High-efficiency cellulose-degrading strain f19-1 and application thereof
The application of the Corynascus verrucosus F19-1 strain solved the problem of low enzymatic hydrolysis efficiency in the high-value utilization of corn straw, realizing efficient enzymatic hydrolysis and conversion of corn straw and improving the utilization efficiency of biomass resources.
Patent Information
- Application Number
- CN202510921701.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-04
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2045-07-04
AI Technical Summary
Existing technologies for the high-value utilization of corn stalks face bottlenecks such as low enzymatic hydrolysis efficiency, insufficient microbial resources, and significant environmental impact, making it difficult to effectively convert lignocellulose components.
We provide the Corynascus verrucosus F19-1 strain, which has a high efficiency in cellulose degradation and a certain ability to degrade hemicellulose and lignin. Through optimization of the fermentation medium, we prepare microbial agents for the enzymatic hydrolysis and transformation of corn straw.
The system achieved efficient enzymatic hydrolysis and conversion of corn straw biomass, with degradation rates of cellulose, hemicellulose, and lignin reaching 59.90%, 35.22%, and 18.71%, respectively. This improved the utilization efficiency of corn straw and laid the foundation for its high-value utilization.
Smart Images

Figure CN120718764B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of microbial fermentation and biomass utilization, and particularly relates to a high-efficiency cellulose-degrading strain F19-1 and application thereof. BACKGROUND
[0002] Corn stalk is one of the main renewable biomass resources in China, and the main chemical components are lignin, hemicellulose and cellulose, and also contains a small amount of fat and protein. Cellulose, as the component with the highest proportion, can significantly improve the overall utilization efficiency of corn stalk if it is efficiently converted. However, the current physical and chemical technologies have problems such as high energy consumption, strong toxicity and complicated subsequent processing, which limit the high-value utilization and conversion of corn stalk. Microbial enzyme catalysis technology has become one of the effective means for the recycling of biomass resources due to its advantages such as mild reaction conditions and green and pollution-free. At present, the microbial method still has the bottlenecks of low enzymatic efficiency, few high-efficiency degradation bacteria resources and being easily affected by environmental factors, and it is urgent to develop more high-quality microbial degradation bacteria resources for the directional enzymatic catalysis of biomass resources under different environmental conditions.
[0003] At present, there are many types of microorganisms that can be used for biomass decomposition, such as bacteria, fungi and actinomycetes. Corynascus verrucosus belongs to a type of microorganism of Ascomycota and Chaetomium, which widely exists in various types of soil, wood and plant tissues. Studies have shown that most of these microorganisms can produce cellulase, xylanase and laccase, and have certain degradation function on lignocellulose components. In addition, these microorganisms also have the ability to produce bioactive substances, which can effectively resist tumor cells and play a certain role in biological control. However, there are relatively few studies on Chaetomium microorganisms that can be used for lignocellulose decomposition, therefore, more Chaetomium microorganisms that can be used for biomass degradation are excavated, and the degradation potential is analyzed and researched, so as to lay a foundation for improving the microbial conversion efficiency of corn stalk biomass. SUMMARY
[0004] The purpose of the present application is to provide a high-efficiency cellulose-degrading strain F19-1 and application thereof, so as to solve the problems existing in the prior art. The Corynascus verrucosus disclosed in the present application has relatively high cellulose degradation efficiency, and also has good degradation ability on hemicellulose and lignin, and can have good enzymatic conversion efficiency on corn stalk biomass, thereby providing excellent strain resources and data support for the subsequent high-value utilization of corn stalk.
[0005] In order to achieve the above purpose, the present application provides the following solutions.
[0006] The application provides a Corynascus_verrucosus F19-1, and the high-efficiency straw degradation fungus is named as Corynascus_verrucosus F19-1, has been preserved in the China Center for Type Culture Collection, and the preservation strain number is CCTCC No: M 20251389, and the preservation address is No. 299, Bajiyilu, Wuchang District, Wuhan City, Hubei Province, China Center for Type Culture Collection.
[0007] The application also provides application of the Corynascus_verrucosus F19-1 or metabolites thereof in degradation of cellulose, hemicellulose and / or lignin.
[0008] The application also provides application of the Corynascus_verrucosus F19-1 or metabolites thereof in any of the following aspects:
[0009] (1) application in corn straw degradation;
[0010] (2) application in agricultural biomass degradation.
