LNP-mRNA delivery system for generating CAR-T in vivo and application of LNP-mRNA delivery system

Abstract

The invention relates to the technical field of biological medicine, and particularly discloses an LNP-mRNA delivery system for generating CAR-T in vivo and application of the LNP-mRNA delivery system. The delivery system comprises lipid nanoparticles and CAR mRNA wrapped by the lipid nanoparticles, the lipid nanoparticles comprise SM102, cholesterol, DSPC and DMG-PEG2000, and the coding target protein of the CAR mRNA is CLDN18.2. The delivery system is applied to preparation of drugs for treating gastric cancer tumors. The obtained mRNA sequence can translate and express CAR protein targeting CLDN18.2, T cells can be encoded in situ in vivo through an LNP delivery system to generate CAR-T, the T cells are transformed into CAR-T cells in vivo, and a novel, convenient and universal implementation scheme is provided for CAR-T therapy.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an LNP-mRNA delivery system for generating CAR-T in vivo and its application. Background Art

[0002] Gastric cancer is the third leading cause of cancer death worldwide. It is a common tumor in my country, with a high proportion of late-stage cases and a relatively low rate of early diagnosis. Targeted therapy and immunotherapy have become important treatments due to their precision and effectiveness. Claudins are a family of proteins whose function is to maintain tight junctions that control the exchange of molecules between cells. Widely distributed in gastric, pancreatic, and lung tissues, the CLDN18.2 isoform is a gastric-specific isoform and a highly selective molecule with an expression rate of 40%-87% in gastric cancer patients. It is also widely expressed only in cancer cells, making it an ideal therapeutic target.

[0003] CAR-T therapy is based on the patient's own T cells. Through in vitro gene modification, a specific chimeric antigen receptor (CAR) is inserted into the T cells. This receptor can recognize specific antigens on the surface of tumor cells and activate T cells to attack tumor cells. Generally, the standard manufacturing process of CAR-T cells includes cell collection, T cell screening and enrichment, T cell activation, CAR gene construction, gene transduction, amplification, quality control, storage and transportation, and re-infusion into patients. The entire CAR-T cell preparation process is very complicated and needs to be carried out under sterile conditions. It also has high requirements for the environment and equipment, which leads to the high cost of CAR-T therapy and limits its clinical application.

[0004] To improve the complex in vitro modification process for CAR-T cells, the concept of in situ CAR-T production has been proposed. This involves programming CAR-T cells directly within the patient, eliminating the in vitro steps of cell collection, modification, and expansion. This approach reduces costs, improves safety, enhances accessibility, and enables broader disease treatment. The key to in vivo CAR-T production lies in selecting a suitable delivery vector. Currently, the vectors studied are categorized as viral and non-viral, with lentiviral (LV) and adeno-associated viral (AAV) vectors representing a significant proportion of viral vectors. While viral vectors offer high transduction rates and long-term, stable gene expression, their packaging capacity is limited; immune responses, side effects such as random integration, and manufacturing difficulties often hinder the selection of viral delivery vectors. The advantage of non-viral mRNA delivery systems is that they avoid integration into the host genome, thus avoiding many risks. Their transient nature also prevents off-target toxicity, enabling transient, regulated expression of CAR-T cells, thereby reducing side effects and safety risks. Summary of the Invention

[0005] In order to solve the above problems, the present invention proposes an LNP-mRNA delivery system for in vivo generation of CAR-T and its application.

[0006] The present invention adopts the following technical solution: a delivery system for generating CAR-T in vivo, comprising lipid nanoparticles and CAR mRNA encapsulated by the lipid nanoparticles, wherein the lipid nanoparticles contain peptidyl phospholipid SM102, cholesterol, dipalmitoylphosphatidylcholine DSPC and dimyristoylglycerol-polyethylene glycol 2000 DMG-PEG2000, and the target protein encoded by the CAR mRNA is CLDN18.2.

[0007] Furthermore, the sequence of the CAR mRNA includes, in sequence: T7 promoter, 5'UTR, CD8a signal peptide, single-chain antibody variable region, CD8 hinge region, CD28 transmembrane region, CD28 costimulatory region, CD3ζ intracellular region, stop codon, 3'UTR and poly (A) tail.

