SNP (Single Nucleotide Polymorphism) site related to cadmium tolerance of corn and transcript gene ZmEIV related to SNP site

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to maize cadmium tolerance and a transcript gene ZmEIV related to the SNP site, and relates to the technical field of biochemistry, the technical key points are as follows: the SNP site and the transcript gene ZmEIV related to the SNP site are obtained by carrying out whole genome association analysis and screening, one transcript gene ZmEIV5 can enhance the cadmium tolerance of organisms, and the other transcript gene ZmEIV5 can enhance the cadmium tolerance of the organisms; the corn with the overexpression gene ZmEIV5 is cultivated, so that the corn shows better adaptability on the cadmium-polluted land; according to the invention, the agricultural environment can be improved, the influence of heavy metal pollution on land can be reduced, the tolerance of crops to heavy metal pollution can be obviously improved, and the food safety can be ensured.

Description

Technical Field

[0001] The present invention relates to the technical field of biochemistry, and in particular to a SNP site associated with maize cadmium tolerance and a related transcript gene ZmEIV. Background Art

[0002] Corn may be significantly affected when grown in an environment contaminated by cadmium. Cadmium enters the plant's body through the root system, inhibiting root growth and reducing the absorption of water and nutrients, leading to slower plant growth, shorter plants, and lower yields. Cadmium can also damage the cell structure of leaves, reduce chlorophyll content, and thus affect photosynthesis efficiency and the nutrient synthesis of corn. In addition, cadmium can interfere with corn's absorption of other essential elements, leading to malnutrition, and triggering oxidative stress reactions, damaging cell structures. The accumulation of cadmium may also affect kernel quality, increasing the cadmium content in corn and threatening food safety. In general, cadmium pollution has a negative impact on the growth, yield, and quality of corn, and in severe cases, it can even affect the survival of the plant.

[0003] To this end, the present invention aims to provide a SNP site associated with cadmium tolerance in maize and its related transcript gene ZmEIV to solve the above problems. Summary of the Invention

[0004] The purpose of the present invention is to solve the above problems, provide SNP sites related to cadmium tolerance in corn and their related transcript genes ZmEIV, obtain SNP sites and ZmEIV5 by screening through whole genome association analysis, and cultivate corn that overexpresses gene ZmEIV5 to improve the adaptability of corn to cadmium-contaminated land.

[0005] In order to achieve the above object, the technical solution of the present invention is as follows:

[0006] The present invention provides a SNP site associated with cadmium tolerance in maize and a related transcript gene ZmEIV, wherein the SNP site is rs2_154969627; the transcript gene ZmEIV is ZmEIV5, and the sequence of ZmEIV5 is SEQ ID No. 5.

[0007] The SNP site and ZmEIV5 were obtained by screening through whole genome association analysis of corn.

[0008] The SNP site and ZmEIV5 can be used to reduce the cadmium content in corn.

[0009] Compared with the existing technology, this solution has the following beneficial effects:

[0010] The present invention screens SNP sites and transcript genes ZmEIV through genome-wide association analysis, wherein one transcript ZmEIV5 can enhance biological cadmium tolerance. By breeding corn that overexpresses gene ZmEIV5, the adaptability of corn to cadmium-contaminated land is improved. The present invention helps to improve the agricultural environment, reduce the impact of heavy metal pollution on the land, and significantly improve the tolerance of crops to heavy metal pollution, thereby ensuring food safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 1 is a schematic diagram of cadmium content and SNP typing data in kernels of 170 maize inbred lines according to an embodiment of the present invention;

[0012] Figure 2 Schematic diagram showing how different mutation sites affect cadmium content in an embodiment of the present invention;

[0013] Figure 3 Schematic diagram of the molecular characteristics of the ZmEIV protein in the embodiment of the present invention;

[0014] Figure 4 This is a schematic diagram of the involvement of six transcript proteins in biological cadmium tolerance in an embodiment of the present invention. DETAILED DESCRIPTION

[0015] In order to enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of the present invention.

[0016] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The present invention will be described in detail below with reference to the embodiments.

[0017] Example:

[0018] The cadmium content and SNP typing data of kernels in 170 maize inbred lines are shown in Figure 2. Figure 1As shown, genome-wide association studies (GWAS) were conducted in three environments: Hainan (HN), Jiangmen Repeat 1 (JMO), and Jiangmen Repeat 2 (JMT). The results identified a significant single nucleotide polymorphism (SNP) marker, rs2_154969627, on chromosome 2. This SNP was consistently found in all environments, and the best linear unbiased predictive value (BLU) across all three environments was also associated with cadmium content in maize kernels. Therefore, this locus is relatively stable and reliable, and a candidate gene, zm00001d005036 (ZmEIV), is located 73.537 kb downstream of this locus.

