A method of modifying a recombinant mytilus mucus structure
By leveraging the synergistic effect of chemical oxidants and reinforcing agents, the problem of low tyrosine modification efficiency of recombinant mussel adhesive protein was solved, achieving high-efficiency adhesion performance and adhesion strength, making it suitable for the biomedical field.
Patent Information
- Application Number
- CN202510944217.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-09
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2045-07-09
AI Technical Summary
In existing technologies, the tyrosine modification method for recombinant mussel adhesive protein is costly and the enzyme is easily inactivated, while the chemical modification method has low reaction efficiency and insufficient adhesion performance, making it difficult to achieve high-efficiency adhesion performance.
By employing the synergistic effect of chemical oxidants (such as potassium permanganate) and enhancers (such as urea and manganese dioxide), the tertiary structure of mussel adhesive proteins is disrupted, exposing active sites, and tyrosine hydroxylation and DOPA quinone crosslinking are carried out to form a highly efficient adhesion network.
It significantly improves the efficiency of modification reaction and adhesion strength, realizes highly selective oxidation and cross-linking of mucin, meets the needs of high-end applications such as medical devices, and simplifies the process without the risk of biological contamination.
Smart Images

Figure CN120699121B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a method for modifying the structure of recombinant mussel adhesive protein. Background Technology
[0002] Mussel adhesive proteins are waterproof, biocompatible, and biodegradable bioadhesive substances secreted by mussels, marine organisms that adhere to surfaces. They promote cell adhesion and crawling, accelerate wound healing, provide broad-spectrum adhesion, and form a water-resistant protective film, making them applicable in cosmetics, biomedicine, and other fields. Mefp-5 is one such small-molecule adhesive protein that plays a major adhesive role. Its amino acid sequence contains a large number of tyrosine residues that can be oxidized to the amino acid 3,4-dihydroxy-L-phenylalanine (DOPA), and DOPA is key to its interfacial adhesion properties.
[0003] The natural abundance of Mefp-5 in mussels is low, extraction processes result in significant losses, and the extraction methods used are highly toxic. Artificial synthesis, on the other hand, easily produces unremovable and harmful byproducts, and the resulting adhesive strength is lower than that of natural mussel adhesive protein. In contrast, obtaining mussel protein through genetic engineering offers advantages such as environmental friendliness, high purity, large yield, and lower cost. Therefore, developing a method for preparing recombinant mussel adhesive protein Mefp-5 using genetically engineered bacteria has significant application value.
[0004] The adhesive strength of mussel adhesive protein depends on the content of DOPA. Recombinant mussel adhesive protein expressed through genetic engineering is usually non-adhesive or has very low adhesiveness. It requires modification of tyrosine residues in the recombinant protein to produce an adhesive protein. Tyrosine modification of mussel adhesive protein has always been a difficult problem. Currently, tyrosinase is commonly used for bio-oxidative modification of tyrosine residues, but this faces problems such as high cost, easy enzyme inactivation, and how to remove the added modifying enzyme. Chemical modification methods (such as the modifying agents described in CN103520766A, such as permanganate and iodine) can avoid enzyme residues, but their reaction efficiency and modification rate are usually low. To achieve effective adhesion performance, the reaction is often carried out under high-concentration oxidant conditions. However, high-concentration oxidants accelerate the DOPA quinone conversion rate, leading to excessive protein cross-linking and a decrease in adhesion performance. Furthermore, relying solely on oxidants is insufficient to achieve sufficient modification of protein sites; therefore, compared to enzymatic modification methods, the resulting adhesion performance is often weaker. Summary of the Invention
[0005] To address the problems mentioned in the background section, this invention provides a method for modifying the structure of recombinant mussel adhesive protein.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method for modifying the structure of recombinant mussel adhesive protein includes the following steps:
[0008] S1. After optimizing the mussel adhesive protein gene sequence, it was cloned into an expression vector to construct a recombinant plasmid;
[0009] S2. The recombinant plasmid was transformed into competent cells and cultured to obtain engineered bacteria;
[0010] S3. The engineered bacteria are cultured and fermented, the bacterial cells are collected by centrifugation, the bacterial cells are broken up by adding a lysate, the eluent is purified and collected, and dialyzed to obtain a dialysate containing non-adhesive recombinant mussel adhesive protein.