[0011] The application also provides application of the Corynascus_verrucosus F19-1 or metabolites thereof in preparation of a microbial agent for degrading cellulose, hemicellulose and / or lignin.
[0012] The application also provides a microbial agent, which comprises the Corynascus_verrucosus F19-1.
[0013] Preferably, the microbial agent comprises a water extract of the Corynascus_verrucosus F19-1 or a sterile body fermentation liquor of the Corynascus_verrucosus F19-1.
[0014] Preferably, the preparation method of the fermentation liquor is as follows: the Corynascus_verrucosus F19-1 is subjected to PDA seed liquid culture, 3-8 mL seed liquid is inoculated into a fermentation medium, and the fermentation medium is cultured at 10-28 DEG C and 180 rpm vibration for 8-20 days.
[0015] Preferably, the fermentation medium is as follows: corn straw powder 3-5%, NaNO3 2.5 g / L, KH2PO4 1.5 g / L, MgSO4·7H2O 0.05 g / L, CaCl2 1.0 g / L, (NH4)2SO4 3.0 g / L, CuSO4·5H2O 0.15 g / L and FeSO4·7H2O 0.02 g / L.
[0016] The application also provides application of the microbial inoculant in any one of the following:
[0017] (1) application in corn stalk degradation;
[0018] (2) application in agricultural biomass degradation.
[0019] The application also provides application of the microbial inoculant in degradation of cellulose, hemicellulose and / or lignin.
[0020] The application discloses the following technical effects:
[0021] 1. The Corynascus verrucosus provided by the application has the abilities of degrading cellulose, hemicellulose and lignin, and has good application potential in enzymatic conversion of corn stalk biomass.
[0022] 2. The Corynascus verrucosus provided by the application exhibits excellent cellulose degradation and has a certain degree of decomposition ability in hemicellulose and lignin degradation, which indicates that the strain has a relatively comprehensive straw biomass degradation enzyme system, and this characteristic provides high-quality strain resources for improving the enzymatic efficiency of corn stalk, and has important significance for promoting the high-value conversion of subsequent agricultural biomass, environmental protection and sustainable development of low-carbon economy. BRIEF DESCRIPTION OF DRAWINGS
[0023] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description are only some embodiments of the application, and for those skilled in the art, other drawings can be obtained from these drawings without creative labor.
[0024] Fig. 1 is a growth morphology diagram of the strain Corynascus verrucosus F19-1 in a Congo red staining plate according to the application;
[0025] Fig. 2 is a growth morphology diagram of the strain Corynascus verrucosus F19-1 in a guaiacol coloration plate according to the application;
[0026] Figure 3 is a colony morphology diagram of the strain Corynascus verrucosus F19-1 of the present application in PDA medium;
[0027] Figure 4 is a morphology diagram of the strain Corynascus verrucosus F19-1 of the present application under a microscope; the scale is 1:50 pm;
[0028] Figure 5 is a phylogenetic tree diagram of the strain Corynascus verrucosus F19-1 of the present application;
[0029] Figure 6 is a morphology diagram of the strain Corynascus verrucosus F19-1 of the present application for corn stalk degradation;
[0030] Figure 7 is a weight loss rate diagram of the strain Corynascus verrucosus F19-1 of the present application for corn stalks;
[0031] Figure 8 is a degradation rate column diagram of the strain Corynascus verrucosus F19-1 of the present application for corn stalks. DETAILED DESCRIPTION
[0032] The detailed description set forth below describes various illustrative embodiments of the application. The detailed description is not intended to limit the scope of the application, but rather to provide a more detailed description of certain aspects, features and embodiments of the application.
[0033] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. In addition, any numerical values recited herein include all values from the lower to the upper bound of the range, inclusive of the lower and upper values, as well as any values explicitly indicated to fall within the range. Any smaller range that falls within the total range specified, as well as any value within the smaller range, is also contemplated. The upper and lower limits of these smaller ranges can independently be included or excluded in the range.
[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.
[0035] Many modifications and variations of the specific embodiments of the application can be practiced in accordance with the principles of the application, and such variations are of no concern to the inventors. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples are illustrative only.
[0036] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.
[0037] The experimental techniques and methods used in the following examples are routine unless otherwise specified.
