Application of tpp riboswitch sequence editing material in synchronously improving crop stress resistance, yield and nutritional quality
By using CRISPR-Cas9 technology to target the TPP riboswitcher sequence in rice and tomatoes for gene editing, the trait trade-off between crop yield and nutritional quality improvement in existing technologies has been resolved, achieving simultaneous improvement in crop yield, nutritional quality and stress resistance.
Patent Information
- Application Number
- CN202511134679.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-14
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-08-14
AI Technical Summary
Existing technologies struggle to simultaneously improve crop yield and nutritional quality without sacrificing crop quality and stress resistance. Traditional breeding and gene editing methods suffer from trait trade-offs and lack precise tools to break down pleiotropic networks.
Gene editing targeting the TPP riboswitcher sequence in rice and tomato using CRISPR-Cas9 technology increases TPP levels, thereby enhancing crop resistance, yield, and nutritional quality. Genetic transformation is performed using TPP riboswitcher sequence editing materials, including nucleotide molecules, sgRNA, recombinant vectors, and recombinant microorganisms.
It achieves simultaneous improvement in crop yield and nutritional quality, breaks through the trade-off of traits, enhances crop disease resistance, cold resistance and photosynthetic efficiency, and provides an effective molecular breeding strategy.
Smart Images

Figure CN120700041B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to the application of TPP riboswitch sequence editing material in synchronously improving crop stress resistance, yield and nutritional quality. BACKGROUND
[0002] Improving crop yield is a key goal of breeding, but success in this goal is often at the expense of crop quality and stress resistance. In recent years, the improvement of crop quality has also become a key goal of breeding. However, it is still a serious challenge to achieve these goals at the same time, because existing research mainly focuses on the improvement of a single trait, and ignores the inherent trade-off between yield, nutrition and stress resistance.
[0003] Currently, metabolic engineering and gene editing techniques have created a variety of biofortified crops, such as "golden rice" rich in beta-carotene, rice rich in riboflavin, rice rich in pyridoxine, etc. Although these research results have alleviated some specific micronutrient deficiency, the ability and transformation efficiency of gene expression vectors limit the simultaneous biofortification of crops with multiple essential nutrients. The trade-off effect of genes controlling yield, nutrition and stress adaptability also limits the potential for comprehensive optimization of traits. For example, mutagenesis of GL4 gene in rice produces an anti-crushing phenotype, but results in smaller seed size. Plant immune activation further embodies this dilemma: pathogen recognition receptors such as Xa21 in rice can confer resistance to rice blast, but under non-pathogenic conditions, it will reduce grain size, while salicylic acid-mediated defense signals inhibit growth through antagonism with gibberellin pathways. Although traditional breeding and transgenic methods can partially alleviate linkage drag, the trade-off driven by pleiotropy remains difficult to solve. These observations collectively reveal an unresolved problem in plant genetics, i.e. the lack of precise tools to disentangle pleiotropic networks, thus requiring innovative methods to break the interdependence between traits at the molecular level.
[0004] Vitamin B1 (thiamine) plays a pivotal role in central energy metabolism. In plants, vitamin B1 sustains the supply of ATP and acetyl-CoA, which are essential for almost all life activities, by maintaining the activities of several core enzymes in the pentose phosphate pathway, the Calvin-Benson cycle, and the tricarboxylic acid (TCA) cycle. In addition, in rice, tobacco, tomato, cucumber, cotton, grape, and Arabidopsis, vitamin B1 can act as a defense activator, activating salicylic acid and Ca 2+Signal pathways induce the expression of systemic acquired resistance (SAR) and pathogenesis-related (PR) genes. At the same time, vitamin B1 is essential for improving plant photosynthetic efficiency, maintaining chloroplast balance, and reducing the impact of various abiotic stresses that induce the accumulation of reactive oxygen species. The biosynthesis of vitamin B1 in plants is regulated by riboswitches, which are conserved RNA elements in the 3'-UTR of THIC that can sense the level of vitamin B1 pyrophosphate (TPP) and feedback inhibit biosynthesis. Although the role of riboswitches in bacteria has been disclosed, their role in plant metabolism and stress adaptation is not well known. Disrupting the function of riboswitches can change the balance of TPP, affecting carbon / nitrogen metabolism and stress response, but research on improving crops using this pathway has not been carried out. Rice (Oryza sativa) is a typical monocot model plant with a small genome, a clear genetic background, and a mature transformation system, and the results of its gene function research have important reference value for monocot crops such as wheat, corn, and sorghum. Tomato (Solanum lycopersicum) is an ideal model species for dicot research, with a clear genome, a short growth cycle, and high conservation in gene regulation mechanisms with dicot plants such as Arabidopsis and tobacco. The results of gene function research can be effectively extended to dicot crops such as legumes, Solanaceae, and Brassicaceae. Conducting functional research on riboswitch sequences in monocot and dicot plants can help promote the development of crop improvement and molecular breeding. SUMMARY
[0005] The purpose of the present application is to provide the application of TPP riboswitch sequence editing materials in synchronously improving the stress resistance, yield and nutritional quality of crops, in order to solve the problems existing in the prior art. The present application improves the level of TPP by editing the TPP riboswitch sequence of plants through CRISPR-Cas9 technology, thereby simultaneously improving the yield, nutritional quality and adaptability to stress of crops. The present application provides a very effective strategy for simultaneously improving the yield, nutritional quality and stress resistance of crops.
[0006] In order to achieve the above purpose, the present application provides the following solutions:
[0007] The present application provides the application of TPP riboswitch sequence editing materials in synchronously improving the stress resistance, yield and nutritional quality of crops, wherein the TPP riboswitch sequence editing materials include any one of the following:
[0008] A1. A nucleotide molecule of a TPP riboswitch sequence;
[0009] A2. An sgRNA targeting the TPP riboswitch sequence;
[0010] A3. A recombinant vector comprising the sgRNA of A2.
[0011] A4. A recombinant microorganism comprising the recombinant vector of A3.
[0012] The TPP riboswitch sequence is the 3'-UTR of a crop THIC gene.
[0013] The stress resistance is disease resistance and cold resistance.
[0014] Optionally, the crop comprises rice or tomato.
[0015] Further, when the crop is rice, the nucleotide sequence of the TPP riboswitch sequence is shown in SEQ ID NO. 1, and the sequence of the sgRNA is shown in SEQ ID NO. 2 from 34th to 124th position.
[0016] When the crop is tomato, the nucleotide sequence of the TPP riboswitch sequence is shown in SEQ ID NO. 11, and the sequence of the sgRNA is shown in SEQ ID NO. 12 and SEQ ID NO. 13.
[0017] The application also provides an sgRNA targeting a TPP riboswitch sequence of a crop, wherein the TPP riboswitch sequence is the 3'-UTR of a crop THIC gene.
[0018] When the crop is rice, the sequence of the sgRNA is shown in SEQ ID NO. 2 from 34th to 124th position.
[0019] When the crop is tomato, the sequence of the sgRNA is shown in SEQ ID NO. 12 and SEQ ID NO. 13.
[0020] The application also provides a recombinant vector comprising the sgRNA.