[0011] S4. Chemical modifiers and enhancers are added to the dialysis solution containing non-adhesive recombinant mussel adhesive protein for reaction to obtain highly adhesive recombinant mussel adhesive protein.
[0012] Preferably, in step S1, the optimized mussel adhesive protein gene sequence is shown in SEQ ID NO:1:
[0013] SEQ ID NO:1
[0014] AGCAGCGAGG AATACAAAGG CGGTTACTAT CCGGGCAACA CTTATCATTA CCACTCCGGTGGCTCCTACC ATGGTTCTGG CTACCACGGT GGCTATAAGG GTAAGTACTA TGGTAAAGCG AAAAAGTACTACTACAAATA CAAGAACAGC GGCAAGTACA AATATCTGAA AAAGGCGCGC AAATATCACC GCAAAGGCTATAAGAAATAC TACGGCGGTG GTTCTAGC.
[0015] Preferably, in step S1, the expression vector is pET22b(+), which carries an Ampicillin resistance marker and includes a T7 promoter, a signal peptide coding sequence, and a C-terminal 6×His tag functional module.
[0016] Preferably, in step S2, the method for transforming the recombinant plasmid into competent cells is the heat shock method, specifically: take the recombinant plasmid and add it to Transetta(DE3) competent cells, put it in an ice bath, heat shock, put it in an ice bath, add LB medium and shake to culture, and spread the transformed bacterial solution on LB agar plates containing Ampicillin for culture.
[0017] Preferably, in step S3, the fermentation conditions for the engineered bacteria are as follows: the fermentation medium is LB medium containing Ampicillin (50 μg / mL), the fermentation temperature is 37℃, the rotation speed is 500-800 rpm, the IPTG induction concentration is 0.5 mM, the dissolved oxygen is 40%-60%, and the fermentation time is 36-42 h.
[0018] Preferably, in step S3, the composition of the lysis solution is: 20-30 mM Tris-HCl, 400-600 mM NaCl, 0.05-0.15 mM EDTA, pH 7-8.
[0019] Preferably, in step S3, the conditions for rupturing the bacterial cells are: 3-5℃, pressure 100-1500 bar, rupture 2-4 times, 5000-15000 rpm, centrifugation for 5-15 min to collect the supernatant.
[0020] Preferably, in step S4, the chemical oxidant is selected from any one or more of permanganate, chlorate, perchlorate, peroxide, nitrate, Br2, I2, and S8.
[0021] Preferably, in step S4, the reinforcing agent includes a denaturant and a catalyst. The denaturant is selected from any one of urea, guanidine hydrochloride, and guanidine isothiocyanate; the catalyst is selected from any one of manganese dioxide, copper oxide, vanadate, titanium dioxide, and zinc oxide.
[0022] Preferably, the mussel adhesive protein is any one of Mefp-1, Mefp-3, Mefp-5, and Mefp-6.
[0023] This invention modifies non-adhesive recombinant mussel adhesive protein using chemical oxidants (such as potassium permanganate) and enhancers (such as urea + manganese dioxide). The possible mechanisms are as follows: (1) Structure exposure and activation: Urea in the enhancer destroys the tertiary structure of mussel adhesive protein, causing its molecular chain to unfold and expose the originally embedded active sites (such as tyrosine residues), significantly improving the accessibility of the modification reaction; at the same time, urea, as a denaturant, reduces the intermolecular interaction energy of the system and works with manganese dioxide to reduce the activation energy of the reaction, thereby overcoming the technical defects of low reaction efficiency and insufficient site modification in traditional chemical modification methods. (2) Precursor conversion: Potassium permanganate (KMnO4) hydroxylates the exposed tyrosine (Tyr) benzene ring to generate dopa (DOPA) with adhesive activity, supplementing the key functional groups of the adhesive protein. (3) Cross-linking and curing: The catechol groups of DOPA are further oxidized to o-quinone, and a three-dimensional cross-linking network is formed through covalent bonds (such as Michael addition and Schiff base reaction) or non-covalent interactions (such as π-π stacking). This process is accompanied by protein conformation adjustment and surface charge neutralization, which ultimately simulates the natural oxidation and curing mechanism of mussel adhesive protein, giving the material significant adhesion strength, water resistance and degradation resistance.