[0038] The reagents, materials, etc. used in the following examples are obtained from commercial channels unless otherwise specified. The high-efficiency straw degrading bacteria provided by the present application is named Corynascus verrucosus F19-1, which has been preserved in the China Center for Type Culture Collection, with the strain number CCTCC No: M 20251389, and the address of preservation is No. 299, Bajiyilu, Wuchang District, Wuhan City, Hubei Province, China Center for Type Culture Collection.
[0039] The solid and liquid medium formulations used in the following examples are as follows:
[0040] PDA solid medium: glucose 20 g, peeled potato 200 g, agar 18 g, distilled water to 1 L.
[0041] Cellulose screening medium: NaCl 6.0 g, MgSO4·7H2O 0.1 g, KH2PO4 0.5 g, CaCl2 0.1 g, (NH4)2SO4 2.0 g, K2HPO4 2 g, CMC-Na 10 g, Congo red 0.2 g, agar 18 g, distilled water to 1 L.
[0042] Guaiacol-PDA medium: glucose 20 g, peeled potato 200 g, KH2PO4 1.0 g, MgSO4·7H2O 0.5 g, aniline blue 0.2 g or guaiacol 4 mL, agar 18 g, distilled water to 1 L.
[0043] Straw degradation medium: corn straw powder 3~5%, NaNO3 2.5 g, KH2PO4 1.5 g, MgSO4·7H2O 0.05 g, CaCl2 1.0 g / L, (NH4)2SO4 3.0 g, CuSO4·5H2O 0.15 g, FeSO4·7H2O 0.02 g, distilled water to 1 L.
[0044] The technical solutions of the present application will be further described below in combination with the drawings and examples:
[0045] Example 1 Isolation and identification of lignocellulose-degrading bacteria
[0046] 1. Isolation and screening of lignocellulose-degrading bacteria
[0047] 1.1 Strain isolation and purification: the applicant collected soil samples from straw-rich cold regions in Wuwei City, Zhuoni County, etc. of Gansu, took an appropriate amount of sample into a 150 mL triangular flask containing sterile water, and shook at 160~180 rpm for 2-6 h. The supernatant was diluted at different gradients, spread on PDA solid medium, and incubated at 20~30℃ for 4~10 d.
[0048] The growth of strains in the plate was observed regularly, and the plate with 6~15 colonies growing in the culture medium was picked in a clean bench and subcultured to obtain single colonies, which were preserved on slant or in glycerol.
[0049] 1.2 Strain preliminary screening: the purified strain was taken with a toothpick and inoculated into different dyeing media, and incubated at 0~30℃ for 10~25 d. The growth of colonies and the color change of dyeing plates were observed regularly. According to the size of the transparent circle around the colony, the strains with cellulase, hemicellulase and ligninase were preliminarily screened, and were preserved in glycerol at-20℃ for standby.
[0050] 1.3 Strain re-screening: the strains obtained by preliminary screening were activated and cultured in PDA liquid medium to obtain seed liquid, which was inoculated into straw degradation medium at an inoculation amount of 5~10%, and each strain was tested in triplicate. The corn straw degradation was observed under the conditions of 15~30℃ and 160~180 rpm shaking culture for 10~20 d, and the fermentation residues were dried and weighed. According to the weight loss rate and degradation rate, the strains with the ability to degrade lignocellulose were further screened.
[0051] 1.4 Isolation and screening results of lignocellulose-degrading bacteria
[0052] Samples were collected from the straw rotting enrichment area, and strains with lignocellulose decomposition were screened with a high probability. The main enrichment strains in the samples were separated and purified through sample enrichment, dilution plating, and streaking subculture. The isolated strains were inoculated into different color-producing media to preliminarily screen strains with lignocellulose-degrading enzymes. According to the size of the transparent circle and the color change, the cellulose-degrading strain F19-1 was further screened. As shown in FIG. 1, the isolated strain F19-1 grew well in the cellulose-congo red solid plate, and the congo red plate faded significantly after 8-10 days of culture. As shown in FIG. 2, there was a significant red-brown color change around the colony in the PDA-guaiacol plate. According to the color change of the plate, it was preliminarily screened that F19-1 had the ability to produce cellulose-degrading enzymes. 50% glycerol was prepared, and the strain was preserved for future use at a ratio of 50% glycerol: bacterial solution of 3:2. Figure 1
[0053] 2. Identification of lignocellulose-degrading strain F19-1
[0054] The identification of the strain mainly used morphological, growth characteristics, and molecular identification and phylogenetic tree construction to determine the species classification of the strain.
