108] Test group 1 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 4.6 with sodium hydroxide;

[0109] Test group 2 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 4.7 with sodium hydroxide;

[0110] Test group 3 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 4.8 with sodium hydroxide;

[0111] Test group 4 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 4.9 with sodium hydroxide;

[0112] Test group 5 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 5.0 with sodium hydroxide;

[0113] Test group 6 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 5.1 with sodium hydroxide;

[0114] Test group 7 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 5.2 with sodium hydroxide;

[0115] Test group 8 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 5.3 with sodium hydroxide;

[0116] Test group 9 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 5.4 with sodium hydroxide;

[0117] Test group 10 methylation conversion solution: 4 M ammonium bisulfite, 0.1 mg / ml oyster glycogen, 0.1% Tween 20, pH adjusted to 5.5 with sodium hydroxide;

[0118] DNA binding solution: 7 M guanidine hydrochloride, 100 mM citrate buffer, pH adjusted to 4-6 with sodium hydroxide;

[0119] Washing solution: 80% ethanol;

[0120] Desulfonation solution: 100 mM sodium hydroxide, 50 mM sodium chloride, 40% anhydrous ethanol, 10% isopropanol, 200 mM Tris buffer solution;

[0121] Eluent: enzyme-free water

[0122] 1. Bisulfite Conversion

[0123] 1. DNA preparation: NA12878 DNA standard, input 100pg genomic DNA.

[0124] 2. Two replicates were set for each control group and test group, and the other steps and methods were the same as those in the first part of Example 1.

[0125] 2. qPCR detection

[0126] The same as in Example 1, the results of measuring CT values ​​are shown in Table 4.

[0127] 3. Results Analysis

[0128] Table 4 CT values ​​under different pH conditions

[0129]

[0130]

[0131] Table 5 Conversion rate under different pH conditions

[0132]

[0133] As shown in Table 4, under different pH conditions, the CT values ​​of each test group were lower than those of the control group, indicating that the conversion solution in the test group improved the recovery efficiency of the DNA sample. At the same time, according to the results in Table 5, the conversion efficiency of the reagents under different pH conditions was above 99.5%, indicating that the conversion solutions of different pH values ​​had no negative impact on the conversion rate.

[0134] Example 4

[0135] 1. Bisulfite Conversion

[0136] 1. DNA preparation: Arabidopsis thaliana, halophilic archaea, and mouse FFPE genomic DNA were spiked with 1% λ DNA (mass percentage), with the input amount of Arabidopsis thaliana and halophilic archaea being 50 ng and the input amount of mouse FFPE being 200 ng.

[0137] 2. The bisulfite conversion reagent of the test group used the DNA conversion solution of test group 4 in Example 3, and the sulfite conversion reagent of the control group used the conversion solution of the control group in Example 1. Two replicates were set for each control group and test group. The other steps and methods were the same as those in the first part of Example 1.

[0138] 2. Recovered DNA Concentration Detection

[0139] The single-strand concentration of the DNA sample recovered in the above step is determined as follows:

[0140] 1. Onedrop-ssDNA: Rinse the instrument with 1 μl of ddH2O and adjust the test to ssDNA. Test the instrument with 1 μl of the eluate (blank), requiring the blank test value to be within ±0.2. Measure 1 μl of the recovered DNA sample and record the concentration.

[0141] 2. Calculation of recovery efficiency: measured concentration * elution volume / (DNA input amount) * 100%

[0142] Conversion rate calculation: The conversion product was constructed according to the Vazyme#NE103 instruction manual. The data volume of each sample in the second-generation sequencing was 1G, and the λDNA conversion rate was calculated by bioinformatics analysis.

[0143] 3. Results Analysis

[0144] Table 6 Recovery efficiency of different types of samples

[0145]

[0146] Table 7 Conversion efficiency of different types of samples

[0147]

[0148] As shown in Table 6, the optimized conversion solution of the present application has a significant improvement in recovery efficiency when used in DNA sample templates of three different species: plants, bacteria, and animals, and the improvement in recovery efficiency is between 14% and 22%. At the same time, according to the results of Table 7, the optimized conversion solution has no effect on the conversion efficiency of the original reagent.

Claims

A composition comprising bisulfite and oyster glycogen, wherein the pH of the composition is 4-7.

2. The composition of claim 1, wherein the bisulfite is one or more of sodium bisulfite, ammonium bisulfite, potassium bisulfite and magnesium bisulfite, preferably ammonium bisulfite, more preferably 1-8M ammonium bisulfite.