[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0025] This invention provides a novel chemical modification method for recombinant mussel adhesive protein. Through the synergistic effect of highly selective oxidants and enhancers, it solves the core problems of low reaction efficiency and insufficient site modification in traditional techniques. Specific advantages are as follows:
[0026] 1. Breakthrough Improvement in Reaction Efficiency and Modification Rate: Traditional chemical modification methods suffer from low reaction efficiency and insufficient modification of active sites (such as Tyr / DOPA) due to protein structure obscuring and energy barrier limitations. This invention uses an enhancer (such as urea + manganese dioxide) to unfold the tertiary structure of mucin, fully exposing active sites, and works synergistically with an oxidant (such as KMnO4) to lower the reaction activation energy, achieving highly efficient simultaneous completion of tyrosine hydroxylation (Tyr→DOPA) and DOPA quinone crosslinking. This is more than 7 times more efficient than traditional chemical methods and even surpasses the efficiency of enzymatic modification.
[0027] 2. Environmentally friendly and simplified process: It abandons the dependence of traditional enzymatic methods on tyrosinase and uses chemical oxidants and enhancers to construct the reaction system, avoiding the instability of exogenous enzyme protein activity, harsh reaction conditions and enzyme residue separation problems. The process has strong compatibility and no risk of biological pollution.
[0028] 3. Product purity advantage: No need to introduce or remove exogenous proteins throughout the process, the resulting mucin has a single component and a well-defined structure, meeting the needs of high-end applications such as medical devices.
[0029] 4. Industrial adaptability: The reaction system is compatible with continuous flow processes and has the potential for large-scale production, providing an efficient and controllable solution for applications in fields such as biomedical adhesives and marine anti-corrosion coatings. Attached Figure Description
[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0031] Figure 1 Carrier construction map.
[0032] Figure 2 Enzyme digestion identification results.
[0033] Figure 3 WB test results;
[0034] Lane M represents the protein marker, lane 1 represents the induced 0-point bacterial-like protein, and lanes 2 and 3 represent the induced bacterial-like protein.
[0035] Figure 4 Coomassie Brilliant Blue test results;
[0036] Lane M represents the protein marker, lane 1 is the unpurified sample, lane 2 is the flow-through sample, lanes 3-6 are the washed samples, and lanes 7-8 are the eluted samples.
[0037] Figure 5 Protein adhesion test results;
[0038] Wherein, 1 and 5 are unmodified Mefp-5 eluent samples from Example 3; 2 is the tyrosinase-modified Mefp-5 sample from Comparative Example 1; 3 is the iodine-modified Mefp-5 sample from Comparative Example 2; 4 is the Mefp-5 sample co-modified with oxidant and enhancer from Example 4; 6 is the tyrosinase control sample; 7 is the iodine control sample; and 8 is the oxidant and enhancer control sample. The Mefp-5 protein content in all samples is 1 mg / mL.
[0039] Figure 6 Standard curve for determining DOPA content using the NBT / potassium glycine staining method.
[0040] Figure 7 Results of DOPA content determination after protein modification;
[0041] M5 represents unmodified Mefp-5 protein, M5-1 represents the tyrosinase-modified Mefp-5 sample from Comparative Example 1, M5-2 represents the iodine-modified Mefp-5 sample from Comparative Example 2, and M5-3 represents the Mefp-5 sample co-modified with oxidant and enhancer from Example 4. The Mefp-5 protein content in all samples was 1 mg / mL. Detailed Implementation
[0042] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0043] Unless otherwise stated, all raw materials and reagents used in this invention are commercially available or can be prepared by known methods.