[0055] 2.1 Morphological and growth characteristics identification of lignocellulose-degrading strain F19-1: Morphological identification mainly used naked eye and microscope observation, and growth characteristics were investigated in terms of growth cycle, temperature tolerance, etc.
[0056] 2.2 Molecular biology identification of lignocellulose-degrading strain F19-1: The ITS method was used to extract the genome of the preliminarily screened strain F19-1, design primers, and perform PCR amplification. The amplification system is shown in Table 1. The primer sequences are as follows:
[0057] ITS1-F (SEQ ID NO. 1): 5'-TCCGTAGGTGAACCTGCGG-3';
[0058] ITS4-R (SEQ ID NO. 2): 5'-TCCTCCGCTTATTGATATGC-3'.
[0059] Table 1 PCR amplification system
[0060] Reaction components Reaction volume (μl) 10 x Ex Taq buffer 2.0 5u Ex Taq 0.2 2.5mM dNTP Mix 1.6 5p ITS1-F 1 5p ITS4-R 1 Template (DNA) 0.5 ddH2O 13.7 Total 20
[0061] PCR amplification conditions: 95℃ 5 min → (95℃ 30 sec, 56℃ 30 sec, 72℃ 90 sec) 25 cycles → 72℃ 10 min → 10℃ ∞.
[0062] PCR amplification products were detected by nucleic acid electrophoresis, purified and Sanger sequenced to obtain the target gene fragment. Blast alignment was performed in the NCBI (National Center for Biotechnology Information) database.
[0063] 2.3 According to the alignment results, 10-16 ITS homologous sequences were downloaded, Chaetomium globisporum CBS 108.83 was used as an outgroup, MEGA software was used, and ML method was used to construct a developmental phylogenetic tree of F19-1.
[0064] 2.4 Analysis results of lignocellulose degrading bacteria F19-1
[0065] The dominant lignocellulose degrading bacteria F19-1 isolated and screened in Example 1 was activated and cultured in PDA solid medium. The results of naked eye and microscopic observation are shown in Figure 3. F19-1 strain was cultured at 28°C for 3-5 days in PDA plate. The colony in the plate was white, the surface was covered with white aerial mycelium, and then turned to dark yellow. The back of the culture medium was yellow-brown. After staining with lactic acid stone carbonic acid cotton blue staining solution, it was observed under a microscope at 100 times to be blue spherical with multiple protrusions on the edge, with a size of 79.189 μm (Figure 4). The strain F19-1 was cultured in liquid PDA medium at an inoculation amount of 1-2%, at 28°C for 2-5d. The colony grew rapidly, and the morphology was multiple white smooth spherical with a small amount of small granular bacterial balls. It reached the logarithmic and late growth stages. At 10°C and 15°C, the colony growth rate was accelerated, and the growth amount also reached the logarithmic and late growth stages. The colony morphology was basically consistent with that at 28°C. According to the morphological and growth characteristics identification analysis, it was preliminarily judged that the strain F19-1 was a white mycelium producing fungus. After ITS amplification and sequencing of F19-1 strain, sequence analysis showed that the ITS sequence fragment size of F19-1 strain was 552 bp, and the ITS nucleotide sequence (SEQ ID NO. 3) was:
[0066] TGGGACTGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATCGTGAACGTTACCCAAACCGTTGCTTCGGCGGGCGGCGCCCTCGCGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTTACCCAAACTCTTGATACATTATGGCCACTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATCCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGCTTGTGTTGGGGACCTGCGGCTGTCCGCAGGCCCTGAAAACCAGTGGCGGGCTCGCTAGTCACACCGAGCGTAGTAGCATACATCTCGCTCAGGGCGTGCTGCGGGTTCCGGCCGTTAAACGACCTTCATAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCATAAGG.
[0067] According to the ITS sequence information of the F19-1 strain, the phylogenetic tree construction result of F19-1 is shown in Figure 5.