[0019] In order to understand the influence of SNP marker site rs2_154969627 on the cadmium content of corn kernels, the influence of different variant sites on cadmium content was analyzed based on the gene site effect value calculation method established earlier. Figure 2 As shown, this locus includes two genotypes (CC and TT), so the materials with different genotypes at this SNP locus were classified separately, and the phenotypic values ​​of the different categories were analyzed by variance analysis, followed by pairwise LSD analysis. The results showed that the phenotypic values ​​of the superior genotype of this SNP and the relative genotype formed by the opposite locus showed significant differences in all three environments (P < 0.05). Therefore, TT is the superior genotype, and possessing this genotype tends to reduce cadmium accumulation.

[0020] To understand the characteristics of ZmEIV, the present invention cloned and synthesized all transcripts of ZmEIV through the maize genome database (https: / / maizegdb.org), and expressed a total of 6 proteins, namely ZmEIV1, ZmEIV2, ZmEIV3, ZmEIV4, ZmEIV5 and ZmEIVN ( Figure 3 A), where ZmEIVN is a novel transcript discovered by cloning.

[0021] In order to understand the correlation between them, similarity analysis ( Figure 3 B) Neighbor-joining cluster analysis ( Figure 3 C) and protein three-dimensional structure prediction ( Figure 3 DI), the similarity coefficients between ZmEIV1, ZmEIV4 and ZmEIVN were all greater than 50%. In the cluster analysis, these three transcripts were classified into 1 category, but the similarity coefficients between ZmEIV1 and ZmEIV4 reached 98.89%, while the similarity coefficients between ZmEIVN and them were less than 54%. Therefore, the protein three-dimensional structure prediction found that ZmEIV1 and ZmEIV4 ( Figure 3 D, F) have high similarity, but poor similarity to ZmEIVN ( Figure 3 H).

[0022] In addition, the correlation coefficient between ZmEIV2 and ZmEIV3 was 85.95%, and they could be classified into 1 category in the cluster analysis. However, their three-dimensional structures were quite different, while the three-dimensional structures of ZmEIV3 and ZmEIVN were more similar ( Figure 3 F, I). Furthermore, ZmEIV5 was independently classified as Class 1, and its amino acid sequence correlation coefficient with the other five transcript proteins was low, averaging 32.97%. Its three-dimensional protein structure was significantly different from that of the other five transcripts, suggesting that ZmEIV5 may have a specific function.

[0023] To identify the involvement of the six ZmEIV transcripts in cadmium tolerance, we overexpressed ZmEIV1, ZmEIV2, ZmEIV3, ZmEIV4, ZmEIV5, and ZmEIVN in AH109 yeast and subjected them to cadmium stress. The results showed that under normal conditions, yeast overexpressing ZmEIV1, ZmEIV2, ZmEIV3, ZmEIV4, and ZmEIVN exhibited poor growth, especially ZmEIV4, under high cadmium concentrations. However, ZmEIV5 exhibited cadmium tolerance and exhibited the best growth, suggesting that this transcript may be an important protein in enhancing plant cadmium tolerance.

[0024] The sequence of ZmEIV1 is SEQ ID No. 1:

[0025] ATGGGCAACTGCGGCACGCGGGAGGAGAATGCCGTCGTCGCTGCGCACGCACAAGTTCAACAGCTCCACTTGTTACAAAATCCTGCCAAGAATGCCATTGGAGATAGGAAGCACAACCGCACCTCATCAGATATAAGTGATCCTTCCACACCTAGGAAAGCTGAAGATGCCAAGAACATTTCCATATACAACGATGTGATTGTCTTCACATTGTTTGAGCTAGAGACAATCACAAAGAGCTTCCGTGCCGATTATGTTCTCGGCGAAGGAGGATTTGGGACCGTTTACAAGGGCTACATAGATGAAAATGTCAGGGTGGGGCTGAAGTCACTGCCTGTTGCAGTCAAGGTGCTCAACAAAGATGGACACCAAGGGCACAGAGAATGGCTTACCGAAGTTAACTGCCTGGGGCAGTTAAGGCATCCAAACTTGGTGAAGTTGATCGGATATTGCTGCGAAGATGACCATCGGCTGCTTGTCTACGAGTTCATGTTTCGAGGAAGCCTAGAAAACCACCTATTCCGAAAGACAGCTACACCATTACCCTGGGGTACTAGGATGTCAATCGCACTGGGAGCTGCTAAAGGGCTTGCTTGCCTCCACAATGCTCAAAGGCCTGTCATCTACAGAGATTTCAAGACATCAAATATTCTACTGGACTCTGGATTATACTGCTAA;