[0044] Example 1: Construction of the expression vector for mussel adhesive protein Mefp-5
[0045] Gene design and plasmid construction: Based on the mussel adhesive protein Mefp-5 sequence (accession number: AAL35297.1) in GenBank, the N-terminal signal peptide (amino acids 1-18) was removed, and a mature peptide coding sequence (amino acids 19-102) was designed and optimized using E. coli preferred codons. The optimized gene sequence (SEQ ID NO:1) was cloned into the expression vector pET22b(+) to construct the recombinant plasmid pET22b(+)-M5. The vector carries an Ampicillin resistance marker and contains a T7 promoter, a signal peptide coding sequence, and a C-terminal 6×His tag functional module for efficient expression and purification of the target protein.
[0046] The Mefp-5 gene fragment was inserted by double digestion with NdeI and XhoI, replacing the XhoI (158) region with the NdeI (288) region to ensure correct integration of the Mefp-5 gene into the vector. The plasmid construction was outsourced to Nanjing GenScript Biotech Co., Ltd. The vector construction image is shown below. Figure 1 As shown.
[0047] (2) Transformation and screening: The constructed recombinant plasmid pET22b(+)-M5 was transformed into Transetta(DE3) competent cells (purchased from TransGen Biotech) using the heat shock method. The specific steps are as follows: 1 μL of recombinant plasmid was added to 50 μL of Transetta(DE3) competent cells and incubated on ice for 30 minutes. Heat shock was performed at 42℃ for 90 seconds, followed by immediate ice incubation for 2 minutes; 500 μL of LB medium was added and cultured at 37℃ with shaking for 1 hour; the transformed bacterial culture was spread on LB agar plates containing Ampicillin (50 μg / mL) and cultured at 37℃ for 14 hours. Single colonies were picked and inoculated into LB liquid medium containing Ampicillin (50 μg / mL) and cultured at 37℃ with shaking for 12 hours for subsequent verification experiments.
[0048] (3) Positive clone verification: The recombinant plasmid was extracted and double-digested with MluI and XhoI. The digestion products were analyzed by agarose gel electrophoresis and compared with KB Ladder DNA molecular weight standards. Different sizes of DNA fragments migrate at different speeds in an electric field. By comparing with the standards, it can be determined whether the size of the band after digestion is consistent with the expectation. The recombinant plasmid was extracted and the correctness of the inserted sequence (SEQ ID NO:1) was verified by double digestion and sequencing. The agarose gel electrophoresis results are as follows. Figure 2 The results showed that the bands after enzyme digestion were the same size as expected, indicating that the inserted sequence was correct.
[0049] (4) Preservation of engineered bacteria: The verified strain was named Transetta pet22b(+)_GS-M5, mixed with 50% glycerol and stored at -80℃ for a long time.
[0050] Example 2: Expression and identification of mussel adhesive protein Mefp-5.
[0051] Activated Transetta pet22b(+)_GS-M5 was inoculated into LB medium containing 50 g / mL Ampicillin. The fermentation temperature was 37 °C, the rotation speed was 500-800 rpm, the IPTG induction concentration was 0.5 mM, the dissolved oxygen was 50%, and the fermentation time was 40 h. The fermentation broth was centrifuged at 9000 rpm for 10 min, the supernatant was discarded, and the bacterial pellet was washed three times with PBS. After centrifugation under the same conditions, the bacterial cells were collected and resuspended in PBS. The mussel adhesive protein Mefp-5 expressed after induction was labeled with a purification tag (6×His).