[0008] Furthermore, the molar ratio of peptidyl phospholipid SM102, cholesterol, dipalmitoylphosphatidylcholine DSPC and dimyristoylglycerol-polyethylene glycol 2000DMG-PEG2000 in the lipid nanoparticles is 50:38.5:10:1.5.

[0009] Furthermore, the mass ratio of lipid nanoparticles and CAR mRNA was 1:3.

[0010] Furthermore, the nucleic acid sequence of the T7 promoter is shown as SEQ ID NO.1; the nucleic acid sequence of the 5'UTR is shown as SEQ ID NO.2; and the nucleic acid sequence of the 3'UTR is shown as SEQ ID NO.3.

[0011] Furthermore, the nucleic acid sequence of the CD8a signal peptide is shown as SEQ ID NO.4, the nucleic acid sequence of the CD8 hinge region is shown as SEQ ID NO.5, the nucleic acid sequence of the CD28 transmembrane region is shown as SEQ ID NO.6, the nucleic acid sequence of the CD28 co-stimulatory region is shown as SEQ ID NO.7, and the nucleic acid sequence of the CD3ζ intracellular region is shown as SEQ ID NO.8.

[0012] Furthermore, the single-chain antibody variable region includes scFv-VL, scFv-VH and G4S linker, the nucleic acid sequence of the scFv-VL is shown in SEQ ID NO.9, the nucleic acid sequence of the scFv-VH is shown in SEQ ID NO.10, and the nucleic acid sequence of the G4S linker is shown in SEQ ID NO.11.

[0013] Application of a delivery system for in vivo generation of CAR-T cells in the preparation of drugs for treating gastric cancer tumors.

[0014] Beneficial effects of the present invention:

[0015] The present invention is based on CAR sequence optimization, and obtains mRNA sequence through in vitro transcription, capping and tailing, which can translate and express CAR protein targeting CLDN18.2. Through the LNP delivery system, it can encode T cells in situ in vivo to generate CAR-T, thereby realizing the in vivo transformation of T cells into CAR-T cells, providing a novel, convenient and universal implementation scheme for CAR-T therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of the construction of the CAR mRNA sequence in the present invention;

[0017] Figure 2 This is the result of quality scoring of CAR mRNA using Qsep software in the present invention;

[0018] Figure 3 This is a flow cytometric graph of the CAR expression efficiency of T cells transfected by the LNP-mRNA delivery system of the present invention;

[0019] Figure 4 This is a graph showing the killing efficiency of CAR-T cells produced by transfecting T cells with LNP-mRNA in the delivery system of the present invention against NUGC418.2 and NCL-N8718.2;

[0020] Figure 5 This is a curve diagram of the change in tumor size of gastric cancer mice treated by in vivo delivery of CAR mRNA by the delivery system LNP-mRNA of the present invention. DETAILED DESCRIPTION

[0021] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0022] Example 1:

[0023] like Figure 1 Figure 2 shows a schematic diagram of the CAR mRNA sequence construction. The mRNA sequence includes: T7 promoter, 5'UTR, CD8a signal peptide, single-chain antibody variable region, CD8 hinge region, CD28 transmembrane region, CD28 costimulatory region, CD3ζ intracellular region, stop codon, 3'UTR and poly(A) tail.

[0024] The nucleic acid sequence of the T7 promoter is shown in SEQ ID NO.1:

[0025] TAATACGACTCACTATA;

[0026] The nucleic acid sequence of 5'UTR is shown in SEQ ID NO.2:

[0027] GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCG GCGCCGCCAC;

[0028] The nucleic acid sequence of 3'UTR is shown in SEQ ID NO.3:

[0029] GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAG CCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGCCT GAGTAGGAAG;

[0030] The nucleic acid sequence of the CD8a signal peptide is shown in SEQ ID NO.4:

[0031] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTC CACGCCGCCAGGCCG;

[0032] The nucleic acid sequence of the CD8 hinge region is shown in SEQ ID NO.5:

[0033] ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGC GTCGCAGCCCCTGTCCCTGCGCCCAGAGCGTGCCGGCCAGCGGCGGGG GGCGCAGTGCACACGAGGGGGCTGGACTTCGCCTGTGAT;

[0034] The nucleic acid sequence of the CD28 transmembrane region is shown in SEQ ID NO.6:

[0035] TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTG CTAGTAACAGTGGCCTTTATTATTTTCTGGGTG;