[0021] The application also provides a recombinant microorganism comprising the recombinant vector.
[0022] The application also provides a method for simultaneously improving stress resistance, yield and nutritional quality of a crop, comprising the step of introducing the recombinant vector or the recombinant microorganism into the crop by genetic transformation technology, so as to improve the stress resistance, yield and nutritional quality of the crop; the stress resistance is disease resistance and cold resistance.
[0023] Optionally, the crop comprises rice or tomato.
[0024] The application also provides a method for cultivating a new crop variety with high stress resistance, high yield and high nutritional quality, comprising the following steps: introducing the recombinant vector or the recombinant microorganism into a crop by genetic transformation technology to obtain a new crop variety with high stress resistance, high yield and high nutritional quality; the stress resistance is disease resistance and cold resistance.
[0025] Optionally, the crop comprises rice or tomato.
[0026] The application also provides a rice TPP riboswitch mutant gene, and the nucleotide sequence of the mutant gene is shown in SEQ ID NO. 9 or SEQ ID NO. 10.
[0027] The application also provides a tomato TPP riboswitch mutant gene, and the nucleotide sequence of the mutant gene is shown in SEQ ID NO. 16 or SEQ ID NO. 17.
[0028] The application discloses the following technical effects:
[0029] The application targets the 3'-UTR region of the rice THIC gene by CRISPR-Cas9 technology, edits the TPP riboswitch sequence, improves the TPP level, and thus simultaneously enhances the complex nutrition, yield, cold resistance and disease resistance of rice grains. The verification in tomato proves the cross-species applicability of the method, and the edited tomato strain shows higher photosynthetic efficiency and stress adaptability, which is beneficial to the growth and development of tomato. The application establishes the metabolic rewiring driven by riboswitch, bypasses the traditional trade-off of traits, realizes the synergistic gain of productivity, nutritional density and environmental adaptability through single genetic intervention, and provides a very effective strategy for simultaneously improving crop yield and nutritional quality. BRIEF DESCRIPTION OF DRAWINGS
[0030] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.
[0031] Figure 1Figure for gene mutation and nutrient component detection results of rice plant material in Example 1; wherein a is the mutation type of TPP riboswitch sequence of 9 mutant materials; b is the content of vitamin B1 in the grain of rice plant material; c is the content of vitamin B1 in the leaf of rice plant material; d is the content of vitamin B1 in the stem of plant material; e-p are the quantitative analysis results of thiamine (vitamin B1), riboflavin, nicotinic acid, pantothenic acid, pyridoxol, α-tocopherol, phosphatidylethanolamine 18:3, phosphatidylcholine 18:3, leucine, threonine, serine, valine in rice sample, respectively;
[0032] Figure 2 Figure for mutation analysis results of TPP riboswitch sequence of 9 rice mutant materials;
[0033] Figure 3 Figure for agronomic trait detection results of rice plant material in Example 1; wherein a is the plant phenotype of mature rice plant material planted in Wuhan, Hubei, with a scale of 10 cm; b is the plant phenotype of mature rice plant material planted in Wuhan, Hubei, with a scale of 10 cm; c is the panicle phenotype of rice plant material planted in Wuhan, Hubei, with a scale of 5 cm; d-m are the yield-related parameter detection results of rice plant material planted in Wuhan, Hubei and Sanya, Hainan, including plot yield (d, e), single plant yield (f, g), panicle length (h, i), single panicle grain number (j, k), single panicle yield (l, m); n-p are the plant height (n), tiller number (o) and panicle number per plant (p) detection results of rice plant material planted in Wuhan, Hubei;
[0034] Figure 4 Figure for panicle phenotype of rice plant material planted in Sanya, Hainan in Example 1;
[0035] Figure 5 Figure for photosynthesis efficiency and nitrogen assimilation detection results of rice plant material in Example 1; wherein a is net photosynthetic rate; b is maximum photochemical efficiency; c is actual light energy conversion efficiency; d is maximum electron transport efficiency; e is the plant phenotype of rice plant material under low nitrogen (LN) culture condition; f is the aboveground tissue dry weight of rice plant material under low nitrogen (LN) culture condition; g is the root dry weight of rice plant material under low nitrogen (LN) culture condition; h is the leaf phenotype of rice plant material under low nitrogen (LN) culture condition; i is the chlorophyll content of rice plant material under low nitrogen (LN) culture condition; j is the phenotype of rice plant material under different nitrogen culture conditions, with a scale of 10 cm; k is the tiller number of rice plant material under different nitrogen culture conditions; l is the panicle number per plant of rice plant material under different nitrogen culture conditions; m is the plant height of rice plant material under different nitrogen culture conditions; n is the root length of rice plant material under different nitrogen culture conditions;
[0036] Figure 6 Figure 1 shows the results of photosynthesis-related parameter detection of the rice plant material in Example 1; wherein a is the transpiration rate; b is the intercellular carbon dioxide concentration; c is the stomatal conductance; d is the non-photochemical quenching coefficient; e is the non-radiation energy dissipation; f is the photochemical quenching coefficient;
[0037] Figure 7 Figure 2 shows the results of resistance detection of the rice plant material in Example 1; wherein a is the plant phenotype of the rice plant material under natural disease stress in Enshi at the tillering stage; b is the single plant phenotype of the rice plant material under natural disease stress in Enshi at the tillering stage; c is the plant phenotype of the rice plant material under natural disease stress in Enshi at the heading stage; d is the single plant phenotype of the rice plant material under natural disease stress in Enshi at the heading stage; e-g are in turn the diseased leaf phenotype (e), lesion ratio (f) and Magnaporthe oryzae biomass (g) of the rice plant material after inoculation with Magnaporthe oryzae ZB22 strain by spraying method; h-j are in turn the diseased leaf phenotype (h), lesion length (i) and Magnaporthe oryzae biomass (j) of the rice plant material after inoculation with Magnaporthe oryzae ZB22 strain by punching method; k is the plant phenotype of the rice plant material under normal conditions and cold stress conditions; l is the survival rate statistics of the rice plant material after cold stress treatment; m is the electrolyte leakage rate of the rice plant material exposed to cold stress conditions; n is the results of DAB staining and NBT staining of the rice plant material under normal conditions and cold stress conditions;
[0038] Figure 8 Figure 3 shows the single plant phenotype of the rice plant material in Example 1 under natural disease pressure in Enshi field;
[0039] Figure 9 Figure 4 shows the results of resistance detection of the rice plant material in Example 1 against Magnaporthe oryzae; wherein a-c are in turn the diseased leaf phenotype (a), lesion length (b) and pathogen biomass (c) of the rice plant material after inoculation with L7 strain by punching method; d-f are in turn the diseased leaf phenotype (d), lesion length (e) and pathogen biomass (f) of the rice plant material after inoculation with L13 strain by punching method; g-i are in turn the diseased leaf phenotype (g), lesion length (h) and pathogen biomass (i) of the rice plant material after inoculation with EA67 strain by punching method;
[0040] Figure 10 Figure 5 shows the results of expression quantity detection of vitamin B1 biosynthesis-related genes in trs3 of the rice plant material under different cold stress conditions; a is the relative expression quantity of OsAK gene, b is the relative expression quantity of OsiscS gene, c is the relative expression quantity of OsTDK1 gene, d is the relative expression quantity of OsTHI4 gene;
