Use of pyrazole anthrones as analogs of strigolactones

Abstract

The application discloses application of pyrazole anthrone in strigolactone analogues. The pyrazole anthrone in the scheme can be used as a strigolactone analogue to regulate the length of a hypocotyl of a plant, promote the expression of a key inhibitor of a strigolactone signal transduction pathway SMXL2 , SMXL6 , SMXL7 , SMXL8 , increase the length and quantity of root hairs, and regulate the growth and development of the plant, and has similar effects to the strigolactone analogue pyrazole anthrone; the pyrazole anthrone is low in price, can be applied to various plants, has little environmental pollution, and can be applied on a large scale in agricultural production.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, and particularly relates to application of pyrazole anthrone as strigolactone analog. BACKGROUND

[0002] Strigolactones (SLs) are carotenoid-derived plant hormone signaling molecules, belonging to the class of small molecule compounds of isoprenoids. A typical SL is composed of a tricyclic lactone known as the ABC ring, which is connected to a butenolide ring D ring through an enol ether bridge, forming a stable four-ring structure. According to the stereochemical characteristics of the B ring and C ring connection site, the part connected to the D ring always maintains a 2’R configuration. This enol ether bridge and D ring in 2’R configuration are essential structural elements for the biological activity of SL. There are two different configurations between the B ring and the C ring, which have derived two distinct SL families. One is called orobanchol family, and the B ring and C ring of SL are similar to the structure of (+)-orobanchol. The other is called strigol family, and the B ring and C ring are the same as the stereostructure of (+)-strigol.

[0003] At present, artificial synthetic analogs of SLs have high synthesis cost, low efficiency, and many other problems such as biochemical safety and chemical stability. Therefore, the related application of SLs has been limited to basic research in the laboratory, and has not been put into actual production activities. Therefore, it is urgent to find new SL analogs. SUMMARY

[0004] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes the application of pyrazole anthrone as a strigolactone analog.

[0005] The present application also proposes a method for regulating the length of the hypocotyl of a plant.

[0006] The present application also proposes a method for regulating the length and / or number of root hairs of a plant.

[0007] According to the first aspect of the present application, the application of pyrazole anthrone as a strigolactone analog is proposed in any one of the following:

[0008] (1) regulating the length of the hypocotyl of a plant;

[0009] (2) regulating the length and / or number of root hairs of a plant;

[0010] (3) regulating the growth and development of a plant;

[0011] (4) regulating the SL signal transduction pathway;

[0012] (5) regulating the strigolactone signal pathway geneSMXL2 、 SMXL6 、 SMXL7 、 SMXL8 expression of the gene;

[0013] (6) inducing SMXL7 ubiquitination and degradation.

[0014] In some embodiments of the present application, the pyrazole anthrones affect the SL signal transduction pathway by binding to the receptors D14 as analogs of strigolactones.

[0015] In some embodiments of the present application, the regulating the growth and development of the plant comprises regulating the growth and development of the hypocotyl and the root of the plant.

[0016] In some embodiments of the present application, the regulating the growth and development of the plant comprises up-regulating ARF1 、 WOX11 、 ATF1 、 ATF2 the expression amount of the gene; down-regulating SAUR29 、 SAUR15 、 SAUR20 、 SAUR24 、 SAUR26 、 SAUR68 、 PIF4 the expression amount of the gene.

[0017] In some embodiments of the present application, the regulating the expression of the strigolactone signal pathway gene SMXL2 、 SMXL6 、 SMXL7 、 SMXL8 comprises up-regulating the expression amount of the strigolactone signal pathway gene SMXL2 、 SMXL6 、 SMXL7 、 SMXL8 .

[0018] In some embodiments of the present application, the regulating the hypocotyl length of the plant comprises inhibiting the elongation of the hypocotyl of the plant.

[0019] In some embodiments of the present application, the plant comprises a Brassicaceae plant.

[0020] In some embodiments of the present application, the Brassicaceae plant comprises Arabidopsis thaliana.

[0021] According to a second aspect of the present application, a method for regulating the hypocotyl length of a plant is provided, the method comprising the following steps: planting a seed of the plant in a culture reagent containing a pyrazole anthrone, and culturing.

[0022] In some embodiments of the present application, the concentration of pyrazole anthrones in the culture reagent is 1-10 µM. Specifically, it can be 1 µM, 2 µM, 3 µM, 4 µM, 5 µM, 6 µM, 7 µM, 8 µM, 9 µM, 10 µM.

[0023] In some embodiments of the present application, the step of culturing comprises vernalization.

[0024] In some embodiments of the present application, the plant comprises a Brassicaceae plant.

[0025] In some embodiments of the present application, the Brassicaceae plant comprises Arabidopsis thaliana.

[0026] According to a third aspect of the present application, a method for regulating the length and / or number of root hairs of a plant is provided, the method comprising the steps of: sowing a seed of a plant in a culture reagent containing pyrazole anthrones, and culturing.

[0027] In some embodiments of the present application, the concentration of pyrazole anthrones in the culture reagent is 1-10 µM. Specifically, it can be 1 µM, 2 µM, 3 µM, 4 µM, 5 µM, 6 µM, 7 µM, 8 µM, 9 µM, 10 µM.

[0028] In some embodiments of the present application, the step of culturing comprises vernalization.