[0068] In summary, the strain F19-1 can be classified into the Niothyriaceae family, has high homology with the Corynascus genus, and has 99.64% sequence homology with Corynascus verrucosus strain SW89, and is determined as Corynascus verrucosus.
[0069] Example 2 Application of Corynascus verrucosus F19-1 in corn straw degradation
[0070] 1 Corynascus_verrucosus F19-1 fermentation culture: prepare straw fermentation degradation medium, sterilize at 121℃ for 20 min. Corynascus_verrucosus F19-1 is inoculated into sterile straw fermentation degradation medium, the inoculation amount is 5~10%, 28℃, 180rpm shake flask culture for 10~20 d.
[0071] 2 Corynascus_verrucosus F19-1 weight loss analysis of corn straw
[0072] The above fermentation culture is subjected to solid-liquid separation, the solid straw residue is washed with water for three times, dried at 105℃ for 2h, and then dried at 80℃ until the weight is constant. After cooling, weigh and record the weight change before and after fermentation, wherein the weight of corn straw before fermentation is M1, and the weight of corn straw after fermentation is M2, in g. The weight loss rate is calculated as shown in formula 1:
[0073] Corn straw weight loss rate X (%) = (M1-M2)*100% / M1 Formula 1
[0074] 3 Corynascus_verrucosus F19-1 degradation of cellulose, hemicellulose and lignin in corn straw: the dried residue in "2 Corynascus_verrucosus F19-1 weight loss analysis of corn straw" is used as a test sample, a certain weight is weighed, and a kit detection method (cellulose, hemicellulose and lignin content detection kit) is used to determine the three components in corn straw. The specific steps are described in the instruction manual. No special steps are changed, and the operation is strictly in accordance with the instruction manual. The calculation of the content of the three components is based on the formula in the instruction manual and is calculated. The content of the three components in the original corn straw is recorded as W1 (mg / g), and the content of the three components in the degraded corn straw is recorded as W2 (mg / g). X represents the percentage of cellulose in the original material (%). The degradation rate is shown in formula 2:
[0075] Relative degradation rate P (%) of three components = [(W1-W2) / (1000+X(%)*10)]*100 / W1 Formula 2
[0076] 4 Corynascus_verrucosus F19-1 degradation application results of corn straw
[0077] The straw degrading strain Corynascus_verrucosus F19-1 screened and identified in Example 1 was applied to corn straw degradation. The weight loss rate and the three components of corn straw, cellulose, hemicellulose and lignin were determined, and the results showed that after fermentation for 10-20 days, compared with before fermentation, the corn straw fermentation residue particles were obviously finer (see Figure 1) Figure 6 , the weight loss rate of Corynascus_verrucosus F19-1 to corn straw decreased by as high as 39.93% (see Figure 2) Figure 7 , the relative degradation rate of cellulose reached 56.90%, the relative degradation rate of hemicellulose reached 35.22%, and the relative degradation rate of lignin was 18.71% (see Figure 3) Figure 8 According to the results, it can be seen that Corynascus_verrucosus F19-1 is a high-efficiency corn straw degrading strain, which is dominant in cellulose degradation, and also has certain hemicellulose and lignin degradation ability.
[0078] The above-described examples only describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art shall fall within the protection scope determined by the claims of the present application.
Claims
1. A Corynascus verrucosus F19-1, characterized in that, The accession number of Corynascus_verrucosusF19-1 is: CCTCC No:M 20251389.
2. The use of Corynascus verrucosus F19-1 as described in claim 1 in the degradation of cellulose, hemicellulose and / or lignin.
3. The application of Corynascus verrucosus F19-1 as described in claim 1 in the degradation of corn stalks.
4. The use of Corynascus verrucosus F19-1 as described in claim 1 in the preparation of microbial agents for degrading cellulose, hemicellulose and / or lignin.
5. A microbial inoculant, characterized in that, The microbial agent includes Corynascus verrucosus F19-1 as described in claim 1.
6. The application of the microbial agent as described in claim 5 in the degradation of corn stalks.
7. The use of the microbial agent as described in claim 5 in the degradation of cellulose, hemicellulose and / or lignin.
Citation Information
Patent Citations
Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CN105861469A
Novel cell wall deconstruction enzymes of chaetomium thermophilum, thermomyces stellatus, and corynascus sepedonium, and uses thereof
WO2015109405A1