[0041] Figure 11 Figure 6 shows the plant phenotype of the rice plant material in Example 1 under different cold stress conditions;
[0042] Figure 12 Figure for gene mutation analysis results, plant phenotypes, photosynthesis efficiency and disease resistance detection results of tomato plant material in Example 2; wherein a is the gene mutation analysis results of the tomato plant material; b-i are the quantitative analysis results of thiamine (vitamin B1), riboflavin, nicotinic acid, pantothenic acid, pyridoxine, α-tocopherol, leucine, threonine, and serine in the tomato fruit sample; j is the plant phenotype of the tomato plant material; k is the net photosynthetic rate of the tomato plant material; l is the transpiration rate of the tomato plant material; m is the intercellular carbon dioxide concentration of the tomato plant material; n is the stomatal conductance of the tomato plant material; o is the plant and leaf phenotype of the tomato plant material under natural disease conditions; p is the leaf phenotype of the tomato plant material after artificial inoculation of Botrytis cinerea; q is the lesion area of the tomato plant material after artificial inoculation of Botrytis cinerea; r is the ratio of lesion area to leaf area of the tomato plant material after artificial inoculation of Botrytis cinerea;
[0043] Figure 13 Figure for resistance detection results of tomato plant material under different cold stress conditions in Example 2; a is the plant phenotype of the tomato plant material under normal conditions and cold stress conditions; b is the electrolyte leakage rate of the tomato plant material under room temperature and exposure to cold stress conditions, respectively; c is the DAB staining (left) and NBT staining results (right) of the tomato plant material under normal conditions and cold stress conditions. DETAILED DESCRIPTION
[0044] The various illustrative embodiments of the present application will now be described in detail in connection with the following figures. This description is intended to be illustrative, but not to limit the scope of the application. Many modifications and variations to the illustrative embodiments described herein will be apparent to those of ordinary skill in the art upon reading this description. The scope of the application is defined by the appended claims.
[0045] It should be understood that the terms used herein are for the purpose of describing particular embodiments and are not intended to limit the present application. In addition, for numerical ranges in the present application, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value between any stated value or stated range, as well as any other stated value or stated range, is also encompassed within the present application. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.
[0046] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference for the disclosure and the description of the procedures and / or materials in connection with which the disclosure was made. In case of conflict, the present specification will control.
[0047] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof. Additional implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The examples in the specification are exemplary only and are not intended to be limiting.
[0048] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having" or variants thereof are open-ended, and specifically do not exclude additional, unrecited elements or method steps.
[0049] The experimental methods in the following examples are routine methods unless otherwise specified. The instruments and equipment used in the following examples are routine laboratory instruments and equipment unless otherwise specified. The test materials used in the following examples are purchased from routine biochemical reagent stores unless otherwise specified.
[0050] Example 1 Rice TPP riboswitch sequence editing experiment
[0051] I. Experimental methods
[0052] 1. Plant material
[0053] Wild-type material: Zhonghua No. 11 (ZH11) rice;
[0054] trs mutant material: The TPP riboswitch in the 3'-UTR region of the key enzyme OsTHIC for synthesizing vitamin B1 was targeted, and a gene mutant material was constructed by CRISPR-Cas9 technology. The construction process was as follows:
[0055] (1) Constructing vectors: taking the TPP riboswitch sequence of rice as shown in SEQ ID NO. 1 as a target, designing sgRNA. And taking PJG090 as a template, amplifying the bsa I-spacer 1-sgRNA-U6a-spacer 2-bsa I sequence containing bsa I site at both ends by PCR, then carrying out Golden Gate cloning reaction with PJG112 vector (disclosed in the literature "A simple and efficient cloning system for CRISPR / Cas9-mediated genome editing in rice") to obtain gene editing vectors. A total of 7 vectors were constructed, and their bsa I-spacer 1 (underlined)-sgRNA (bold)-U6a (italic)-spacer 2 (underlined)-bsa I sequences are shown in SEQ ID NO. 2-8, respectively.
[0056] SEQ ID NO. 1:
[0057] TGTTAGTAATGAAAGTTGCACCAGGGGTGCCTGTATTCTCAACGATCTGAAGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCCTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA.
[0058] SEQ ID NO. 2:
[0059] agGGTCTCAggca AGTAATGAAAGTTGCACCAGgttttagagctatgctgaaaagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttattttttcctgtagttttcccacaaccattttttaccatccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccgaatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagtaggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacggaataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctctcagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctagagcaaactggactgccttatatgcgcgggtgctggcttggctgcc GCTCGATCTCCCACCAAAAA gtttTGAGACCct.
[0060] SEQ ID NO. 3:
[0061] agGGTCTCAggca AGTAATGAAAGTTGCACCAGgttttagagctatgctgaaaagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttattttttcctgtagttttcccacaaccattttttaccatccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccgaatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagtaggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacggaataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctctcagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctagagcaaactggactgccttatatgcgcgggtgctggcttggctgcc GCTGCTGAGCTCACACGTTC gtttTGAGACCct.
[0062] SEQ ID NO. 4:
[0063] agGGTCTCAggca AACAGGATAATGCCTGCGAAgttttagagctatgctgaaaagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttattttttcctgtagttttcccacaaccattttttaccatccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccgaatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagtaggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacggaataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctctcagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctagagcaaactggactgccttatatgcgcgggtgctggcttggctgcc GCTGCTGAGCTCACACGTTC gtttTGAGACCct.
[0064] SEQ ID NO. 5:
[0065] agGGTCTCAggca AACAGGATAATGCCTGCGAAgttttagagctatgctgaaaagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttattttttcctgtagttttcccacaaccattttttaccatccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccgaatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagtaggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacggaataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctctcagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctagagcaaactggactgccttatatgcgcgggtgctggcttggctgcc GCTCGATCTCCCACCAAAAA gtttTGAGACCct.
[0066] SEQ ID NO. 6:
[0067] agGGTCTCAggca AGCCCAATTCACAACAATCCgttttagagctatgctgaaaagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttattttttcctgtagttttcccacaaccattttttaccatccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccgaatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagtaggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacggaataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctctcagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctagagcaaactggactgccttatatgcgcgggtgctggcttggctgcc GCTGCTGAGCTCACACGTTC gtttTGAGACCct.
[0068] SEQ ID NO. 7:
[0069] agGGTCTCAggca AGCCCAATTCACAACAATCCgttttagagctatgctgaaaagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttattttttcctgtagttttcccacaaccattttttaccatccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccgaatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagtaggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacggaataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctctcagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctagagcaaactggactgccttatatgcgcgggtgctggcttggctgcc GCTCGATCTCCCACCAAAAA gtttTGAGACCct.