[0029] In some embodiments of the present application, the step of culturing further comprises, after vernalization, culturing at 20-25 °C under conditions of 15-17 h light and 6-8 h darkness.

[0030] In some embodiments of the present application, the step of culturing further comprises, after vernalization, culturing at 22 °C under conditions of 16 h light and 8 h darkness.

[0031] In some embodiments of the present application, the plant comprises a Brassicaceae plant.

[0032] In some embodiments of the present application, the Brassicaceae plant comprises Arabidopsis thaliana.

[0033] According to some embodiments of the present application, at least the following beneficial effects are achieved: the pyrazole anthrones of the present application can regulate the length of the hypocotyl of a plant as strigolactone analogs, promote the key inhibitor of the strigolactone signaling pathway SMXL2 、 SMXL6 、 SMXL7 、 SMXL8It can express genes, increase root hair length and number, regulate plant growth and development, and has similar effects to the strigolactone analog pyrazoanthrone. Moreover, pyrazoanthrone is inexpensive, can be applied to a variety of plants, has little environmental pollution, and can be used on a large scale in agricultural production. Attached Figure Description

[0034] Figure 1 GR24, PZE, and At in the embodiments of the present invention D14 Figure showing the conformational analysis of docking and its binding sites; where A represents GR24 and At. D14 The resulting composite, B being PZE and At, D14 The composite after docking;

[0035] Figure 2 GR24, PZE, and Os in the embodiments of the present invention D14 Figure showing the conformational analysis of docking and its binding sites; where A represents GR24 and Os D14 The resulting composite, B, consists of PZE and Os. D14 The composite after docking;

[0036] Figure 3 The PZE treatment in this embodiment of the invention is applied to Col-0 and mutants ( max4-1 , d14 and max2 The influence of Arabidopsis hypocotyls; in Figure A, from top to bottom, Arabidopsis materials of max4, max2, d14, and WT are shown, and from left to right, they are treated with MOCK, GR24, and PZE, respectively; Figure B is a statistical analysis of the average length, with a scale bar of 0.5 cm.

[0037] Figure 4 The figure shows the effect of PZE and GR24 on root hair growth in Arabidopsis thaliana in the embodiments of the present invention.

[0038] Figure 5 The image shows the detection results of GR24 causing ubiquitination and degradation of SMXL7 protein in an embodiment of the present invention, where the scale bar is 50 μm.

[0039] Figure 6 This is a graph showing the detection results of PZE-induced ubiquitination and degradation of SMXL7 protein in an embodiment of the present invention, where the scale bar is 50 μm.

[0040] Figure 7 This is a graph showing the results of differential gene expression analysis of PZE and GR24 in the SLs signal transduction pathway in this embodiment of the invention.

[0041] Figure 8Figure of the detection result of the differential expression analysis of the SLs signal transduction pathway related genes in the embodiment of the present application;

[0042] Figure 9 Figure of the detection result of the differential expression analysis of the genes related to the growth and development of the hypocotyl in the embodiment of the present application. DETAILED DESCRIPTION

[0043] The concept and the technical effects of the present application will be described below in conjunction with the embodiments so as to fully understand the objects, features and effects of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application. The test methods used in the embodiments are conventional methods unless otherwise specified. The materials, reagents and the like used in the embodiments are commercially available unless otherwise specified.

[0044] Embodiment 1

[0045] The present embodiment provides the application of pyrazole anthrone as a strigolactone analogue, and the specific screening and verification process is as follows:

[0046] 1. Synthesis and mining of strigolactone analogues

[0047] The conventional two-step sequence preparation will be used in the synthesis of SL: first, perform formaldehyde, and then connect the D ring. At present, the research is designed by combining the molecular structure of plant IAA (such as indole-3-acetic acid and 2,4-D) with the active core structure of SL. This type of hybrid molecules provides a template for the development of new plant growth regulators, and in the future, more efficient crop plant type management and weed control may be achieved by precisely regulating the two hormone pathways. Among the triazole urea (Triazole Urea) antagonists, it is found through virtual screening that triazole urea can bind to the active center of KAI2, and the binding pocket is narrower compared with the SL receptor D14. The KAI2 specific chemical probe is designed for the first time, which distinguishes the KAR and SL pathways, promotes the design strategy of selective plant hormone antagonists, and covalently binds to the SL receptor and antagonizes the SL response.

[0048] 2. Action mechanism of strigolactone analogues

[0049] SL analogues recognize and activate the key receptors D14 / DAD2 of SLs, induce the hydrophobic pocket of the receptor, change the conformation, and form an active complex with the SL analogue. When the enol ether bond or amide bond of the SL analogue is hydrolyzed by the receptor, an unstable intermediate is released, triggering subsequent signal transduction. D14 When the receptor D14After the recruited E3 ubiquitin ligase is activated, it will mark the protein SMXL6 / 7 / 8 or D53 and induce its ubiquitination degradation, thereby removing the inhibition of downstream genes, inducing the response of signal pathway related genes (such as BRC1 / TB1 / PAP1), completing the signal transduction process, regulating axillary bud germination, and promoting symbiosis. SL analogs can also activate the receptor ShHTL7 of parasitic plant Striga, trigger downstream signals, and stimulate parasitic seed germination. They can also act as rhizosphere signals to activate fungi branching at low concentrations. The structure of the analog design is more inclined to the backbone with ABC ring to maintain receptor binding. The enol ether bond in the D ring modification part of the natural SL has high activity but is unstable, and the amide bond is used to retain its activity and be more stable.