[0052] Western blot (WB) assays were performed on induced 0-point and post-induced bacterial-like proteins using a Tricine-SDS-PAGE electrophoresis system. The primary antibody was ProteinFind Anti-His Mouse Monoclonal Antibody, and the secondary antibody was ProteinFind Goat Anti-Mouse IgG (H+L). The WB results are shown below. Figure 3 As shown in the figure. The results indicate that the Mefp-5 protein is located between 7 kDa and 16 kDa, close to the 16 kDa position.
[0053] Example 3: Purification and identification of mussel adhesive protein Mefp-5.
[0054] The collected bacterial cells were resuspended in a 1:10 (g / mL) lysis buffer (25 mM Tris-HCl, 500 mM NaCl, 0.1 mM EDTA, pH 7.5). The lysis conditions were 4°C, 1200 bar, 3 cycles, followed by centrifugation at 9000 rpm for 10 min to collect the supernatant. The supernatant was passed through a Ni-nickel column at a flow rate of 2 cm / min. The washing buffer consisted of 10 mM imidazole, 300 mM sodium chloride, and 20 mM pH 8.0 Tris-HCl; the elution buffer consisted of 300 mM imidazole, 300 mM sodium chloride, and 20 mM pH 8.0 Tris-HCl at a flow rate of 2 cm / min.
[0055] After collecting and purifying samples from each step, protein electrophoresis was performed using a Tricine-SDS-PAGE system. After electrophoresis, the protein gel was removed and stained with Coomassie Brilliant Blue. After destaining, the protein bands were observed. Figure 4 As shown, the results indicate that the position of the purified Mefp-5 protein band is the same as that of the Mefp-5 protein during WB identification.
[0056] Example 4: Method for modifying the structure of mussel adhesive protein Mefp-5
[0057] Take the eluent obtained in Example 3, place it in a dialysis bag with a 1 kDa cutoff, and dialyze overnight at 4°C. The dialysate used is 20 mM, pH 4.5 sodium acetate buffer. The ratio of dialysis sample to dialysate is 1:100, and the dialysate is changed twice.
[0058] Collect the dialysate and place it in a reaction vessel. Add urea to a final concentration of 4M, potassium permanganate to a final concentration of 10 mM, and MnO2 to a final concentration of 0.1 mM. Adjust the pH to 4.5 and maintain the reaction for 12 hours at a controlled temperature of 4°C. After the reaction is complete, filter out the MnO2 using a 0.22 μm filter membrane. Then, place the reaction solution in a 1 kDa dialysis bag and dialyze overnight at 4°C using 20 mM, pH 4.5 sodium acetate buffer. Dialyze to remove potassium permanganate and urea. Repeat the dialysis process twice to obtain functional mussel adhesive protein. Example 5
[0059] The difference between this embodiment and embodiment 4 is that potassium chlorate is added, and the final concentration is 10mM. The rest is exactly the same as in embodiment 1. Example 6
[0060] The difference between this embodiment and embodiment 4 is that hydrogen peroxide is added to a final concentration of 10 mM, while the rest is exactly the same as in embodiment 1. Example 7
[0061] The difference between this embodiment and Example 4 is that the reinforcing agent is 4M guanidine hydrochloride and 0.1mM copper oxide, while the rest is exactly the same as in Example 1. Example 8
[0062] The difference between this embodiment and Example 4 is that the reinforcing agent is 4M guanidine isothiocyanate and 0.1mM titanium dioxide, while the rest is exactly the same as in Example 1.
[0063] Comparative Example 1: Method for modifying the tyrosinase of the mussel adhesive protein Mefp-5
[0064] Take the eluent obtained in Example 3, place it in a dialysis bag with a 1 kDa cutoff, and dialyze overnight at 4°C. The dialysate used is 20 mM, pH 4.5 sodium acetate buffer. The ratio of dialysis sample to dialysate is 1:100, and the dialysate is changed twice.
[0065] Collect the dialysate, add tyrosinase solution to a final concentration of 50 U / mL; then add CuSO4 solution to a final concentration of 2 mM, maintain for 3 h, control the reaction temperature at 37℃, and finally obtain functional mussel adhesive protein.