[0070] SEQ ID NO. 8:
[0071] agGGTCTCAggca AGCCCAATTCACAACAATCCgttttagagctatgctgaaaagcatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttaagcttattttttcctgtagttttcccacaaccattttttaccatccgaatgataggataggaaaaatatccaagtgaacagtattcctataaaattcccgtaaaaagcctgcaatccgaatgagccctgaagtctgaactagccggtcacctgtacaggctatcgagatgccatacaagagacggtagtaggaactaggaagacgatggttgattcgtcaggcgaaatcgtcgtcctgcagtcgcatctatgggcctggacggaataggggaaaaagttggccggataggagggaaaggcccaggtgcttacgtgcgaggtaggcctgggctctcagcacttcgattcgttggcaccggggtaggatgcaatagagagcaacgtttagtaccacctcgcttagctagagcaaactggactgccttatatgcgcgggtgctggcttggctgcc AACAGGATAATGCCTGCGAA gtttTGAGACCct.
[0072] (2) Constructing mutant material: the gene editing vector constructed in step (1) is transferred into Agrobacterium, and a rice genetic transformation is carried out by using the method of Agrobacterium infection of rice callus, taking ZH11 as the receptor plant to construct the trs mutant material.
[0073] 2. Detection of nutritional ingredients
[0074] (1) Metabolite analysis of rice samples: freeze-dry the rice samples, and then grind them with a mixer mill (MM400, Retsch) at a frequency of 30 Hz for 1.5 min. Then, weigh 100 mg of the powder, and extract it with pure methanol at 4°C overnight. Then, centrifuge the extract at 10,000 x g for 10 min. Collect the supernatant, filter it, and then perform LC-MS analysis to perform extensive targeted metabolomics analysis including vitamins, sugars, polyphenols, lipids, and amino acids.
[0075] (2) Metabolite quantification: The metabolite (including vitamin B1, riboflavin, niacin, pantothenic acid, pyridoxine, a-tocopherol, phosphatidylethanolamine 18:3 (LysoPE18:3), phosphatidylcholine 18:3 (LysoPC18:3), leucine, threonine, serine, valine, etc.) content in plant tissue samples was detected by high performance liquid chromatography (HPLC) principal component method (referring to the literature Fitzpatrick, T. B. et al. Vitamin Deficiencies in Humans: Can Plant Science Help? Plant Cell 24, 395-414, doi:10.1105 / tpc.111.093120 (2012)). The analysis conditions are as follows: HPLC chromatographic column: shim-pack GIS S C18 (pore size 1.9 pm, length 2.1 x 100 mm); 0.04% acetic acid aqueous solution as mobile phase A, and acetonitrile solution added with 0.04% acetic acid as mobile phase B; gradient program: 0 min, 5% B; 12.0 min, 95% B; 13.2 min, 95% B; 13.3 min, 5% B; 15.0 min, 5% B; flow rate: 0.4 mL / min; temperature: 40°C; injection volume: 2 pL.
[0076] Target metabolome analysis was performed by predetermined multiple reaction monitoring (MRM) through LC-ESI-QQQ-MS / MS system (LCMS-8060, SHIMADZU, Japan). The ESI source operating parameters are as follows: atomizing gas flow, 3 L / min; heating gas flow, 10 L / min; interface temperature, 500°C; DL temperature, 250°C; heating block temperature, 400°C; dry gas flow, 10 L / min. The recorded data was processed by LabSolutions 5.91 software.
[0077] 3. Detection of agronomic traits
[0078] The field yield of trs mutant materials and wild type materials was evaluated in Sanya, Hainan and Wuhan, Hubei (low incidence of rice blast). The design of field plots followed the strategy formulated by the International Rice Research Institute. In each field test, each strain had 5 repeated plots, each plot had 100 plants, and the plant spacing was 20 cm. After the rice matured, the yield of each plot and each strain was counted.
[0079] 4. Detection of photosynthetic efficiency and nitrogen assimilation
[0080] 4.1 Photosynthetic efficiency
[0081] (1) Measurement of leaf photosynthesis-related parameters
[0082] Photosynthesis parameters, including net photosynthetic rate (Pn), stomatal conductance (Gs), intercellular CO2 concentration (Ci), and transpiration rate (Tr), were measured using a portable photosynthesis system, LI-6800, from 10:00 to 11:00 am. The irradiance used to activate photosynthesis was 600 μmol·m -2 ·s -1 . All measurements were performed on the newest fully expanded leaves, and the CO2 concentration in the atmosphere was 400 μmol·mol -1 , and the temperature was 25 °C.
[0083] (2) Measurement of chlorophyll fluorescence values
[0084] Before measurement, the plant material was dark-adapted for 30 min. After the start of measurement, the minimum fluorescence in the dark (Fo) was recorded using weak modulated irradiance light (<0.1 μmol·m -2 ·s -1 , frequency 0.6 kHz), and the maximum fluorescence (Fm) was determined using a saturating pulse of light (300 ms, 10000 μmol m -2 s -1 , frequency 20 kHz). After the start of actinic light (387 μmol·m -2 ·s -1 , 635 nm), saturating pulses were turned on every 30 s to record the maximum fluorescence in the light (Fm'). After the induction curve was stable, the chlorophyll steady-state fluorescence in the light-adapted condition (Fs) was determined, and the chlorophyll minimum fluorescence after light adaptation (Fo') was recorded after the fluorescence signal decreased after the actinic light was turned off after 600 s. The chlorophyll fluorescence parameters were calculated as follows:
[0085] Maximum photochemical efficiency Fv / Fm= (Fm-Fo) / Fm;
[0086] Actual light energy conversion efficiency Y(II) = (Fm'-Fs) / Fm';
[0087] Non-radiative energy dissipation Y(NO) = Fs / Fm;
[0088] Non-photochemical quenching coefficient NPQ = (Fm-Fm') / Fm';
[0089] Photochemical quenching coefficient qP= (Fm'-Fs) / (Fm'-Fo');
[0090] Maximum electron transport efficiency ETR = Y(II) x PAR x 0.84 x 0.5.
[0091] (3) Measurement of chlorophyll content
[0092] Fresh leaves were collected, frozen in liquid nitrogen and ground into powder. Pigments were then extracted with 80% acetone and shaken overnight in the dark. After centrifugation at 12000 x g for 10 min at 4°C, the chlorophyll content was measured at 645 and 663 nm wavelengths.
[0093] 4.2 Nitrogen assimilation
[0094] After 10 days of plant material cultivation, plants were divided into low nitrogen group and normal control group. The normal control group was fed with the following nutrient solution: Ca(NO3)2·4H2O: 236 mg / L, KNO3: 101 mg / L, NH4H2PO4: 11.5 mg / L, MgSO4·7H2O: 123 mg / L, EDTA-Fe: 2 mg / L, H3BO3: 0.5 mg / L, MnSO4·H2O: 0.5 mg / L, ZnSO4·7H2O: 0.05 mg / L, CuSO4·5H2O: 0.02 mg / L, (NH4)6Mo7O 24 ·4H2O: 0.01 mg / L. The low nitrogen group was fed with a solution containing 20% of the nitrogen content of the normal control group, and other conditions were consistent with the normal control group. After one month of treatment, plants were harvested for biomass and chlorophyll content analysis. The low nitrogen group plants were continued to grow to heading and seed setting, and plant height, root length and tiller number were statistically analyzed. The nutrient solution of all plants was replaced every three days.