[0050] 3. Screening of small molecule chemical structures

[0051] (1) Small molecule chemical structure screening

[0052] Using the synthetic strigolactone analog GR24 as a structural reference, the unique configuration of its core structure ABC ring and D ring was analyzed, and chemical structure screening was performed. Pyrazole compounds were selected for screening SL analogs after comparison and calculation in multiple databases.

[0053] (2) Preparation of small molecule ligand and protein receptor structure file

[0054] Protein preparation:

[0055] 1) Obtain Arabidopsis thaliana protein crystal structure data file (PDB code: 8VD3, resolution: 2.00 Å) from PDB protein database. D14

[0056] 2) Obtain rice protein crystal structure data file (PDB code: 3VXK, resolution: 1.75 Å) from PDB protein database. D14

[0057] Ligand preparation:

[0058] 1) Download the 3D structure of small molecule GR24 (PubChem CID number: 3036799, CAS number: 76974-79-3, molecular formula: C 17 H 14 O5) from PubChem.

[0059] 2) Download the 3D structure of small molecule PZE (molecular formula: C 14 H8N2O, CID number: 8515, CAS: 129-56-6).

[0060] (3) AUTODOCK molecular docking virtual screening​​

[0061] Molecular docking was performed using AutoDock. An AutoDock grid parameter file (working directory) was created specifying the PDBQT file of the receptor and parameters for generating atomic affinity maps. AutoDock was launched and the default working directory was set. Select "Ligand->Input->Open" and select the ligand PDBQT file. Select "Grid->Macromolecule->Open" and select the receptor PDBQT file. Set map types by selecting "Grid->Set Map Types>Choose Ligand" and selecting the ligand PDBQT file. Define the search space by selecting "Grid->GridBox" which opens a window to specify the center and size of the search space. Define a minimum box using "Center->Centeron Ligand". When finished, select "File->Close Saving Current". Save the grid parameter file by selecting "Output->Save GPF", which is usually saved with a gpf extension. Run AutoGrid by selecting "Run->Run AutoGrid" and in the pop-up window, use the "Browse" button to specify the path to the AutoGrid executable and the path to the grid parameter file. After specifying the grid parameter file, run AutoGrid. A docking parameter file is generated specifying the PDBQT file of the ligand and parameters for the docking simulation. Select "Docking->Macromolecule>Set Rigid Filename" and select the receptor PDBQT file. Select "Docking->Ligand->Choose" and select the ligand PDBQT file and accept the default ligand docking parameters. Select "Docking>Docking Parameters>Accept" and "Docking>Docking Parameters>Accept". Select "Output>LamarckianGA", which is usually saved with a dpf extension. Run AutoDock by selecting "Run->RunAutoDock".

[0062] (4) GROMACS molecular dynamics simulation

[0063] The complex bound to PZE was subjected to molecular dynamics simulation using the GROMACS molecular dynamics simulation software. The specific steps are as follows: D14

[0064] ​1) Prepare the data file, after completing the molecular docking, screen out the docking conformation with the lowest binding energy, that is, the highest binding stability, integrate the protein and ligand of this conformation into a file, save the PDB file containing both.

[0065] 2) When simulating the initial structure file of protein-ligand complex, the complex is divided into receptor and ligand, and the ligand small molecule is processed.

[0066] 3) Check whether the PDB file meets the force field standard used by GROMACS. The force field is charmm36 force field. Use the standardized file for the next running step.

[0067] 4) Use GROMACS to process the PDB file before simulation, and perform MD simulation. Convert the PDB file to GROMACS format to generate the initial structure and topology file.

[0068] 5) Set the cubic box and add solvent molecules in the box.

[0069] 6) Set the solvent configuration and prepare the input file for ion addition.

[0070] 7) Add ions and neutralize the system, use NA and CL as ion types, prepare the input file for energy minimization. Perform energy minimization.

[0071] 8) Prepare the input file for NVT equilibration, execute the temperature data in the NVT equilibration process.

[0072] 9) Prepare the input file for NPT equilibration, execute the NPT equilibration simulation, and execute the equilibration simulation.

[0073] 10) Extract the pressure and density data in the NPT equilibration process, and prepare the input file for production simulation.

[0074] 11) Execute the final production simulation, analyze and extract the simulation results, extract the trajectory as PDB format for visualization.

[0075] 12) Calculate the root mean square deviation (RMSD) of alpha-C atoms of the whole system, analyze the stability of the system, calculate the root mean square fluctuation (RMSF) of alpha-C atoms of the whole system, analyze the molecular flexibility, analyze the change of gyration radius of protein, extract energy data, and analyze the total energy change of the system.

