Porcine ARRB1 gene 11 intron SNP molecular marker, primer pair and application thereof in pork quality character breeding

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker of an eleventh intron of a pig ARRB1 gene, a primer pair and application of the SNP molecular marker and the primer pair in pork quality character breeding, and relates to the technical field of pig molecular markers. Wherein the pork quality character is intramuscular fat character; the SNP molecular marker is located in an eleventh intron of an ARRB1 gene of a ninth chromosome of a pig, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1 in a sequence table, and g.130Cgt exists at the 130bp position of the sequence; the T basic group is mutated. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding pigs by using the molecular marker. According to the invention, the correlation between one SNP molecular marker in the pig ARRB1 gene and the intramuscular fat character of the pig is explored for the first time, so that the SNP molecular marker can be used for marker-assisted selective breeding of the pig, that is, a new application of the SNP molecular marker in the pig ARRB1 gene in marker-assisted breeding of the pork quality character is provided, early screening of the breeding character of the pig is realized, and the breeding efficiency of the pig is improved. The screening method is simple and rapid.

Description

Technical Field

[0001] The present invention relates to the technical field of pig molecular markers, and in particular to a pig ARRB1 gene intron 11 SNP molecular marker, a primer pair and application thereof in pig meat quality trait selection and breeding. Background Art

[0002] Meat quality is a crucial economic trait in the pig breeding industry, with pork quality directly impacting pig farm production and economic profitability. Meat quality has a heritability ranging from 0.25 to 0.42, making it a mostly medium-heritability trait. Currently, the key genes that influence meat quality are still insufficient to identify and elucidate their mechanisms. Therefore, identifying key molecular genetic markers controlling pork quality traits and using them in marker-assisted breeding is crucial for improving meat quality and increasing economic profitability.

[0003] β-arrestin 1 (ARRB1) is a key member of the β-arrestin family, which includes two isoforms: β-arrestin 1 and β-arrestin 2. Unlike ARRB2, ARRB1 can shuttle between the cytoplasm and the nucleus and is clearly expressed in serum. ARRB1 is a key regulator of G protein-coupled receptor desensitization and internalization, regulating multiple downstream signaling pathways, exerting anti-oxidative stress, anti-apoptosis, anti-inflammatory, and autophagy-regulating effects.

[0004] Studies have shown that ARRB1 can prevent oxidative stress-mediated cell death in mouse embryonic fibroblasts when interleukin-8 (IL-8) stimulates the CXC motif receptor 2 (CXCR2) receptor. In hepatic ischemia-reperfusion injury, ARRB1 inhibits apoptosis by inhibiting the downstream mitogen-activated protein kinase (MAPK) pathway and suppresses inflammation by inhibiting the nuclear factor kappa-B (NF-κB) pathway. ARRB1 can also inhibit the NF-κB pathway activated by Toll-like receptors (TLRs) and the interleukin-1 receptor (IL-1R) by binding to tumor necrosis factor receptor associated factor 6 (TRAF6), thereby suppressing the formation of a local inflammatory storm. Studies have also shown that in vascular inflammatory responses, ARRB1 inhibits inflammation by antagonizing ARRB2. Endothelial cell denudation studies have confirmed that after ARRB1 KO, neutrophils are more likely to attach to the vascular endothelium, leading to atherosclerosis and even thrombosis.

[0005] However, the molecular mechanism of whether the ARRB1 gene can improve pork quality has not been reported. Summary of the Invention

[0006] The purpose of the present invention is to overcome the above-mentioned technical deficiencies and provide a molecular marker, primer pair and application of the SNP molecular marker in intron 11 of the pig ARRB1 gene in pig quality trait selection and breeding. The present invention discovered that a SNP in the ARRB1 gene on chromosome 9 is associated with pork quality traits, which can be used as a molecular marker for pork quality trait screening and pig breeding.

[0007] In the first aspect, the present invention provides a SNP molecular marker associated with the pork quality trait gene ARRB1, wherein the pork quality trait is an intramuscular fat trait; the SNP molecular marker is located in the 11th intron of the ARRB1 gene on pig chromosome 9, and its nucleotide sequence is shown in the sequence table SEQ ID NO.1. There is a g.130C>T base mutation at the 130bp of the sequence.

[0008] Furthermore, the C or T base polymorphic site at the 130th bp in the sequence SEQ ID NO. 1 exhibits three genotypes: CC, TC or TT, wherein the T allele is the dominant allele.

[0009] In a second aspect, the present invention provides a use of the SNP molecular marker described in the first aspect in pork quality trait screening and / or pig breeding.

[0010] In a third aspect, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, wherein the primer pair comprises: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.3.

[0011] In a fourth aspect, the present invention provides a use of the primer pair described in the third aspect in pork quality trait screening and / or pig breeding.

[0012] In a fifth aspect, the present invention provides a kit for rapid pig breeding using the SNP molecular markers described in the first aspect, comprising the primer pair described in the third aspect.