[0095] 5. Resistance detection
[0096] 5.1 Disease resistance
[0097] Rice blast resistance was evaluated in Enshi rice blast nursery (high rice blast incidence). The design of field plots followed the strategy developed by the International Rice Research Institute. In each field test, each line had 5 replicate plots, each plot had 100 plants, and the plant spacing was 20 cm. The diseased plants of rice blast susceptible line "Lijiang Xintuanheigui" were used as inoculum sources for disease transmission. One row of Lijiang Xintuanheigui was sown every 10 rows of test varieties, allowing the fungus to spread naturally with the wind. The resistance of different lines to rice blast was evaluated according to the evaluation system of the International Rice Research Institute, and the percentage of necrotic spikes caused by rice blast was calculated.
[0098] Rice plant infection assays were performed with Magnaporthe oryzae EA67 isolated from rice fields in Enshi, M. oryzae L7 and L13 isolated from rice fields in Liaoning, and M. oryzae ZB22. The above strains have been disclosed in the literature “Genome editing of a rice CDP-DAG synthase confers multipathogen resistance”: M. oryzae EA67 is M. oryzae ES76 in the literature, M. oryzae L7 is M. oryzae LN3 in the literature, M. oryzae L13 is M. oryzae LN13 in the literature, and M. oryzae ZB22 is M. oryzae ZB25 in the literature. The four strains are preserved in the laboratory of the Agricultural Multidimensional Omics Platform of Yizhao Bay, which is open to the public.
[0099] Four to five-week-old rice plants at the tillering stage were used for both spray inoculation and punch inoculation. Before spray inoculation, the plants were placed in a humidity chamber (relative humidity greater than 90%) for 24 h to increase susceptibility, and then the spore concentration of the pathogen was adjusted to 1 x 10 5 5 For punch inoculation, the spore concentration of the pathogen was adjusted to 1 x 10 5 For punch inoculation, the spore concentration of the pathogen was adjusted to 1 x 10
[0100] 5.2 Cold tolerance
[0101] Plant material was grown in pots in a light incubator at 28°C under a 16 h light / 8 h dark photoperiod and 70% relative humidity. After 15 days of growth, the seedlings were subjected to cold stress by placing them at 4°C for 48 h, after which they were moved to 28°C for recovery. Meanwhile, plant material was grown under normal conditions (26°C) as a control.
[0102] (1) Measurement of electrolyte leakage
[0103] Three leaves of uniform size were collected from each plant material, cut into small pieces, rinsed clean, and shaken in deionized water overnight. After incubation, the conductivity of the solution (R1) was measured using a DDS-11C conductivity meter. The samples were then placed in boiling water in a sealed container for 20 min. The conductivity was measured again (R2). The amount of electrolyte leakage was calculated as R1 / (R1+R2).
[0104] (2) Measurement of O2 - and H2O2
[0105] O2 - and H2O2 were detected by nitro blue tetrazolium chloride (NBT) and 3,3-diaminobenzidine (DAB) staining, respectively. To detect O2 - , 3-5 cm long leaves were harvested and incubated in 1% NBT (w / v, pH=7.8) and then vacuumed for 30 min. After dark incubation at room temperature, samples were transferred to 95% ethanol at 80°C to remove chlorophyll. To detect H2O2, plant leaves were stained with 0.05% DAB (w / v, PH 3.8), vacuumed for 30 min, and then incubated for 12 h.
[0106] (3) Measurement of the expression of vitamin B1 biosynthesis-related genes
[0107] The expression of OsAK, OsisscS, OsTDK1 and OsTHI4 genes in plant leaves was detected.
[0108] II. Experimental results
[0109] 1. Plant material
[0110] Given the key role of vitamin B1 in plant and human nutrition, efforts to increase its content are of great value. The present invention uses CRISPR-Cas9 technology to obtain a series of gene editing lines, targeting the TPP riboswitch in the 3'-UTR region of the key enzyme OsTHIC for synthesizing vitamin B1, aiming to increase the content of vitamin B1 in rice. Seven gene editing vectors (each containing one or two sgRNAs designed for the TPP riboswitch and its OsTHIC flanking sequence) generated 173 T0 generation editing lines, of which 47 had mutations. After two rounds of breeding, a total of 9 lines with the same mutation type were obtained, including single base, multiple base and fragment deletion, and were named trs1 to trs9. The mutation types of the TPP riboswitch sequences of the lines are shown in Table a and Table Figure 1 . Figure 2
[0111] 2. Results of nutrient component detection
[0112] The results of the quantitative analysis of vitamin B1 are shown in Table Figure 1 The vitamin B1 content in different tissues of the 9 lines was significantly improved compared with ZH11, as shown in b-d. Among them, trs3 and trs8 had the highest vitamin B1 content in different tissues. Therefore, further in-depth study was carried out on trs3 and trs8. The sequences of the TPP riboswitch sequence of trs3 and trs8 are shown as SEQ ID NO. 9 and SEQ ID NO. 10.
[0113] trs3 (SEQ ID NO. 9):
[0114] TGTTAGTAATGAAAGTTGCCTGTATTCTCAACGATCTGAAGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCCTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA.
[0115] trs8 (SEQ ID NO. 10):
[0116] TGTTAGTAATGAAAGTTGCACCAGGGGTGCCTGTATTCTCAACGATCTGAAGGCCTCTTGGCCTGGAAGCTGGA.
[0117] The vitamin B1 content in commercially available white rice is generally about 1 mg / kg, which means that a person needs to eat about 1.5 kg of rice per day to meet the recommended daily intake of 1.5 mg of vitamin B1 for an adult. In order to evaluate whether eating trs fortified rice can meet the daily vitamin B1 requirement of humans, the vitamin B1 content in ZH11, trs3 and trs8 mutant japonica rice was further quantitatively analyzed. As shown in e, the vitamin B1 content in trs3 and trs8 mutant lines increased from 0.92 mg / kg in ZH11 to 5.26 mg / kg and 5.51 mg / kg, respectively. This means that eating about 300 g of trs fortified rice can meet the daily vitamin B1 intake. Figure 1
[0118] Given the crucial role of vitamin B1 in the tricarboxylic acid cycle and glycolysis, it serves as an upstream precursor for many important nutrients, including lipids and amino acids. To assess the overall nutritional quality of TRS3 and TRS8 mutant lines, targeted metabolomics analysis was performed on 115 nutrients and health-related components (including 17 vitamins, 53 lipids, 21 amino acids, 9 sugars, and 15 polyphenols) in rice samples. The results showed that the levels of most nutrient metabolites were higher in the TRS3 and TRS8 mutant lines than in ZH11. These included riboflavin, niacin, pantothenic acid, pyridoxine, α-tocopherol, monoacylglycerol phospholipids, and several essential amino acids for the human diet. Figure 1 These results indicate that gene editing of the TPP riboswitches can simultaneously increase the levels of vitamin B1 and other nutrients.