[0076] Screening result analysis:

[0077] A primary screening result

[0078] All small molecule structures are from Pubchem database, SDF format is converted to PDB format by Open Babel. The receptor protein structure is from PDB database. AutoDock molecular docking tool is used to evaluate the docking results by binding free energy. The process of molecular docking mainly has two stages. Before docking, the ligand and receptor need to be pretreated, the three-dimensional structure of the receptor protein is determined and the ligand molecule is energy minimized. The best active site of the ligand and receptor is set to have a stable state before docking. For example, in the receptor protein of SL D14 , the interaction binding site is in the "V" shape active pocket of D14 , which also establishes the precondition for the preliminary screening of SL analogs. The binding free energy interval of docking between GR24 and SL receptor protein D14 is used as a reference. The scoring value of AutoDock is an important indicator for evaluating the binding affinity of ligand and receptor. Generally, the scoring value ≤ -7 kcal / mol indicates strong binding, and the scoring value ≥ -3 kcal / mol indicates weak binding.

[0079] Table 1 Scoring value interval of molecular docking

[0080]

[0081] The screening conditions are mainly based on the structural formula and similar atomic types. The number of binding sites is set to 10, and the autodock is run to obtain 10 best sites, i.e. the binding energy value of small molecules and receptors. Referring to the best scoring value of -6.84 kcal / mol after docking between positive control GR24 and D14 , the binding ability is screened according to the scoring value interval (kcal / mol).

[0082] Table 2 Best scoring value of molecular docking

[0083]

[0084] According to the value of docking scoring value, pyrazole anthraquinone may have strong binding and significant interaction, and may be a potential active compound. Its structural formula is shown in formula (1) as follows:

[0085]

[0086] Formula (1).

[0087] B pyrazole anthraquinone and D14 affinity analysis results

[0088] By analyzing the structural characteristics of SLs and their analogues, and utilizing a molecular docking platform, various structural analogues of SLs were screened from a small molecule organic database. The SL analogue GR24 and its receptor protein were then compared. D14 Using the docking results as a reference, the top three small molecule compounds with the highest scores were screened among pyrazole compounds. PZE ranked first, and its interaction with the SLs signal transduction receptor was analyzed. D14 Its affinity.

[0089] The results are as follows Figure 1 As shown in the figure, Figure A and Figure B represent GR24, PZE, and At, respectively. D14 The docking conformation. The pink tubular model represents GR24, the purple tubular model represents PZE, and the blue ribbon represents... D14 Receptors. The blue bonds are salt bridges, the white bonds are hydrophobic interactions, and the green bonds are pi-stacking P and pi-stacking T bonds.

[0090] The conformation of molecular docking was analyzed. D14 The conformation of the complex docked with GR24 and PZE is as follows: Figure 1 As shown. At D14 Represented by a light blue ribbon model. GR24 and PZE are represented by pink and purple tubular models, respectively. In the conformations of these two complexes, GR24 and PZE are both located at At. D14 Within the "V"-shaped combined pocket, the right-hand image of the complex shows GR24, PZE, and At. D14 The interactions between amino acid residues all involve hydrophobic forces, salt bridges, and π-π bonds.

[0091] Hydrophobic interactions are formed with VAL144, the bond length of GR24 is 3.59 Å, and the bond length of PZE is 3.99 Å;

[0092] It forms a hydrophobic interaction with VAL194, the bond length between GR24 and the residue is 3.73 Å, and the bond length between PZE and the residue is 3.29 Å;

[0093] It forms a hydrophobic interaction with TRP155, and the bond length between GR24 and the residue is 3.55 Å, while the bond length between PZE and the residue is 3.44 Å.

[0094] It forms a hydrophobic interaction with PHE159, and the bond length between GR24 and the residue is 3.57 Å, while the bond length between PZE and the residue is 3.76 Å.

[0095] It forms hydrogen bonds with SER191, the bond length between GR24 and the residue is 3.46 Å, and the bond length between PZE and the residue is 2.05 Å;

[0096] It forms a π-π bond with PHE195, the bond length of GR24 with the residue is 5.14 Å, and the bond lengths of PZE with the residue are 5.09 Å and 5.10 Å.

[0097] GR24 and AT D14 The optimal conformation for docking has a score of -8.56 for PZE and AT. D14 The optimal conformation of PZE has a docking score of -7.56, indicating that PZE and... D14 It exhibits high affinity. Based on this, GR24, PZE, and Os were further analyzed. D14 Following molecular docking, the conformations of these two complexes show that GR24 and PZE are also bound to Os. D14 In the "V" shaped pocket, such as Figure 2 Figures A and B represent GR24, PZE, and Os, respectively. D14 The conformation of the docking and its binding sites. The pink tubular model represents GR24, the purple tubular model represents PZE, and the blue ribbon represents... D14 Receptors. GR24 and Os D14 The blue bonds are salt bridges, and the white bonds are hydrophobic forces.

[0098] 4. Performance analysis of pyrazothrone as a strigolactone analogue

[0099] Material culture: The Arabidopsis thaliana material used in this experiment was wild-type Col-0 and its corresponding strigolactone receptor mutant. d14 Synthetic mutants max4-1 and max2 .

[0100] (1) Effects of pyrazolanthrone on growth and development indicators of Arabidopsis thaliana

[0101] 1) Effect of pyrazolanthrone on the length of the hypocotyl in Arabidopsis thaliana

[0102] The Arabidopsis thaliana material used was wild-type Col-0, mutant d14 , max4-1 and max2 Seed materials were placed in 2mL EP tubes, disinfected by soaking in 75% alcohol for 10-15 minutes, rinsed 3-5 times with sterilized deionized water on a sterile operating table, and an appropriate amount of sterilized 0.1% agar was added to suspend the seeds in the tubes. The tubes were then placed in a 4℃ refrigerator for vernalization for 48-72 hours (72 hours in this example) before proceeding to the next step of seeding.