[0026] The ZmEIV2 sequence is SEQ ID No. 2:

[0027]

[0028] The sequence of ZmEIV3 is SEQ ID No. 3:

[0029]

[0030] The ZmEIV4 sequence is SEQ ID No.4:

[0031] ATGGGCAACTGCGGCACGCGGGAGGAGAATGCCGTCGTCGCTGCGCACGCACAAGTTCAACAGCTCCACTTGTTACAAAATCCTGCCAAGAATGCCATTGGAGATAGGAAGCACAACCGCACCTCATCAGATATAAGTGATCCTTCCACACCTAGGAAAGCTGAAGATGCCAAGAACATTTCCATATACAACGATGTGATTGTCTTCACATTGTTTGAGCTAGAGACAATCACAAAGAGCTTCCGTGCCGATTATGTTCTCGGCGAAGGAGGATTTGGGACCGTTTACAAGGGCTACATAGATGAAAATGTCAGGGTGGGGCTGAAGTCACTGCCTGTTGCAGTCAAGGTGCTCAACAAAGATGGACACCAAGGGCACAGAGAATGGCTTACCGAAGTTAACTGCCTGGGGCAGTTAAGGCATCCAAACTTGGTGAAGTTGATCGGATATTGCTGCGAAGATGACCATCGGCTGCTTGTCTACGAGTTCATGTTTCGAGGAAGCCTAGAAAACCACCTATTCCGAACTACACCATTACCCTGGGGTACTAGGATGTCAATCGCACTGGGAGCTGCTAAAGGGCTTGCTTGCCTCCACAATGCTCAAAGGCCTGTCATCTACAGAGATTTCAAGACATCAAATATTCTACTGGACTCTGGATTATACTGCTAA;

[0032] The ZmEIV5 sequence is SEQ ID No.5:

[0033] ATGCTCAAAGGCCTGTCATCTACAGAGATTTCAAGACATCAAATATTCTACTGGACTCTGGATTATACTGCTAAGCTGTCTGACTTTGGCCTGGCAAAAGCTGGCCCTGAAGGTGATCAGACCCATGTATCAACACGGGTGATGGGAACCTACGGTTATGCTGCCCCTGAATATGTGATGACCGGCCACTTGACTGCTAGAAGTGATGTCTACAGCTTCGGTGTGGTCCTTCTGGAGCTCTTGACAGGGCGCAAGTCAATCGACAAGTCGCGGCCCAGCAGGGAGCAGAGCCTGGTTGACTGGGCCCTCCCCAAGCTGAACGACAAGAGGCGGCTTCTCCAGATCATCGACCCGAGACTGGAGGGGCAGTACTCGGCCAGAGCCGCCCACAAAGCCTGCAGCCTTGCGTTCTACTGCCTGAGCCAGAACCCCAAGGCCAGGCCACTCATGAGCGACGTCGTCGAGACCCTCGAACCGTTGCAGGGCAGCGGTGGAGGCGATGGACGCGGCCAGCCTTCTGGCCTTCCTGACTATAGGGGTCGCCGCAGGATAACCGGGAACAGCGTCCACTTCAGGGCCATCCCGAACCCCAAGTGCTCCCCTGCCGTCCCGGCCACGGCTTGCCGAGTGCGGTGA;

[0034] The ZmEIVN sequence is SEQ ID No. N:

[0035]

[0036] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the embodiments as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. The SNP loci associated with maize cadmium tolerance and their associated transcript gene ZmEIV are characterized by: The SNP site is rs2_154969627; The transcript gene ZmEIV is ZmEIV5, and the sequence of ZmEIV5 is SEQ ID No.

5.

2. The SNP site associated with cadmium tolerance in maize and its related transcript gene ZmEIV according to claim 1, characterized in that: The SNP site and ZmEIV5 were obtained by screening through whole genome association analysis of corn.

3. The SNP site associated with cadmium tolerance in maize and its associated transcript gene ZmEIV according to claim 1, characterized in that: The SNP site and ZmEIV5 can be used to reduce the cadmium content in corn.

Images