[0119] 3. Results of agronomic trait testing
[0120] To evaluate the agronomic traits of riboswitched editing plants, field trials were conducted in Wuhan using TRS3, TRS8, and ZH11 plants. Field trial results showed that, compared to ZH11, TRS3 and TRS8 plants exhibited significantly increased plot yields, with increases ranging from 17.10% to 21.13%. Figure 3 The height of the mutant material was also significantly increased (ad), Figure 3 (n). However, there were no significant differences in the number of tillers and spikes per plant among trs3, trs8, and ZH11, indicating that the increased yield of the mutant materials was not caused by these two quantitative traits. Figure 3 To further rule out the possibility that planting density caused increased yield, phenotypic analysis of individual plant traits was performed in three separate randomized plots. The results showed that, compared to ZH11, trs3 and trs8 exhibited 16.58% to 20.92% higher per-plant cereal yield. Figure 3 (f). Detailed phenotypic analysis showed that, compared with ZH11, the yield increase of trs3 and trs8 lines was related to an increase in ear length of 15.45% to 24.85% (f). Figure 3 (h), which correspondingly increases the number of grains per ear and the yield ( Figure 3 (j and l).
[0121] To evaluate the stability of the yield-increasing effect of vitamin B1 riboswitching, field trials were also conducted in Sanya, Hainan, where environmental conditions are drastically different. Despite the drastically different conditions, under the short-day and tropical conditions of Hainan, TRS3 and TRS8 plants still showed significant yield increases, such as... Figure 3 As shown in e and g, compared to ZH11, yield per plot increased by 18.65% to 19.48%, and yield per plant increased by 15.53% to 21.97%. Furthermore, as... Figure 3i, k, m and Figure 4 As shown, the spike length, number of grains, and yield per plant of plants edited by trs3 and trs8 were significantly higher than those of ZH11.
[0122] 4. Results of photosynthetic efficiency and nitrogen assimilation
[0123] To investigate the underlying mechanisms leading to increased yield, photosynthesis in the plant materials was analyzed. Quantitative analysis showed that, under standard growth conditions, the net photosynthetic rate of the TRS3 and TRS8 lines was 47% higher than that of ZH11. Figure 5 (a). Furthermore, these plants also showed improved Fv / Fm values (Fv / Fm represents the maximum quantum efficiency of photosystem II when all reaction centers are open), and increased photosystem II yield. Figure 5 (b and c). Furthermore, gene-edited riboswitches showed increased chloroplast electron transport rates ( Figure 5 d, Figure 6 ).
[0124] By culturing plant materials under low nitrogen (LN) conditions, it was found that the aboveground biomass of the mutant materials was significantly higher than that of the wild-type materials under LN conditions, while the root biomass was slightly increased. Figure 5 (e.g.). Meanwhile, the chlorophyll content of the mutant material increased by 16-20% compared to the wild-type material. Figure 5 (h and i). Further LN treatment was applied to the plants throughout their entire growth cycle from flowering to maturity. Representative images of the normal control group and the low-nitrogen treatment group of the mutant material are shown below. Figure 5 Quantitative data on tillering number indicate that the tillering ability of the mutant material is enhanced under both normal culture and LN conditions. Figure 5 (k). Similarly, under normal culture and LN conditions, the number of spikes per plant in the mutant material was higher (k). Figure 5 (l). Although the plant height of the mutant material remained unchanged under normal culture conditions, it increased under LN conditions. Figure 5 The case of root length (m) is similar. Figure 5 (n).
[0125] 5. Results of disease resistance and cold resistance tests
[0126] To evaluate the stress resistance of riboswitched rice lines, field trials under natural disease stress were conducted in a Magnaphalitis zae endemic area in Enshi, Hubei Province. Field observations showed that, compared with the wild-type material (ZH11), the mutant material maintained near-normal growth parameters while exhibiting a stronger innate defense response to natural pathogen infection. This was evident from the critical tillering stage (… Figure 7 ab,Figure 8 ) and heading date (c-d) can be clearly seen. Figure 7
[0127] Controlled infection experiments were further conducted by two different inoculation methods: spray inoculation (mimicking natural spore dispersal) and punch inoculation (localized tissue penetration) of M. oryzae ZB22 strain. Spray inoculation experiments showed that lesion length of mutant materials was significantly shorter compared to ZH11 lines, exhibiting typical rice blast lesions (e, f of Figure 7 This resistance phenotype was consistently observed in punch inoculation experiments (h, i of Figure 7 but the difference between mutant materials and ZH11 plants was more pronounced under spray conditions. Quantitative PCR analysis of fungal biomass confirmed these morphological observations, showing that in both inoculation methods, M. oryzae DNA accumulation was reduced by 42-67% in mutant materials compared to ZH11 controls (g, j of Figure 7 Additional inoculation experiments were also conducted using pathogen strains from Liaoning (L7, L13) and Enshi (EA67). In these experiments, trs3 lines exhibited more pronounced resistance than trs8 lines (f of Figure 9 These complementary experimental approaches collectively demonstrate that genetic editing of the riboswitch can improve plant resistance to disease through multiple infection routes, both in the field and under controlled laboratory conditions.
[0128] Low temperature (LT) is a major environmental factor that limits rice growth and agricultural production, causing oxidative stress and damage to plants. Vitamin B1 biosynthetic genes play an important role in plant resistance to various oxidative stresses, but their function in cold stress tolerance is currently unknown. Transcriptional data from maize showed that the expression levels of most genes in the vitamin B1 synthesis pathway were induced by LT, and similar results were found in rice trs3 by qPCR ( Figure 10 ). This suggests that vitamin B1 may be involved in LT stress response. To explore this issue, trs3 and trs8 mutant materials and ZH11 plants were placed in LT treatment. After one day of exposure, the degree of leaf curling in trs3 and trs8 was slightly lower compared to ZH11 control (a, b of Figure 11 After 2 days of exposure to cold stress conditions and recovery, more than 80% of mutant materials survived, while only about 32% of ZH11 survived (k, l of Figure 7 Maintaining cell membrane integrity is crucial for cold tolerance, and electrolyte leakage is an indicator of membrane damage. Under cold stress, electrolyte (ion) leakage in trs3 and trs8 was significantly slower than in ZH11 (m, n of Figure 7 m). In addition, by detecting the accumulation of reactive oxygen species through DAB and NBT staining, it was found that trs3 and trs8 leaves accumulated H2O2 and O2 - Much less than ZH11.
[0129] The above data demonstrate that gene editing of the TPP riboswitch can enhance the tolerance of rice to biotic (pathogenic fungi) and abiotic (cold) stresses through different but complementary mechanisms.