[0103] The corresponding mass of GR24, Pyrazolanthrone powder reagent was weighed with an analytical balance, dissolved in appropriate amount of DMSO, and then prepared into a 2mM reagent mother liquor with distilled water, and filtered and sterilized with a water filter head. When the MS medium sterilized at 121℃ for 25 min was cooled, an appropriate amount of mother liquor was added, and the conical flask was slowly shaken to mix the mother liquor with the MS medium evenly. After the medium was completely solidified, the vernalized Arabidopsis seeds were taken out, and the seeds in the tube were blown and mixed with 1ml of the gun head. Then the seeds were evenly spotted on the medium, and cultured at 22℃ for 16h weak light and 8h dark for 7d. The length of hypocotyl under different treatments was photographed and counted. The final concentration of GR24 and Pyrazolanthrone was 5μmol / L.

[0104] The results are shown in Figure 3 From the figure, it can be seen that PZE (pyrazolanthrone) can significantly inhibit the elongation of wild-type Arabidopsis hypocotyls. In the SLs synthesis mutant max4, the hypocotyls of Arabidopsis were significantly inhibited after PZE and GR24 treatment. In the SLs signal transduction mutant d14 and max2 , there was no significant inhibition or elongation of hypocotyls after treatment.

[0105] 2) Effect of pyrazolanthrone on root growth and development

[0106] Experimental method: Prepare three sets of 90mmx15mm high-transparency quartz glass culture dishes and three 30mL 1 / 2 solid MS medium. Set up a blank control group, a pyrazolanthrone treatment experimental group, and a rac-GR24 positive control group. The pyrazolanthrone concentration in the experimental group is 5μM, and the rac-GR24 SLs analog concentration in the positive control group is 5μM. The pyrazolanthrone mother liquor and rac-GR24 reagent mother liquor are added to the 1 / 2 solid MS medium to prepare the experimental group and positive control group medium; the blank control group is poured with 1 / 2 solid MS medium without reagents. WT and d14 、 max4 Arabidopsis mutants are spotted and vernalized, and then the culture dishes are transferred to 22℃ room temperature and cultured under 16h light and 8h dark conditions.

[0107] After 10d of culture, the roots of Arabidopsis seedlings are observed. The Arabidopsis seedlings are carefully taken out of the medium, and the integrity of the Arabidopsis root system is ensured as much as possible. The residual agar on the Arabidopsis root system is washed with water, and the Arabidopsis seedlings are placed on a black background plate (a black background plate is an agar plate with black ink added to keep the root system moist). The growth state of each Arabidopsis root system is observed, and representative Arabidopsis plants are selected. The roots of these selected Arabidopsis plants are spread out as much as possible without overlapping between the roots.

[0108] Observation of root hair growth: The roots of Arabidopsis seedlings were prepared into temporary smears and observed under a general optical microscope. The differences in root hair in the root tip maturation zone between different treatments were observed and photographed. The experiment was repeated 3 times.

[0109] The results are shown in Figure 4 Figures, from which it can be seen that in wild-type Arabidopsis, the number of root hairs in the PZE and GR24 treatment groups was greater than that in the control group, and the length was longer. In SL signal transduction mutant d14 , the root hairs in the PZE treatment group were longer and thicker than those in the control group. In the SL biosynthesis mutant max4, the root hairs in the PZE treatment group were longer than those in the control group.

[0110] (3) Effect of pyrazole anthrone on the expression of plant hormone signal transduction pathway genes

[0111] 1) Construction of SMXL7 -Venus fusion expression vector

[0112] In order to monitor the expression of SMXL7 in Arabidopsis in real time, the SMXL7 and the marker were fused and expressed, and the detection of the SMXL7 protein was completed by monitoring the marker. The fluorescent tag was selected to be fused with the protein SMXL7 , and a SMXL7 -Venus plasmid was constructed. A modified pEGAD vector was provided by the research group of Professor Xie Daoxin of Tsinghua University in our laboratory. The GFP in the vector itself was removed by enzyme digestion, and the cloned fluorescent protein Venus was connected to the vector. The sequence of Venus is shown in SEQ ID NO: 9.

[0113] Venus sequence:

[0114] TGGTTGAGCAAGGGCGAGGAGCTGTTCCACC GGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTA AACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGC AAGCTGACCCTGAAGCTGATCTGCACCACCGGCAAGCTGCCCCTGCCCTGGCCC ACCCTCGTGACCACCCTGGGCTACGGCCTGCAGTGCTTCGCCCGCTACCCCGAC CACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCC GAAGGCTACGTCCAG GAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGC GCCGAGGT GAAGTTCGAGGGCGACACCCTGGTGAACCgCATCGAGCTGAAGGGCATCGACT TCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAAC TACAACAGCC ACAACGTCTATATCACC GCCGACAAGCAGAAGAACGGCATCAAGGCCAAGTTCAAG ATCCGCCACAACATCGAGGACGGCGGC GTGCAGCTCGCCGACCAC TACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC TACCTGAGCTACCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCgATCAC ATGGTCCTGCTGGAGTTCGTGACC GCCGCCGGGATC ACTCTCGGCGATGGACGAG CTGTACAAGTAA (SEQ ID NO: 9).