[0066] Comparative Example 2: Method for modifying mussel adhesive protein Mefp-5 with oxidants
[0067] Take the eluent obtained in Example 3, put the eluent into a dialysis bag with a retention capacity of 1 kDa, and dialyze it overnight at 4°C. The ratio of dialysis sample to dialysis solution is 1:100, and the dialysis solution is changed twice.
[0068] As described in Example 3 of CN103520766A, the dialysate was collected and placed in a reaction vessel. A 10% (mass percentage) iodine solution was added, following a 1 mg / mL Mefp-5 addition of 2% total volume iodine solution system. After thorough mixing, the mixture was kept at 4°C for 12 h. After the reaction was complete, the reaction solution was placed in a 1 kDa dialysis bag and dialyzed overnight at 4°C. The dialysate was 20 mM, pH 4.5 sodium acetate buffer. The iodine solution was removed by dialysis. This process was repeated twice to obtain functional mussel adhesive protein.
[0069] Results and Detection
[0070] Protein Adhesion Detection
[0071] Take 2 μL of the samples obtained in Example 4, Comparative Example 1, and Comparative Example 2 and place them on a 0.2 μm nitrocellulose membrane (NC membrane), marking the sample position. After the sample is absorbed by the NC membrane, place the NC membrane containing the sample in a 500 mL beaker, add 300 mL of pure water, and sonicate for 10 min. Remove the NC membrane and place it in a petri dish, add NBT staining solution, and stain in the dark for 45 min. The NBT staining solution is prepared by dissolving 9 mg of NBT in 15 mL of glycine-potassium buffer, mixing well, and preparing fresh before use. The glycine-potassium buffer is prepared by dissolving 75 g of glycine in 400 mL of water, adjusting the pH to 10 with solid KOH, adding water to a final volume of 500 mL, and storing at 4 °C. After staining, remove the NC membrane, rinse twice with sodium borate solution, store in sodium borate solution overnight, and then rinse three times with pure water. The sodium borate solution is prepared by dissolving 2.5 g of sodium borate decahydrate in 40 mL of water, and sonicating at 40 °C. Blue-purple spots were observed at the marked areas of the samples. The results for Examples 4, 1, and 2 are as follows. Figure 5 As shown, Figure 5 As can be seen, spots 1 and 5 are the unmodified Mefp-5 eluent samples from Example 3, indicating that unmodified Mefp-5 is colorless. Modified Mefp-5 (spots 2, 3, and 4) all show significant color development, with the strongest color development observed in Mefp-5 co-modified with oxidant and enhancer (spot 4), and the weakest color development observed in iodine-modified Mefp-5 (spot 3). In the negative controls (spots 6, 7, and 8), only the tyrosinase control sample (spot 6) shows weak color development; the other controls show no color development. This indicates that the color development of tyrosinase-modified Mefp-5 is affected by weak background interference, while iodine-modified Mefp-5 and oxidant-enhancer-modified Mefp-5 show no background interference. The adhesion results show that the adhesion of oxidant-enhancer-modified Mefp-5 is significantly stronger than that of tyrosinase-modified Mefp-5 and iodine-modified Mefp-5.
[0072] Protein Dopa Content Determination
[0073] The NBT / potassium glycinate staining method (0.24 mM NBT, 2 M potassium glycinate, pH 10) was used. 0, 2, 4, 8, 16, and 20 μL of DOPA standard (1 μg / mL) were added to six labeled wells of a 96-well plate, and the final volume of each well was adjusted to 20 μL with ultrapure water. 180 μL of NBT / potassium glycinate solution was then added. Samples obtained in Example 4 and Comparative Example 1 were repeated in the NBT / potassium glycinate solution. The reaction was carried out at 25 °C in the dark for 1 h, and the absorbance at 530 nm was measured using a microplate reader. A standard curve was constructed based on the DOPA series solutions, and the DOPA content of the samples was calculated based on the measured absorbance of the sample solutions.