[0036] The nucleic acid sequence of the CD28 costimulatory region is shown in SEQ ID NO.7:

[0037] AGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGAC TCCCCGCCGCCCCGGGCCAACCCGCAAGCATTACCAGCCCTATGCCCCACC ACGCGACTTCGCAGCCTATCGCTCC;

[0038] The nucleic acid sequence of the CD3ζ intracellular region is shown in SEQ ID NO.8;

[0039] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAA;

[0040] The nucleic acid sequence of scFv-VL is shown in SEQ ID NO.9:

[0041] GACATCGTGATGACCCAGAGCCCCGACAGCCTGGCCGTGAGCCTGGGCGAGCGGGCCACCATCAACTGCAAGAGCAGCCAGAGCCTGTTCAACAGCGGCAACCAGAAGAACTACCTGACCTGGTACCAGCAGAAGCCCGGCCAGCCCCCCAAGCTGCTGATCTACTGGGCCAGCACCCGGGAGAGCGGCGTGCCCGACCGGTTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGACCATCAGCAGCCTGCAGGCCGAGGACGTGGCCGTGTACTACTGCCAGAACGCCTACAGCTTCCCCTACACCTTCGGCGGCGGCACCAAGCTGGAGATCAAGCGG;

[0042] The nucleic acid sequence of scFv-VH is shown in SEQ ID NO.10:

[0043] CAGGTGCAGCTGCAGGAGAGCGGCCCCGGCCTGATCAAGCCCAGCCAGACCCTGAGCCTGACCTGCACCGTGAGCGGCGGCAGCATCAGCAGCGGCTACAACTGGCACTGGATCCGGCAGCCCCCCGGCAAGGGCCTGGAGTGGATCGGCTACATCCACTACACCGGCAGCACCAAC TACAACCCCGCCCTGCGGAGCCGGGTGACCATCAGCGTGGACACCAGCAAGAACCAGTTCAGCCTGAAGCTGAGCAGCGTGACCGCCGCCGACACCGCCATCTACTACTGCGCCCGGATCTACAACGGCAACAGCTTCCCCTACTGGGGCCAGGGCACCACCGTGACCGTGAGCAGC;

[0044] The nucleic acid sequence of the G4S linker is shown in SEQ ID NO.11:

[0045] GGTGGAGGCGGTTCAGGCGGAGGTGGTTCTGGCGGTGGCGGATCG;

[0046] The stop codon nucleic acid sequence is: TAATGA;

[0047] The nucleic acid sequence of the poly(A) tail is: containing 110nt of adenine A, the first 30 A's are connected by GCATATGACT and the last 80 A's are connected by GCATATGACT.

[0048] AAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

[0049] Example 2: CAR mRNA in vitro transcription, the steps are as follows:

[0050] a) Add ddH2O, Quick CIP, rCut smart, vector, and NcoI enzyme in sequence, and digest the vector at 37°C for 30 minutes and 80°C for 5 minutes.

[0051] b) Based on the target sequence in WO 2018 / 006882 A1, homology arms were designed to perform target fragment PCR, and DNA gel electrophoresis was used to verify whether the PCR product was the target sequence;

[0052] c) Purify the PCR product and enzyme-digested vector using a purification kit (T1130S) and measure the concentration;

[0053] d) Use HiFi DNA Assembly Master Mix (E2621S) was used to perform HiFi ligation between the PCR product and the vector;

[0054] e) Add the ligation product to the competent cells, plate, and select a single clone for sequencing;

[0055] f) The obtained plasmid was linearized using BspQI. After gel electrophoresis confirmed that the digestion was complete, the digestion product was purified using DNA isolation beads (10501-005).

[0056] g) In vitro transcription was performed using the T7 co-transcription capping kit (10111-3011). The resulting RNA product was purified using RNA isolation beads (10511-005) and dissolved in enzyme-free water.

[0057] h) mRNA was quantified by nanodrop and qualitatively analyzed by Qsep, and then stored at -80°C for a long term.

[0058] like Figure 2 As shown, the size of the obtained mRNA fragment is about 1800 kb, which is consistent with the target sequence length.