[0115] The extracted plasmid DNA was double-digested, and the target fragment was recovered by electrophoresis SMXL7 The Venus vector was ligated, and the ligated product was transformed into E. coli Top 10 competent cells. After suitable E. coli single colonies were grown on the plate, a single colony was inoculated into LB liquid medium containing an antibiotic and cultured overnight. After confirming that the target fragment was correct by PCR using the bacterial solution as a template, the plasmid was extracted from the PCR-positive bacterial solution. The double-digested recombinant plasmid DNA was identified and sequenced, and the plasmid with correct sequencing was transformed into Agrobacterium EHA105 competent cells and plated on YEB resistant plates for culture. The constructed SMXL7Venus was transfected into Arabidopsis protoplasts using PEG3300. After overnight culture in low light, confocal microscopy was used to observe whether it was expressed. SMXL7 The expression was detected in the nucleus of protoplasts, consistent with the expression localization of protein D53. The constructed fusion expression vector was then transformed into Arabidopsis plants.

[0116] 2) Construction SMXL7 -Venus genetically modified plants

[0117] The target transformation plasmid ( SMXL7 Agrobacterium (containing the Venus plasmid) was activated, and the OD value of the Agrobacterium EHA105 infection solution was prepared between 0.7 and 1.0. Wild-type Arabidopsis plants, 10 cm long and in good condition after bolting, were selected, and the flowering and fruiting pods were removed. All flowers were immersed in the transformation solution for 60-90 seconds, adjusting the time according to the flowering status of the plants. The infected plants were then covered with bags to maintain humidity. After 24 hours of culture, the bags were removed. After one week of culture, the Agrobacterium transformation and infection steps were repeated, followed by normal culture until seed harvest.

[0118] Transgenic Arabidopsis seeds obtained after infection and transformation were vernalized and sown on the soil. After 7 days of cultivation, BASTA resistance screening was carried out, and the selected positive plants were cultured normally until harvest.

[0119] 3) Observation SMXL7 -Venus fusion protein fluorescence

[0120] In the SL signal transduction path D14 It is the receptor protein of SL, when D14 Upon sensing the SL signal, it recruits the F-box protein. MAX2 And SMXLs family proteins, including SMXL7 In protein complexes, D14 Can mediate SMXL7 The protein undergoes ubiquitination modification, which leads to... SMXL7 Protein degradation, thereby relieving SMXL7 The inhibition of downstream gene expression allows the SL signaling pathway to be transduced normally, regulating the growth and development of plants.

[0121] After Arabidopsis thaliana is infected through inflorescences, homozygous individuals are selected. SMXL7Venus transgenic material. After the vernalization of Arabidopsis seeds is placed in the medium for five days, the Arabidopsis seedlings are carefully clamped out with tweezers, the whole seedlings are laid on a clean glass slide, the roots are kept flat, an appropriate amount of ddH2O is sucked with a pipette, a cover glass is covered, and the excess water is absorbed with filter paper. The fluorescence distribution of the roots is observed by laser confocal microscopy, and a laser of about 488 nm is used as the excitation light. When green fluorescent dots are observed, it means that this Arabidopsis seedling is SMXL7 Venus transgenic material.

[0122] 4) Fluorescence degradation experiment

[0123] In the SL signal transduction pathway, D14 is a receptor protein of SL, when D14 perceives the SL signal, it recruits F-box protein MAX2 and SMXL family proteins, including SMXL7. D14 , MAX2 and SMXL7 form a complex, in which D14 can mediate ubiquitination modification of SMXL7 protein, and further cause degradation of SMXL7 protein, thereby relieving the inhibition of SMXL7 on downstream gene expression, so that the SL signal pathway can be normally transmitted to regulate the growth and development process of plants. Then, in the SMXL7-Venus transgenic material, if exogenous SL or SL analog is added, when D14 protein perceives the signal molecule, it induces ubiquitination modification of SMXL7 protein, and further causes degradation of SMXL7 protein, i.e. degradation of SMXL7-Venus protein with green fluorescence.

[0124] Prepare different concentrations of GR24 (5 μmol / L) and PZE reagent (1 μmol / L), and observe the Arabidopsis seedlings with green fluorescence under the laser confocal microscope. SMXL7 Venus transgenic Arabidopsis seedlings, remove the water, and suck the prepared GR24 with a pipette and drop it on the glass slide, then immediately put it into the laser confocal microscope for observation, adjust to the appropriate surface, take a photo every minute, and only until the fluorescence disappears. The PZE treatment group is also operated in the same way, first find the root with point-like distributed fluorescence, then immediately put it into the laser confocal microscope after adding PZE, take a photo, and repeat the experiment 3 times.

[0125] Result analysis:

[0126] When the receptor protein D14 is recognized, it hydrolyzes the SL molecule to generate an intermediate product, and after the hydrolysis of SLs, the active part combines with D14 to formD14 -SLs complex. This process leads to D14 conformational changes, enabling it to interact with F-box protein MAX2 . D14 -SLs complex binds to MAX2 Skp1 and Cullin1, forming a ubiquitin ligase complex. The complex recognizes and ubiquitinylates inhibitors in the SLs signaling pathway (such as D53 / SMXLs), marking them for degradation by the 26S proteasome. Degradation of the inhibitors releases the inhibition on downstream transcription factors, thereby activating the expression of SLs-responsive genes, regulating plant growth and development, and stress response.