[0074] Standard curve such as Figure 6 As shown, the sample results of Example 4, Comparative Example 1, and Comparative Example 2 are as follows. Figure 7 As shown, the DOPA content of Mefp-5 increased significantly after modification. Specifically, the DOPA content after tyrosinase modification was 0.768±0.046 μg / mL, the DOPA content after iodine modification was 0.272±0.034 μg / mL, the DOPA content after co-modification with oxidant and enhancer was 2.157±0.139 μg / mL, and the DOPA content of unmodified Mefp-5 was 0.039±0.010 μg / mL. The DOPA content of Mefp-5 after tyrosinase modification increased by 19.8 times compared with that of unmodified Mefp-5, the DOPA content after iodine modification increased by 7 times, and the DOPA content after co-modification with oxidant and enhancer increased by 55.7 times. That is, the DOPA content of Mefp-5 after tyrosinase modification and iodine modification is much lower than that after co-modification with oxidant and enhancer.
[0075] SEQ ID NO:1
[0076] AGCAGCGAGG AATACAAAGG CGGTTACTAT CCGGGCAACA CTTATCATTA CCACTCCGGTGGCTCCTACC ATGGTTCTGG CTACCACGGT GGCTATAAGG GTAAGTACTA TGGTAAAGCG AAAAAGTACTACTACAAATA CAAGAACAGC GGCAAGTACA AATATCTGAA AAAGGCGCGC AAATATCACC GCAAAGGCTATAAGAAATAC TACGGCGGTG GTTCTAGC.
[0077] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. A method of modifying a recombinant Mytilus mussels' mucus structure, characterized in that, The method comprises the following steps: S1. After optimizing the gene sequence of mussel mucin, the sequence is cloned into an expression vector to construct a recombinant plasmid; S2. The recombinant plasmid is transformed into a competent cell, and the cell is cultured to obtain an engineering bacterium; S3. The engineering bacterium is cultured and fermented, and the bacterial body is collected by centrifugation, the bacterial body is broken by a bacterial breaking solution, the eluate is collected, dialysis is performed, and a dialysate containing the recombinant mussel mucin without adhesion is obtained; S4. A chemical oxidant and an enhancer are added into the dialysate containing the recombinant mussel mucin without adhesion to perform a reaction, and the recombinant mussel mucin with high adhesion is obtained; In the step S1, the optimized gene sequence of mussel mucin is shown in SEQ ID NO: 1: SEQ ID NO: 1 AGCAGCGAGG AATACAAAGG CGGTTACTAT CCGGGCAACA CTTATCATTA CCACTCCGGTGGCTCCTACC ATGGTTCTGG CTACCACGGT GGCTATAAGG GTAAGTACTA TGGTAAAGCG AAAAAGTACTACTACAAATA CAAGAACAGC GGCAAGTACA AATATCTGAA AAAGGCGCGC AAATATCACC GCAAAGGCTATAAGAAATAC TACGGCGGTG GTTCTAGC; The chemical oxidant is potassium permanganate, the enhancer comprises urea and manganese dioxide, and the ratio of the potassium permanganate, the urea and the manganese dioxide is 4M:10mM:0.1mM.
2. The method of claim 1, wherein the recombinant Mytilus mullusc glycoprotein structure is modified by, In the step S3, the bacterial breaking solution comprises 20-30mM Tris-HCl, 400-600mM NaCl and 0.05-0.15mM EDTA, and has a pH of 7-8.
3. The method of claim 1, wherein the recombinant Mytilus mullusc glycoprotein structure is modified by, In the step S3, the bacterial body is broken under the following conditions: 3-5℃, a pressure of 100-1500 bar, 2-4 times of breaking, 5000-15000rpm, and centrifugal collection of supernatant for 5-15min.
Citation Information
Patent Citations
Method for preparing composite protein adhesive
CN102965070A
Mussel mucoprotein liquid product as well as preparation method and application thereof
CN103520766A