[0013] In a sixth aspect, the present invention provides a method for screening pork quality traits and / or pig breeding, comprising the following steps:

[0014] S1. Extract pig genomic DNA;

[0015] S2. Using the genomic DNA obtained in step S1 as a template, performing PCR amplification using the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purifying the molecular marker;

[0016] S3. Perform sequencing analysis on the molecular markers purified in step S2, retain the individuals carrying the T allele at the 130th bp of the sequence, and eliminate the individuals carrying the C allele.

[0017] Furthermore, in step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

[0018] Furthermore, in step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng of genomic DNA, 25 μL of PCRmix, 1 μL each of the upstream and downstream primers mentioned above, and ddH2O is added to make up the total volume to 50 μL; the PCR operation program is: 98°C pre-denaturation for 45 s; 98°C denaturation for 10 s, 61°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 5 min; 4°C storage.

[0019] Compared with the prior art, the beneficial effects of the present invention include: the present invention discovered for the first time that SNP molecular markers related to the pig ARRB1 gene are related to the meat quality traits of pigs, specifically the intramuscular fat traits. Therefore, the molecular markers can be used to screen pork quality traits and select pig breeds, that is, it provides a new use of SNP molecular markers related to the pig ARRB1 gene in marker-assisted breeding of pork quality traits, realizes early screening of pork quality traits, and the screening method is simple and fast. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is an agarose gel electrophoresis detection diagram of the PCR product in Example 1 of the present invention, wherein lane M is DL5000 Marker, and lanes 1-4 are the amplified fragments in pigs, with a fragment size of 326 bp;

[0021] Figure 2 This is the sequencing map of the g.130C>T site in Example 1 of the present invention. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0023] Example 1 Acquisition of SNP Detection Fragments of the Porcine ARRB1 Gene and Establishment of a Polymorphic Site Detection Method

[0024] 1. Extraction of pig genomic DNA

[0025] Pig genomic DNA was extracted using the PureLink® Animal Tissue Genomic DNA Extraction Kit (Invitrogen). TM Pro 96 Genomic DNA Purification Kit (K182104A) was used to extract porcine genomic DNA according to the kit instructions. The extracted DNA was tested for concentration and quality and stored at -20°C until use.

[0026] 2. Obtaining the SNP genetic marker detection fragment of the porcine ARRB1 gene

[0027] (1) PCR amplification

[0028] According to the SNP genetic marker detection sequence in the genomic sequence of the porcine ARRB1 gene, a pair of primers is designed to amplify the fragment of the polymorphic site.

[0029] Among them, the nucleotide sequence of the SNP genetic marker detection sequence is:

[0030] GGCGGTGGTTCGTGATGTCCGCCCAGGTCCTCCCCATCAGGCCACTGTCCGGTGACACACGACAGCCTTTGACCACAGAGAAATCCACATCGATCCTCCGGAGTCAGAAGCAACAAGAGCCCCAGAACCTTCCCCACCCCACAGCCTCAGTCCACTGGCTGGGTG CAGGCGAGGCAGGACAGAGCCCAGCCCAGGGCCACAAACCAGCCCTGTGACAGCCGAGCAGGCGCTGTGGACGGATGGGTGGACGGACGGACTGACGGACGTGCAAGGACGAGGGAGGAAGACAGACCCAGCAAGGCAGGAGGAAGAGGAACAGGCACCG, such as SEQ Shown as ID NO.1.

[0031] The designed primers are as follows:

[0032] Upstream primer: 5'GGCGGTGGTTCGTGAT 3', as shown in SEQ ID NO.2.

[0033] Downstream primer: 5'CGGTGCCTGTTCCTCTTC 3', as shown in SEQ ID NO.3.

[0034] PCR amplification was performed using the above primers and genomic DNA extracted from the ear margin tissue of the pig to be tested as a template. The PCR reaction system was 50 μL, and the components in the system were: 100 ng of genomic DNA, 25 μL of PCR mix, 1 μL each of the above upstream and downstream primers, and ddH2O was added to make up the total volume to 50 μL.

[0035] The PCR program was as follows: 98°C pre-denaturation for 45 seconds; 98°C denaturation for 10 seconds, 61°C annealing for 30 seconds, 72°C extension for 30 seconds, 35 cycles; 72°C extension for 5 minutes; 4°C storage. PCR products were detected by 1.5% agarose gel electrophoresis. The test results are shown in the attached figure. Figure 1 As shown, lane M is DL5000 Marker, lanes 1-4 are amplified fragments in pigs, and the size of the amplified fragments is 326 bp.

[0036] (2) PCR product purification

[0037] The PCR amplification product was purified using the Gel Extraction Kit from Shanghai Sangon Biotechnology Co., Ltd. For specific steps, see the kit instructions.

[0038] 3. Detection of molecular markers using direct sequencing of PCR products

[0039] The PCR purified products obtained above were directly sent to Beijing Aoke Company for sequencing. The genotype of the locus in the test population was determined based on the sequencing results. DNA Star software was used for analysis. The results are shown in the attached figure. Figure 2 As shown, it was found that there was a C130–T130 allele mutation at 130bp in the sequence shown in SEQ ID NO.1, namely g.130C>T, and the above mutation caused the polymorphism of the ARRB1 gene.