[0130] Example 2 Tomato TPP riboswitch gene editing experiment
[0131] I. Experimental methods
[0132] 1. Plant material
[0133] Wild-type material: "Ailsa Craig" ecotype tomato (WT);
[0134] Sltrs mutant material: The TPP riboswitch in the 3'-UTR region of the key enzyme slTHIC for synthesizing vitamin B1 was targeted, and a gene mutant material was constructed by CRISPR-Cas9 technology, and the construction process was as follows:
[0135] (1) Gene editing vector construction: The TPP riboswitch sequence of tomato as shown in SEQ ID NO. 11 was targeted, sgRNA was designed, and target sgRNA1 and sgRNA2 were obtained; primers F / R were designed according to the target information, and WT plant DNA was used as a template for amplification using high-fidelity enzyme. After electrophoresis detection, the PCR product was recovered, and the PCR product was ligated with the pH-Ubi-cas9-7 vector to obtain the ligation product.
[0136] SEQ ID NO. 11:
[0137] TTTATTGACACGAGAAAGCACCGGGGGTGTCTGTGTCAGCTTCAAATGCTGACTGATCAGGCTGAGAAAGTCCCTTTGAACCTGAACGGGATAATTCCTGCGTAGGGAGCGTGCAATTTCTTTTTTCTTGCTTGCACAGGGATGGCGATTCTCCAAAATGGTTGAAAATTCAAAATTAATCTGATCCTGCTCTTTGCCAGGACCAGTTTATTCACTGTCTATTCAAGACACCATCTTGTATTGTTTGTTTTTTTGGTGTCCTGTACCGCATTGAGGCCTGACTAAATACAGATTCCCGC.
[0138] sgRNA1: ATTGACACGAGAAAGCACCGGGG (SEQ ID NO. 12).
[0139] sgRNA2: CCTGCTCTTTGCCAGGACCAGTTT (SEQ ID NO. 13).
[0140] F: AAGGAGGCGGTAGTAGGA (SEQ ID NO. 14).
[0141] R: CAAGGGTCGTGATGGAGT (SEQ ID NO. 15).
[0142] PCR amplification system: 1 μl of F / R primer, 1 μl of WT plant DNA template, 20 μl of high-fidelity enzyme, and 27 μl of ddH2O.
[0143] The ligation system is: 4 μl of PCR product, 1 μl of linearized vector, 1 μl of recombinase, 2 μl of buffer, and 1 μl of ddH2O; the ligation reaction conditions are 37 °C for 30 min.
[0144] (2) Transformation of E. coli: After taking the competent DH5a out of the freezer, it was quickly placed on ice. After 5 min, the bacteria were dissolved and the ligation product was added. It was placed on ice for 25 min, heated at 42 °C for 45 s, placed on ice for 2 min, added 100 μl of LB without antibiotics, and shaken at 37 °C, 200 rpm for 1 h. Plate, LB + kanamycin, 37 °C culture for 24 h. Pick positive colonies and verify by sequencing. Extract the recombinant plasmid that has been verified successfully.
[0145] (3) Transformation of Agrobacterium: Mix 20 μl of Agrobacterium (EHA105-WM) with 1 μl of recombinant plasmid, ice bath for 5 min, liquid nitrogen freeze for 5 min, 37 °C water bath for 5 min, ice bath for 5 min. Add 100 μl of LB without antibiotics, shake at 28 °C, 200 rpm for 2 h, directly plate on the corresponding bacterial antibiotic + rifampicin plate, and incubate at 28 °C for two days. Pick positive colonies for colony PCR identification, and use the correct colonies for transformation experiments.
[0146] (4) Genetic transformation of tomato: After the tomato seeds germinate, the cotyledon and hypocotyl are taken as the infection material and pre-cultured for 2 d. Then, they are placed in a suspension containing Agrobacterium for 5 min, dried, and then placed in co-culture medium at 23 °C for 3 d. Then, the explants are transferred to the corresponding resistant selection medium, subcultured to differentiation medium every 3 weeks, and resistant shoots are obtained after about 7 weeks. The main stems are subcultured to rooting glass tubes when they grow to 2-3 cm.
[0147] 2. Photosynthesis efficiency detection
[0148] Tomato plant material was planted in a flowerpot and cultivated under 28°C cool white fluorescent light (600 mmol m -2 ·s -1 , 12 h photoperiod) in a growth chamber at 18°C (day-night temperature difference) and 60% relative humidity. Then, the photosynthesis efficiency of the tomato plant material was detected according to the method of “4.1 Photosynthesis efficiency” in Example 1.
[0149] 3. Disease resistance detection of tomato
[0150] 3.1 Natural disease
[0151] Each genotype of tomato plant was planted in the disease high season (high temperature and humidity), and routine cultivation management was adopted to ensure the consistency of water and fertilizer and plant spacing. The disease conditions of each plant were observed and recorded in the stable period of disease, and at least five repetitions were carried out for each genotype.
[0152] 3.2 Artificial inoculation of pathogenic bacteria
[0153] The culture of Botrytis cinerea (Bc, isolated strain B05.10, recorded in the literature “A Proteomic Analysis of Ripening Tomato Fruit Infected by Botrytis cinerea”, and the strain is currently preserved in the laboratory of the Agricultural Multiomics Platform of Yizheng Bay National Laboratory, which can be obtained by the public) was placed on a potato dextrose agar (PDA) plate and cultured at 22°C for 5 to 7 days. Under the condition of 1 mg / mL glucose and 1 mg / mL K2HPO4, the spores of Botrytis cinerea were harvested from the PDA plate and filtered with gauze. The concentration of spores was adjusted to 10 6 spores / mL with a hemocytometer. 10 μl of spore suspension was inoculated on the fourth to fifth leaves of 5 to 7 weeks old tomato plants. The inoculated plants were placed in a humid growth chamber at 22°C. The control group was the plant or leaf treated with water. The area of necrotic lesion was measured 5 to 7 days after inoculation.
[0154] 4. Cold resistance detection of tomato
[0155] The cold treatment method of rice plant material in Example 1 “5.2 Cold resistance” was referred to, and the electrolyte leakage, O2 - and H2O2 of tomato plant material were detected.
[0156] II. Experimental results
[0157] In view of the results obtained on rice, in order to explore whether the change of vitamin B1 content by editing the TPP riboswitch sequence to improve crop yield, nutritional quality and resistance can also work in dicotyledonous plants. The tomato slTHIC gene mutant is constructed. Two sltrs mutant plants are generated in the tomato slTHIC gene, named sltrs1 (adding 1 base) and sltrs5 (deleting 5 bases) respectively (a). Figure 12 The TPP riboswitch sequence sequence of sltrs1 and sltrs5 is shown as SEQ ID NO. 16 and SEQ ID NO. 17.
[0158] sltrs1 (SEQ ID NO. 16):
[0159] TTTATTGACACGAGAAAGCACCGGGGGTGTCTGTGTCAGCTTCAAATGCTGACTGATCAGGCTGAGAAAGTCCCTTTGAACCTGAACGGGATAATTCCTGCGTAGGGAGCGTGCAATTTCTTTTTTCTTGCTTGCACAGGGATGGCGATTCTCCAAAATGGTTGAAAATTCAAAATTAATCTGATCCTGCTACTTTGCCAGGACCAGTTTATTCACTGTCTATTCAAGACACCATCTTGTATTGTTTGTTTTTTTGGTGTCCTGTACCGCATTGAGGCCTGACTAAATACAGATTCCCGC.
