Plant genetic transformation method based on haploid induction line

Abstract

The invention discloses a plant genetic transformation method based on a haploid induction line. According to the invention, a haploid immature embryo obtained by utilizing a haploid induction line containing a visual marker is transformed, so that a rapid homozygosis method of transgenic and gene editing plants is realized; comprising the following steps: (1) hybridizing a homozygous haploid induction line with an embryo part color mark as a male parent with other varieties of plants to obtain hybrid F1-generation seeds, and identifying haploid and diploid immature embryos according to the embryo part color of the F1-generation seeds; and 2) carrying out genetic transformation on the haploid immature embryo to obtain a T0-generation haploid transgenic plant, and doubling the obtained T0-generation haploid transgenic plant by using a doubling reagent so as to rapidly obtain a homozygous transgenic or gene editing plant. The method disclosed by the invention has important significance on wheat haploid breeding, DH population construction, gene positioning, target gene function research and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a plant genetic transformation method based on a haploid induction line. Background Art

[0002] Wheat is one of the world's most important food crops, providing food for nearly one-third of the world's population. Improving its yield and quality through genetic engineering is of great strategic significance for ensuring global food security and promoting sustainable agricultural development. Transgenic technology has become a powerful tool for functional gene analysis and trait improvement. When combined with traditional breeding methods, it provides a promising strategy for wheat variety development. A key challenge in wheat transgenic and gene editing research is the rapid generation of homozygous lines for phenotypic verification. Due to the presence of three subgenomes (A, B, and D) containing numerous functionally redundant homologous genes, multiple generations of selfing are required to stabilize transgenic and gene-edited traits (Zhang et al., 2016; Howells et al., 2018). Haploid induction followed by chromosome doubling provides a rapid route to generate homozygous lines, which is important for fixation of target traits and construction of genetic populations (Fu et al., 2022).

[0003] Traditional wheat haploid induction methods, including anther culture, microspore culture, and chromosome elimination using maize pollen, are limited by low efficiency, strong genotype dependence, and technical complexity, making them difficult to apply on a large scale in breeding practices. Previous attempts to directly transform haploid tissues (such as anthers or callus) using Agrobacterium or biolistic bombardment have failed to yield transgenic haploid wheat (Brisibe et al., 2000; Amoah et al., 2001). To date, no studies have reported successful transformation of haploid embryos in any plant species. This leaves a critical technical gap in wheat functional genomics research, necessitating the development of a rapid and stable genetic method for transforming haploid immature embryos to achieve transgenic and gene-edited wheat. Summary of the Invention

[0004] The object of the present invention is to provide a plant genetic transformation method based on a haploid induction line.

[0005] A plant genetic transformation method based on a haploid induction line is carried out according to the following steps: 1) Haploid induction and identification: Using a wheat haploid induction line carrying a visible marker gene and a haploid induction gene as the male parent, hybridizing with a wheat variety to obtain hybrid F1 grains. Haploid and diploid grains are distinguished by the color of the embryo. 2) Transformation of haploid embryos: Collect haploid embryos 15-18 days after hybridization and transfer the target gene or gene editing vector via Agrobacterium-mediated transfection. 3) Regeneration and identification of transgenic plants: Induce callus tissue and regenerate plants on a culture medium containing a selection agent. Identify T0 generation transgenic positive plants through PCR, histochemical staining, and phenotypic observation. 4) Chromosome doubling: Treat T0 generation haploid transgenic plants with colchicine or propionamide to obtain homozygous doubled haploid plants. Verify ploidy by flow cytometry and chromosome counting.

[0006] Step 1) The visual marker gene is a purple embryo gene marker, including ZmC1 and ZlUT Gene. ZmC1 and ZlUT Genetic marker for the color of the embryonic part of the grain.

[0007] Step 1) The haploid induction gene is MTL Homologous genes, PLD3 Gene or DMP Gene.

[0008] Step 1) The wheat haploid induction line is a haploid induction line HIPE with purple embryos; the wheat variety is Fielder.

[0009] In step 1), the haploid is white and the diploid is purple.

[0010] Step 2) The target gene is GUS and / or Ruby .

[0011] Step 2) The gene editing vector is targeted TaWaxy CRISPR / Cas9 system for gene editing.

[0012] Step 3) The histochemical staining is GUS dyeing.

[0013] Step 3) The phenotypic observation is Ruby Red mark.