[0040] Example 2 Detection of polymorphic distribution of molecular markers in pigs

[0041] In this example, the polymorphism distribution pattern of the g.130C>T site of the porcine ARRB1 gene was detected in 275 pigs with the intramuscular fat trait. The detection results are shown in Table 1.

[0042] Table 1 Distribution of polymorphisms at the g.130C>T site in the ARRB1 gene

[0043]

[0044] The results in Table 1 show that in pigs, the ARRB1 gene g.130C>T site presents three genotypes: CC, TC, and TT. Among them, the CC genotype is more common, and the C allele frequency is 62%.

[0045] Example 3 Association analysis between molecular markers and pig reproductive traits

[0046] To determine whether the g.130C>T site in the porcine ARRB1 gene is associated with differences in pork quality traits, the method established in Example 1 was used to detect polymorphisms and analyze the correlation between different genotypes of this polymorphic site and intramuscular fat traits. SAS statistical software (SAS Institute Inc, Version 9.4) GLM program was used to perform variance analysis of different SNP genotype combinations and perform significance tests. The model used was:

[0047] Y ijl =μ+G i +W j +e ijl ;

[0048] Y ijl is the phenotypic value of the trait, μ is the average value, G i is the genotype effect (including gene additive effect and dominant effect; additive effect uses 1, 0 and -1 to represent CC, TC and TT genotypes respectively, and dominant effect uses 1, -1 and 1 to represent CC, TC and TT genotypes respectively); W jis age in days; e ij is the residual effect.

[0049] The association analysis between different genotypes and meat quality traits was conducted in pigs. The statistical analysis results are shown in Table 2:

[0050] Table 2 Association analysis between ARRB1 gene g.130C>T locus and pork quality traits

[0051]

[0052] Note: The trait means in the table are mean ± standard deviation, A and B indicate significant difference (P<0.05), * indicates significant difference (P<0.05)

[0053] Table 2 shows that in pigs, the intramuscular fat of individuals with the T genotype at the g.130C>T locus was significantly higher than that of individuals with the TC and CC genotypes (P<0.05), and the additive effect reached a significant level (P<0.05), so the T allele is the dominant allele.

[0054] Example 4 Application of ARRB1 gene SNP molecular markers in pork quality trait screening and / or pig breeding

[0055] The g.130C>T SNP marker in the intron of the ARRB1 gene is significantly associated with pork quality traits, with the T allele exhibiting a significant additive effect. Therefore, this SNP marker can be used to assist in the selection of TT or TC-type individuals with good meat quality during pig breeding. Individuals carrying this dominant allele should be retained during breeding, thereby improving the production performance of the herd.

[0056] The specific embodiments of the present invention described above do not limit the scope of protection of the present invention. Any other corresponding changes and modifications made based on the technical concept of the present invention should be included in the scope of protection of the claims of the present invention.

Claims

1. A SNP molecular marker associated with the pork quality trait gene ARRB1, characterized in that: The pork quality trait is an intramuscular fat trait; the SNP molecular marker is located in the 11th intron of the ARRB1 gene on pig chromosome 9, and its nucleotide sequence is shown in the sequence table SEQ ID NO.

1. There is a g.130C>T base mutation at the 130bp of the sequence.

2. The SNP molecular marker associated with the pork quality trait gene ARRB1 according to claim 1, characterized in that: The C or T base polymorphic site at the 130th bp in the sequence SEQ ID NO.1 exhibits three genotypes: CC, CT or TT, among which the T allele is the dominant allele.

3. Use of the SNP molecular marker according to any one of claims 1 or 2 in pork quality trait screening and / or pig breeding.

4. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The primer pair includes: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

5. Use of the primer pair according to claim 4 in pork quality trait screening and / or pig breeding.

6. A kit for rapid pig breeding using the SNP molecular marker according to claim 1, characterized in that: Comprising the primer pair as claimed in claim 4.

7. A method for screening pork quality traits and / or pig breeding, characterized in that: The following steps are involved: S1. Extract pig genomic DNA; S2. Using the genomic DNA obtained in step S1 as a template, performing PCR amplification using the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purifying the molecular marker; S3. Perform sequencing analysis on the molecular markers purified in step S2, retain the individuals carrying the T allele at the 130th bp of the sequence, and eliminate the individuals carrying the C allele.

8. The method for screening pork quality traits and / or pig breeding according to claim 7, characterized in that: In step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

9. The method for screening pork quality traits and / or pig breeding according to claim 7, characterized in that: In step S2, the PCR reaction system was 50 μL, and the components in the system were: 100 ng of genomic DNA, 25 μL of PCR mix, 1 μL each of the upstream and downstream primers mentioned above, and ddH2O was added to make up the total volume to 50 μL; the PCR operation program was as follows: pre-denaturation at 98°C for 45 s; denaturation at 98°C for 10 s, annealing at 61°C for 30 s, and extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

Images