3. The composition according to claim 1, wherein the concentration of the oyster glycogen is 0.01-10 mg / ml, preferably 0.01-5 mg / ml.

4. The composition of claim 1, further comprising a pH adjuster, wherein the pH adjuster is one or more of an acid, a base, a weak acid salt, and a weak base salt; preferably, the pH adjuster comprises NaOH.

5. The composition of claim 1, further comprising a surfactant, preferably a nonionic surfactant, more preferably Tween 20, more preferably 0.01%-10% (volume fraction) Tween 20.

6. A method for converting DNA using bisulfite, the method comprising: The composition according to any one of claims 1 to 5 is added to a DNA sample to carry out a conversion reaction to obtain a converted DNA sample; the converted DNA sample is adsorbed using a solid phase carrier; and the converted DNA sample is subjected to a desulfonation treatment and an elution treatment to obtain a DNA product. The method according to claim 6 , wherein the conversion reaction is incubated at 80-98° C. for 1-20 min.

8. The method according to claim 6, wherein the solid phase carrier is an adsorption column, preferably a silicon-based adsorption column, more preferably a silica gel adsorption column.

9. The method according to claim 8, wherein the step of adsorbing the transformed DNA sample using a solid phase carrier comprises adding the transformed DNA sample and binding solution to an adsorption column, mixing, and centrifuging.

10. The method according to claim 9, wherein the binding solution comprises a guanidine salt and a buffer component; preferably, the guanidine salt is one or more of guanidine hydrochloride, guanidine thiocyanate and guanidine isothiocyanate, preferably guanidine hydrochloride, more preferably 5-10 M guanidine hydrochloride; preferably, the buffer component comprises any one or more of phosphate buffer, MES buffer, HEPES buffer and citric acid buffer; preferably, the buffer component is citric acid buffer, more preferably 10-200 mM citric acid buffer.

11. The method according to claim 6, wherein the desulfonation treatment comprises adding a desulfonation solution, and the desulfonation solution comprises an alkaline solution; preferably, the alkaline solution is one or more of NaOH, KOH and Ca(OH)2, preferably 10-200 mM NaOH or KOH.

12. The method according to claim 11, wherein the desulfonation solution further comprises a buffer component, wherein the buffer component is one or more of Tris, Triton, PBS buffer, and HEPES buffer, preferably Tris, more preferably 10-200 mM Tris; preferably, the desulfonation solution further comprises an alcohol, preferably ethanol and / or isopropanol, preferably 20%-80% ethanol and / or 1%-50% isopropanol; preferably, the desulfonation solution further comprises a metal salt, preferably Na + Salt and / or K + Salt, preferably NaCl and / or KCl, preferably 10-20 mM NaCl.

13. The method according to claim 6, further comprising a washing treatment before the desulfonation treatment, and / or, further comprising a washing treatment between the desulfonation treatment and the elution treatment; preferably, the washing treatment comprises adding a washing liquid, and the washing liquid is an alcohol, preferably ethanol and / or isopropanol, more preferably 50%-95% ethanol. The method according to claim 6 , wherein the elution treatment comprises adding an elution buffer, and the elution buffer is nuclease-free water or TE buffer.

15. The method according to claim 6, wherein the solid phase carrier is a magnetic adsorption medium or an anion exchange material; preferably, the solid phase carrier is a magnetic bead or an anion exchange resin.

16. A method for detecting DNA methylation, comprising performing bisulfite conversion on a DNA sample using the method according to any one of claims 6 to 15 to obtain a DNA product; and performing qPCR amplification on the DNA product.

17. A method for detecting DNA methylation, comprising: performing bisulfite conversion on a DNA sample using the method according to any one of claims 6 to 15 to obtain a DNA product; constructing a library of the DNA product; and preferably sequencing the library.

18. A kit comprising the composition according to any one of claims 1 to 5.

19. The kit according to claim 18, further comprising a solid phase carrier, wherein the solid phase carrier is one or more of an adsorption column, magnetic beads or an anion exchange material; preferably, the kit further comprises at least one of a binding solution, a desulfonation solution, a washing solution and an elution solution.

20. Use of the composition according to any one of claims 1 to 5 for improving the recovery rate of DNA bisulfite conversion.

Citation Information

Patent Citations

  • Method for bisulfite treatment

    US9868756B2