[0014] The plant is wheat, corn, rice, barley, millet, tomato or Arabidopsis thaliana.

[0015] The beneficial effects of the present invention are that wheat haploid embryos are very easy to transfer genes through Agrobacterium-mediated transformation, thereby efficiently delivering transgenic and gene-editing vectors. In the T1 generation, doubled haploid (DH) transgenic and gene-edited plants were analyzed by phenotypic assessment, histochemical staining, PCR, PCR / RE, and sequencing. No Ruby or GUS Segregation of transgenics, all TaWaxy All mutations were stably inherited, with no additional mutations present, confirming the genetic stability and heritability of the edited genes in the T0 generation. Therefore, the present invention can be used for Agrobacterium-mediated transformation experiments using haploid immature wheat embryos as explants, thereby achieving rapid and stable inheritance of transgenic and gene-edited wheat, significantly shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 These are the results of identifying F1 embryos from hybrids using HIPE as the male parent and other wheat varieties; Ha is a haploid and Di is a diploid.

[0017] Figure 2 is the linearized vector graph; (a): pWMB110-Ruby ; (b): pWMB110-GUS ; (c): pWMB110- SpCas9-TaWaxy ; Ubi : ubiquitin promoter; NLS: nuclear localization signal. Nos : Nos terminator; TaU3 :wheat U3 promoter; 35S : Cauliflower mosaic virus 35S promoter; bar : Glufosinate-resistance gene.

[0018] Figure 3 Flow cytometric analysis of callus ploidy; Ha represents haploid; Di represents diploid.

[0019] Figure 4 These are the chromosome identification results of transgenic haploid, doubled haploid and diploid control plants; Ha is haploid; Di is diploid.

[0020] Figure 5 T0 generation transgenic plants bar PCR identification results of the gene; M: DL2000 DNA marker; 1: positive control; 2: wild-type Fielder (negative control); 3-10: T0 generation haploid transgenic plants.

[0021] Figure 6 For T0 generation haploid and double haploid plants GUS Gene PCR test results; M: DL5000 DNA marker; 1, positive control (containing pWMB110-GUS expression vector); 2, negative control: wild-type Fielder plants; 3-10, T0 generation plants.

[0022] Figure 7For T0 generation haploid and doubled haploid plants Ruby Gene PCR test results; M: DL5000 DNA marker; 1, positive control (containing pWMB110-Ruby expression vector); 2, negative control: wild-type Fielder plants; 3-10: T0 generation plants.

[0023] Figure 8 The results of histochemical staining are shown in Figure 2. GUS The expression of WT and WT cells was compared with that of the control group.

[0024] Figure 9 for Ruby Phenotypic comparison of the gene in T0 generation plants and the control group; bar = 10 cm.

[0025] Figure 10 T1 transgenic plants GUS and Ruby PCR identification of genes; (a) GUS Genetic testing; (b) Ruby Genetic testing; M: DL5000 DNA marker; 1: GUS and Ruby From containing GUS and Ruby Amplified from a plasmid containing an expression vector (positive control); 2: wild-type Fielder (negative control); 3-10: T1 generation doubled haploids GUS or Ruby Genetically modified plants.

[0026] Figure 11 T0 generation transgenic plants Cas9 PCR identification results of the gene; M: DL2000 DNA marker; 1: positive control; 2: wild-type Fielder (negative control); 3-10: T0 generation haploid transgenic plants.

[0027] Figure 12 T0 generation transgenic plants TaWaxy PCR / RC detection results of genes; M: DL2000 DNA marker; a and b: T0 generation transgenic plants TaWaxy-7A and TaWaxy-7D PCR / RC test results of the gene; 1, PCR amplification product of the control plant without enzyme digestion; 2, PCR amplification product of the control plant after restriction endonuclease Bgl II enzyme digested PCR amplification products; 3-10, restriction endonucleases Bgl PCR amplification products of T0 plants digested with enzyme II.

[0028] Figure 13 for TaWaxy - gW830 Representative mutation types of the site; red font is PAM region; blue font is sgRNA ; “-” indicates base deletion; the rightmost side indicates the number of missing bases.

[0029] Figure 14 T0 generation transgenic wheat plants TaWaxy Sanger sequencing peak diagram identification results of gene mutations.