[0059] Example 2: LNP-encapsulated mRNA preparation experiment and characterization assay

[0060] a) SM102, cholesterol, DSPC, and DMG-PEG2000 were dissolved in anhydrous ethanol at a ratio of 50:38.5:10:1.5 to prepare the organic phase. The required amount of mRNA was calculated based on the positively charged amino group (N) / negatively charged phosphate group (P) ratio of 8. The mRNA was dissolved in sodium citrate solution to prepare the aqueous phase. The organic phase to aqueous phase ratio was 1:3, and the flow rate between the two phases was 1.5 ml / 1.5 min. LNPs were prepared using a microfluidic device.

[0061] b) The prepared LNPs were uniformly dispersed in a sodium citrate solution, gradually replaced with a TBS solution using a 100 kDa ultrafiltration tube, concentrated, and stored at 4°C for a short period of time;

[0062] c) Take LNP to test the encapsulation efficiency, use Quant-iT TM The RiboGreen RNA quantification kit (R11490) was used to calculate the mRNA packaging content;

[0063] d) Another 10 μL of LNP was diluted with 1 mL of TBS solution, and its particle size, potential, and PDI value were measured using a Malvern particle size analyzer.

[0064] The characterization results are shown in Table 1.

[0065] Table 1 LNP-mRNA characterization results

[0066] Particle size (mm) PDI Potential mV Encapsulation efficiency% 157.5 0.155 -5.039 90.08

[0067] From the results in Table 1, it can be seen that LNP-mRNA is nanometer-level, the PDI value is controlled below 0.3, the particle size distribution is uniform, and the encapsulation efficiency is above 90%, which has a good encapsulation efficiency and provides a good foundation for subsequent applications.

[0068] Example 3: Detection of CAR Positive Rate Expression in T Cells Transfected with LNP-mRNA Delivery System

[0069] a) T cell isolation: PBMCs were thawed at 37°C, added to EasySep Buffer, and centrifuged at 500xg for 8 minutes, 5 steps up and 5 steps down. Counted. Resuspended to 5E7 / mL, Isolation Cocktail added to the sample, mixed, and incubated at room temperature for 5 minutes. RapidSpheres were added to the sample and mixed, and the tube was placed on a magnetic stand and incubated at room temperature for 10 minutes. Carefully pipette the enriched cell suspension into a new centrifuge tube. Remove the tube from the magnet, add 4 ml of fresh EasySep Buffer, and incubate for another 5 minutes for a second round of isolation. Wash the cells with 1640 complete medium, count by centrifugation, and adjust the cell density to 1E6 / mL using 1640 complete medium. Activation beads were added at a rate of 12.5 μL per 1E6 cell. The cells were activated in a CO2 incubator for 48 hours before use. (T cell isolation kit purchased from StemCell)

[0070] b) After quantification of the CAR mRNA-encapsulated LNPs, 1 μg / 1E5 T cells were dosed. Before addition to the cells, the LNPs were concentrated using an ultrafiltration tube and replaced in 1640 culture medium. After incubation for 4 hours, the CAR positivity rate was detected by flow cytometry.

[0071] The results are as follows Figure 3 As shown in the figure, after adding LNPs encapsulating CAR mRNA, the positive rate of CAR protein was 57.6% compared with the control group, indicating that LNPs successfully transfected T cells to prepare CAR-T.

[0072] Example 4: The killing efficiency of CAR-T cells produced by transfecting T cells with LNP-mRNA delivery system against NUGC4 18.2 and NCL-N87 18.2

[0073] a) One day in advance, adjust the density of NUGC4 18.2 and NCL-N87 18.2 tumor cells to 5E4 cells / ml, plate in 96-well plates, add 100 μL / well (5E3 cells / well), and incubate in a 37°C incubator.

[0074] b) After 48 hours of T cell sorting and activation, LNPs were added and incubated for 4 hours to detect the CAR positive rate by flow cytometry;

[0075] c) CAR-T cells and naive T cells were collected and added to a 96-well plate. CAR-T cells or naive T cells were added (100 μL / well) according to different effector-target ratios (CAR+:tumor) and incubated in a 37°C incubator.

[0076] d) After 24 hours of incubation, centrifuge the cell culture plate at 300 x g for 5 minutes and collect 100 μL / well of the cell supernatant into another 96-well plate. This can be frozen at -80°C for subsequent analysis of IL-2 release.