[0127] Figure 5 For the change in fluorescence before and 10 min after treatment with 5 μmol / L GR24, Figure 6 For the dynamic change in fluorescence degradation before, 5 min after, and 10 min after treatment with 1 μmol / L PZE, it can be seen from the figure that by constructing SMXL7 Venus transgenic Arabidopsis material, the fluorescence distribution in the roots was observed SMXL7 A small amount of PZE (1 μmol / L) can cause degradation, and when a high concentration of PZE (5 μmol / L) is used, SMXL7 protein can be transiently degraded, indicating that PZE can be D14 recognized and recruited to form a ubiquitin ligase complex. Recognize and ubiquitinylate the inhibitor SMXL7 protein in the signal transduction pathway.

[0128] 5) Transcriptome sequencing analysis and relative fluorescence quantification

[0129] The sequencing samples were 7 d Arabidopsis seedlings (Arabidopsis was grown to 4-6 leaf stage) divided into 3 groups, treated with 10 μmol / L GR24 for 4 h, treated with 10 μmol / L PZE for 4 h as the experimental group, and treated with pure water as the control group, and submitted to the company for transcriptome sequencing analysis. In order to explore the influence of GR24 and PZE treatment on Arabidopsis seedlings in gene regulation transcription, after completing the transcriptome sequencing result analysis, the Arabidopsis material under the same treatment condition was subjected to fluorescence quantitative PCR experiment, and the experiment was repeated 3 times.

[0130] The steps of the fluorescent quantitative PCR experiment include: extracting RNA, synthesizing cDNA, and analyzing gene expression. First, RNA extraction should be done correctly with gloves and masks to avoid RNA degradation. Mortar needs to be autoclaved at 121 °C, and enzyme-free gun heads and centrifuge tubes are used. Liquid nitrogen, TRIpure Reagent total RNA extraction reagent, and self-prepared reagents: chloroform, isopropanol, 75% ethanol, RNase-free water are prepared. The following is the specific operation method for extracting RNA:

[0131] a Sample grinding: Pour liquid nitrogen into a sterilized mortar, quickly put the Arabidopsis thaliana plant sample into it, and grind it into fine powder. Quickly transfer the ground powder to an enzyme-free 2 mL centrifuge tube.

[0132] b RNA lysis: Add 50-100 mg of tissue powder and 1 mL of TRIpure Reagent to each centrifuge tube and mix well. Incubate at room temperature for 5 minutes to allow the nuclear protein to fully dissociate.

[0133] c Centrifugal separation: 4°C, 12000 rpm, centrifugation for 10 min, carefully pipette the supernatant into a new centrifuge tube.

[0134] d Chloroform treatment: Add 0.2 mL of chloroform to the supernatant, vortex quickly for 15 s, and incubate at room temperature for 2-3 min. 4°C, 12000 rpm, centrifugation for 15 min, separate the three layers of liquid, and the RNA is in the uppermost colorless water layer.

[0135] e RNA precipitation: Pipette the colorless water layer into a new centrifuge tube, add an equal volume of isopropanol, vortex quickly for 10 s, and incubate at room temperature for 10 min. 4°C, 12000 rpm, centrifugation for 3 min, discard the supernatant.

[0136] f RNA washing: Add 1 mL of 75% ethanol to the precipitate and mix gently to wash the precipitate. 4°C, 12000 rpm, centrifugation for 3 min, carefully discard the supernatant to avoid losing the RNA precipitate.

[0137] g RNA dissolution and preservation: Incubate at room temperature for 3 min, then add 30-50 μL of RNase-free water to dissolve the RNA. Quickly freeze the RNA solution with liquid nitrogen and store it in a -80 °C refrigerator to prevent degradation.

[0138] The saved RNA is detected by agarose gel electrophoresis to detect the quality of the RNA. After analyzing the quality of the RNA, the concentration of the RNA is detected using a microplate reader. Second, cDNA synthesis is performed using the Monabio reverse transcription kit, and the operation is performed on ice. The reaction system is shown in Table 3.

[0139] Table 3 cDNA synthesis reaction system

[0140]

[0141] After gently aspirating and mixing, centrifuge for 10 seconds, and then react in a PCR instrument under the following conditions: 50℃ for 15 min; 85℃ for 5 min. After the reaction is complete, store the cDNA at 4℃.

[0142] Using synthesized cDNA as a template, qRT-PCR amplification was performed using a CFX96-CFX384 real-time quantitative PCR instrument (Bio-Rad, USA). After preparing the reaction system according to the experimental design, samples were accurately pipetted into the qRT-PCR plate, ensuring consistent volume of each reaction component in each well. Three technical replicates were set up for each sample to ensure data reliability. To reduce errors potentially caused by excessively high cDNA concentrations, the cDNA template obtained from reverse transcription was diluted 2–5 times. Simultaneously, primers were diluted to 10 μM to optimize reaction conditions. The reaction system followed the ChamQ Universal SYBR qPCR Master Mix instructions, using a 20 μL system for relative quantitative PCR. To reduce experimental errors, primers were added separately as a variable, and three biological replicates were set up for each sample. Threshold cycle (Cq / Ct) values ​​for each reaction were recorded using real-time quantitative PCR, and 2... -ΔΔCt The relative expression level of the target gene is calculated using this method.