[0160] sltrs5 (SEQ ID NO. 17):
[0161] TTTATTGACACGAGAAAGCACCGGGGGTGTCTGTGTCAGCTTCAAATGCTGACTGATCAGGCTGAGAAAGTCCCTTTGAACCTGAACGGGATAATTCCTGCGTAGGGAGCGTGCAATTTCTTTTTTCTTGCTTGCACAGGGATGGCGATTCTCCAAAATGGTTGAAAATTCAAAATTAATCTGATCCTGCTGCCAGGACCAGTTTATTCACTGTCTATTCAAGACACCATCTTGTATTGTTTGTTTTTTTGGTGTCCTGTACCGCATTGAGGCCTGACTAAATACAGATTCCCGC.
[0162] Compared with wild-type tomatoes (WT), the levels of thiamine (vitamin B1), riboflavin, niacin, pantothenic acid, pyridoxine, α-tocopherol, leucine, threonine, and serine in the fruit of the tomato mutant material were significantly increased. Figure 12 The growth rate accelerates during the asexual growth stage (bi). Figure 12 (j). Furthermore, its photosynthetic rate increased dramatically by 56% to 77% (j). Figure 12 k), transpiration rate increases ( Figure 12 The porosity increases (l), Figure 12 (n), but the internal carbon dioxide concentration did not change ( Figure 12 (m). Furthermore, under natural disease conditions ( Figure 12 (o) and under artificial inoculation of pathogens ( Figure 12 (PR), tomato mutant materials exhibit significant resistance to gray mold. Furthermore, under cold treatment conditions, the growth status of the mutant materials is significantly superior to that of the wild type ( Figure 13 (a) The mutant electrolyte leakage rate is reduced ( Figure 13 (b), and a decrease in reactive oxygen species accumulation ( Figure 13 c).
[0163] The above combined data indicate that gene editing of the TPP riboswitch can significantly promote tomato growth, improve the nutritional quality of tomatoes, and increase the tolerance of tomatoes to biological (pathogen) stress and cold environments.
[0164] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of TPP riboswitch sequence editing materials in simultaneously improving crop stress resistance, yield, and nutritional quality, characterized in that... The TPP riboswitching sequence editing material includes any one of the following: A1. sgRNA targeting the TPP riboswitch sequence; A2. A recombinant vector containing the sgRNA described in A1; A3. Recombinant microorganisms containing the recombinant vector described in A2; The TPP riboswitch is the 3'-UTR of the crop THIC gene; the crop is rice or tomato; When the crop is rice, the edited TPP riboswitching sequence is shown in SEQ ID NO.9 or SEQ ID NO.10; When the crop is tomato, the edited TPP riboswitching sequence is shown in SEQ ID NO.16 or SEQ ID NO.17; The aforementioned resistance refers to disease resistance and cold resistance.
2. The application of TPP riboswitch sequence editing materials in increasing vitamin B1 content in crops, characterized in that, The TPP riboswitching sequence editing material includes any one of the following: A1. sgRNA targeting the TPP riboswitch sequence; A2. A recombinant vector containing the sgRNA described in A1; A3. Recombinant microorganisms containing the recombinant vector described in A2; The TPP riboswitch is the 3'-UTR of the crop THIC gene; the crop is rice or tomato; When the crop is rice, the edited TPP riboswitching sequence is shown in SEQ ID NO.9, SEQ ID NO.10, and any of the following sequences: (1)TGTTAGTAATGAAAGTTGCACAGGGGTGCCTGTATTCTCAACGAT CTGAAGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCCTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA; (2)TGTTAGTAATGAAAGTTGCACAGGGTGCCTGTATTCTCAACGATC TGAAGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCCTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA; (3)TGTTAGTAATGAAAGTTCAGGGGTGCCTGTATTCTCAACGATCTG AAGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCCTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA; (4)TGTTAGTAATGAAAGTTGCCAGGGGTGCCTGTATTCTCAACGAT CTGAAGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCCTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA; (5)TGTTAGTAATGAAAGTTGCGAATACAATCTCCGTGCAGATCGTC TTGGTGTCCATCTACTCCGGGTGGAGCGTTTATCAGCAGCACTCCTCACCATCCTATGTTAGGAGGTGGCATGTAATAGCACTGGATAGCTGCTCTGTTTTTATCAACTTCTACTTGTAATTTCAGGGACCTTAATAAACCTTTAGTGGCTTGGACTTGTATGTGCATTACTGCAAAGGCACTAACTTTTATATCACAATAACATGTTCTCGCCTTCCAGGGGTGCCTGTATTCTCAACGATCTGAAGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCCTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA; (6) TGTTAGTAATGAAAGTTGCGGTGCCTGTATTCTCAACGATCTGA AGGCCTCTTGGCCTGGATTGTTGTGAATTGGGCTGAGAAAGTCCTTTTGAACCTGAACAGGATAATGCCTGCGAAGGGAGTGTGCATTTCTACTTTTATGTTTCCAGGGAACTCTCAACACAACCCCTTTTTGGTGGGAGATCGAGCTATCCAATATGTTCCTGAACGTGTGAGCTCAGCAGCTGGA; (7)TGTTAGTAATGAAAGTTGCAAGCTGGA; When the crop is tomato, the edited TPP riboswitching sequence is shown in SEQ ID NO.16 or SEQ ID NO.
17.
3. The application according to claim 1, characterized in that, When the crop is rice, the nucleotide sequence of the TPP riboswitch sequence is as shown in SEQ ID NO.1, and the sequence of the sgRNA is as shown in positions 34-124 of SEQ ID NO.2; When the crop is tomato, the nucleotide sequence of the TPP riboswitch sequence is shown in SEQ ID NO.11, and the sequence of the sgRNA is shown in SEQ ID NO.12 and SEQ ID NO.
13.
4. A method for simultaneously improving crop stress resistance, yield, and nutritional quality, characterized in that, The method includes the step of transferring the recombinant vector or recombinant microorganism described in claim 1 into a crop through genetic transformation technology to obtain a mutant crop, thereby improving the crop's stress resistance, yield, and nutritional quality; the stress resistance refers to disease resistance and cold resistance. The crop is rice or tomato; When the crop is rice, the TPP riboswitching sequence of the mutant crop is shown in SEQ ID NO.9 or SEQ ID NO.10; When the crop is tomato, the TPP riboswitching sequence of the mutant crop is shown in SEQ ID NO.16 or SEQ ID NO.
17.
5. A method for cultivating a new crop variety with strong stress resistance, high yield, and high nutritional quality, characterized in that, The method includes the step of transferring the recombinant vector or the recombinant microorganism described in claim 1 into a crop through genetic transformation technology to obtain a new crop variety with strong stress resistance, high yield, and high nutritional quality; wherein the stress resistance is disease resistance and cold resistance. The crop is rice or tomato; When the crop is rice, the TPP ribosomal sequence of the new crop variety is as shown in SEQ ID NO.9 or SEQ ID NO.10; When the crop is tomato, the TPP ribosomal sequence of the new crop variety is as shown in SEQ ID NO.16 or SEQ ID NO.17.