[0077] e) Detect Luciferase signal in the remaining cell fluid: Dilute the substrate 50-fold with detection buffer, add 50 μL / well, incubate in the dark at room temperature for 5 min, transfer 80 μL to a 96-well opaque white plate, and read the luminescence.

[0078] The results are as follows Figure 4 As shown in the results, LNP-mediated CAR-T cells had a significant killing effect on NUGC4 18.2 and NCL N87 18.2 gastric cancer cells in vitro compared with T cells, and the killing rate of the effector-target ratio of 5:1 to 1:3 was greater than 50%.

[0079] Example 5: LNP-mRNA in vivo delivery of CAR mRNA for the treatment of gastric cancer in mice

[0080] a) NSG mouse model establishment: 6-8 week-old female NSG mice were purchased from Nanmo. After one week of acclimatization, 5E6 NUGC4 cells (100 μL) were injected subcutaneously into the axilla of each mouse. The tumor size was measured daily until it grew to 100 mm3.

[0081] b) Three different dosing groups (10 μg, 20 μg, and 40 μg) were set up, and LNPs and T cells were injected into the tail vein of each mouse with 100 μL, once every two days, for a total of four doses;

[0082] c) The tumor sizes of mice were measured every other day.

[0083] The results are as follows Figure 5 As shown, in the NUGC4 mouse model, the LNP-CAR-T cell injection group showed an inhibitory effect on tumor growth compared with the PBS injection group within 0-14 days. The tumor volume ratios of the three concentration treatment groups and the PBS group were P values ​​<0.01, which were statistically significant.

Claims

1. A delivery system for in vivo generation of CAR-T cells, characterized by: The invention comprises lipid nanoparticles and CAR mRNA wrapped by the lipid nanoparticles, wherein the lipid nanoparticles contain peptidyl phospholipid SM102, cholesterol, dipalmitoylphosphatidylcholine DSPC and dimyristoylglycerol-polyethylene glycol 2000DMG-PEG2000, and the target protein encoded by the CAR mRNA is CLDN18.

2.

2. The delivery system for in vivo generation of CAR-T cells according to claim 1, characterized in that: The sequence of the CAR mRNA includes: T7 promoter, 5'UTR, CD8a signal peptide, single-chain antibody variable region, CD8 hinge region, CD28 transmembrane region, CD28 costimulatory region, CD3ζ intracellular region, stop codon, 3'UTR and poly (A) tail.

3. The delivery system for in vivo generation of CAR-T cells according to claim 1, wherein: The molar ratio of peptidyl phospholipid SM102, cholesterol, dipalmitoylphosphatidylcholine DSPC and dimyristoylglycerol-polyethylene glycol 2000DMG-PEG2000 in the lipid nanoparticles is 50:38.5:10:1.

5.

4. The delivery system for in vivo generation of CAR-T cells according to claim 1, wherein: The mass ratio of lipid nanoparticles and CAR mRNA was 1:

3.

5. The delivery system for in vivo generation of CAR-T cells according to claim 2, wherein: The nucleic acid sequence of the T7 promoter is shown in SEQ ID NO.1; the nucleic acid sequence of the 5'UTR is shown in SEQ ID NO.2; and the nucleic acid sequence of the 3'UTR is shown in SEQ ID NO.

3.

6. The delivery system for in vivo generation of CAR-T cells according to claim 5, characterized in that: The nucleic acid sequence of the CD8a signal peptide is shown in SEQ ID NO.4, the nucleic acid sequence of the CD8 hinge region is shown in SEQ ID NO.5, the nucleic acid sequence of the CD28 transmembrane region is shown in SEQ ID NO.6, the nucleic acid sequence of the CD28 co-stimulatory region is shown in SEQ ID NO.7, and the nucleic acid sequence of the CD3ζ intracellular region is shown in SEQ ID NO.

8.

7. The delivery system for in vivo generation of CAR-T cells according to claim 6, characterized in that: The single-chain antibody variable region includes scFv-VL, scFv-VH and G4S linker, the nucleic acid sequence of the scFv-VL is shown in SEQ ID NO.9, the nucleic acid sequence of the scFv-VH is shown in SEQ ID NO.10, and the nucleic acid sequence of the G4S linker is shown in SEQ ID NO.

11.

8. Use of the delivery system for in vivo generation of CAR-T cells according to any one of claims 1 to 7 in the preparation of a drug for treating gastric cancer.

Images