[0143] The qRT-PCR reaction system and reaction procedure are shown in Table 4-5 below.

[0144] Table 4 Relative Real-Time Quantitative PCR Reaction Systems

[0145]

[0146] Table 5 Relative Real-Time Quantitative PCR Reaction Procedures

[0147]

[0148] The primer sequences used in the qRT-PCR reaction are shown in Table 6.

[0149] Table 6 qRT-PCR primers

[0150]

[0151] Analyzing transcriptome data to identify pathways involved in SL signaling. SMXL2 The differential expression results for / 6 / 7 / 8 are as follows: Figure 7 As shown in the figure, the pathways involved in SLs signaling are...SMXL2 The expression of / 6 / 7 / 8 is up-regulated. The results of relative fluorescence quantitative detection of signal transcription inhibitor SMXL6 / 7 / 8 are shown in Figure 8 , which also shows significant up-regulation of expression.

[0152] The results of transcriptome correlation data analysis of gene expression affecting the growth and development of hypocotyl under the influence of pyrazole anthrone are shown in Figure 9 From the figure, it can be seen that PZE can act as a signal molecule to affect the response of plant hormones and affect the growth and development of hypocotyl. The specific analysis is as follows:

[0153] Hypocotyl is a key stage in plant growth and development, with a complex regulatory network. The results of the previous experiments show that PZE will inhibit the elongation of hypocotyl under weak light, and the inhibition degree is basically the same as that of the GR24 treatment group. The growth and development of Arabidopsis hypocotyl is regulated by a variety of genes, which are involved in hormone signal pathways, cell division and elongation, cell wall modification, light signal transduction and other processes. Among the differentially expressed genes affecting the growth and development of hypocotyl, the genes related to plant hormones mainly include ARF family genes, AUX family genes; among them, ARF family genes are key transcription factor families in Arabidopsis that regulate IAA signal transduction. They regulate the expression of downstream genes by binding to IAA response elements, thereby affecting plant growth and development. Among the up-regulated ARF family genes in the differential gene set, ARF1 belongs to the inhibitory ARF family gene, which inhibits signal transcription, ARF1 regulates cell elongation and development, ARF2 participates in cell aging, ARF9 regulates cell elongation. The genes related to light signal transduction are PIF family genes, which promote hypocotyl elongation, especially in the dark or weak light. Among the differential genes, PIF4 is down-regulated; the genes related to stress response are NAC family genes, and there are many NAC family genes in Arabidopsis, with diverse functions. They play an important role in plant growth and development and stress response. According to the function, NAC genes can be divided into categories such as growth and development, stress response, and hormone signal transduction. ATAF1, ATAF2 are all up-regulated, regulating leaf development and participating in drought, high salt and pathogen stress response, RD26 responding to drought and high salt stress, NAC6 regulating embryonic development and seed germination. The genes related to the maintenance and differentiation of stem cells are WOX family. They are mainly involved in stem cell maintenance, organogenesis and embryonic development, etc.WOC11 Genes up-regulated. ERF1, ERF11 It is speculated that PZE affects IAA, ethylene, ABA as a signal molecule, SAUR Family genes are involved in regulating plant organ development (such as hypocotyl, root, leaf) and morphological construction, and play multiple functions in plant growth and development, promote cell elongation by regulating the expression of cell wall acidification and cell elongation related genes, and are involved in IAA, GA, ABA signal transduction, among which SAUR15, SAUR20, SAUR24, SAUR26, SAUR29, SAUR68 Down-regulated. Based on the analysis of differentially expressed genes, it is speculated that PZE affects the response of plant hormones as a signal molecule and affects the growth and development of hypocotyl.

[0154] The embodiments of the application are described in detail above, but the application is not limited to the above embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the purpose of the application. In addition, the embodiments of the application and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of pyrazole anthrones as a strigolactone analogue in any of the following: (1) inhibiting hypocotyl length in plants; (2) increasing root hair length and / or number in plants; the plant is Arabidopsis thaliana.

2. Use according to claim 1, characterized in that, the inhibiting hypocotyl length in plants or increasing root hair length and / or number in plants is achieved by: 1) modulating the SL signaling pathway; 2) modulating the expression of strigolactin signaling pathway genes SMXL2 , SMXL6 , SMXL7 , SMXL8 of the application 3) induction SMXL7 ubiquitination and degradation.

3. A method of inhibiting hypocotyl length in a plant, comprising, the method comprises the following steps: sowing plant seeds in a culture reagent containing pyrazole anthrones, and culturing; the concentration of pyrazole anthrones in the culture reagent is 1-5 µM; the plant is Arabidopsis thaliana.

4. A method of increasing root hair length and / or number in a plant, characterized by, the method comprises the following steps: sowing plant seeds in a culture reagent containing pyrazole anthrones, and culturing; the concentration of pyrazole anthrones in the culture reagent is 1-10 µM; the plant is Arabidopsis thaliana.

Images