[0030] Figure 15 For the T0 generation TaWaxy Comparison of I2-KI staining of mature grains of the gene-edited mutant and wild-type Fielder (left).

[0031] Figure 16 T1 generation transgenic plants TaWaxy PCR / RC detection results of gene editing; (a) TaWaxy-7A Gene; (b) TaWaxy-7D gene; M: DL2000 DNA marker; 1, PCR amplification product of control plant without enzyme digestion; 2, PCR amplification product of control plant after restriction endonuclease digestion Bgl II enzyme digested PCR amplification products; 3-10, restriction endonucleases Bgl PCR amplification products of T1 plants digested with enzyme II. DETAILED DESCRIPTION

[0032] To facilitate understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0033] The wheat variety used in the following examples is Fieder, which can be obtained from the National Crop Germplasm Resource Bank of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The haploid induced line with purple embryos (HIPE) was previously developed by our laboratory using a bidirectional promoter specifically expressed in the embryo and aleurone layer. pBD68 (Provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences), driving the anthocyanin gene in maize ZlUT Genes and ZmC1 Gene expression, purple embryo plants obtained and wheat mtl-ABD Homozygous mutants were crossed and the F2 and F 2-3 Generation was identified to obtain ZlUT Genes and ZmC1 genetic mtl-ABDHomozygous mutants were used as the male parent to obtain hybrid F1 generation grains, and haploid grains were quickly identified by the color of the grain embryo (Tang et al., 2023. A fast technique for visual screening of wheat haploids generated from TaMTL-edited mutants carrying anthocyanin markers, Plant Communications, 3.).

[0034] The sources of the plasmids and strains mentioned in the experimental examples are as follows: The plant gene editing vector pWMB110-Cas9-TaWaxy is described in the following literature: Liu et al. 2020 Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium -mediated CRISPR system.Journal of Experimental Botany, 71:1337-1349. Plant expression vector pWMB110-Ruby and pWMB110-GUS Described in the following references: Shi K, Huang WH, Zhu MX, Teng SZ, Zhang JL, DuanZZ, Zhu CC, Hu T, Wang K, Wang Z. Efficient genetic transformation and genome editing via an Agrobacterium ‐mediated in commercial oat( Avena sativa L.) cultivars. Journal of Integrative Plant Biology, 2025, 67(7): 1697-1699. Example 1

[0035] (I) Haploid induction and identification During the flowering stage of wheat, the purple embryo marker ( ZmC1 and ZlUT The wheat haploid induced line (HIPE) with a gene (such as β-catenin) is used as the male parent and hybridized with wheat varieties (such as Fielder) to obtain the hybrid F1 generation. After hybridization, the haploid (white) and diploid (purple) can be distinguished by the color of the grain embryo.

[0036] (II) Genetic transformation of haploid embryos Take the F1 generation young seeds 15-18 days after hybridization, sterilize them with 75% alcohol for 1 minute, 15% sodium hypochlorite for 8 minutes, and wash them with sterile water three times. Peel off the embryos in the clean bench and select the haploid (white) embryos by the color of the embryo part. Figure 1 ), will contain Figure 2 Medium vector plasmid ( pWMB110-Ruby and pWMB110-GUS Vector) was used to infect and transform wheat haploid immature embryos.

[0037] The specific operations are as follows: 1) Before infection, pWMB110-Ruby and pWMB110-GUS Add Kana 50mg L to the Agrobacterium of the carrier -1 The cells were cultured in YEP liquid medium at 200 rpm and shaken overnight at 28°C in the dark.

[0038] 2) Centrifuge at 3,500 rpm for 10 min at room temperature to collect Agrobacterium cells. Discard the supernatant and resuspend in MS medium (1 / 10 MS basic medium (Beijing Ximeijie Technology Co., Ltd., Cat. No.: M519, glucose 10 g L) at a rate of 1 mL cells / mL. -1 )], resuspend the bacterial pellet and obtain pWMB110-Ruby and pWMB110-GUS Resuspension of Agrobacterium GV3101 containing the vector.

[0039] 3) Select the F1 generation embryos 15-18 days after interbreeding and use pWMB110-Ruby and pWMB110-GUS The vector was infected with Agrobacterium tumefaciens GV3101 resuspension and then plated on AS basic co-culture medium (1 / 2 MS basic culture medium, glucose 10 g L -1 , agar 8 g L -1 ) and cultured at 25℃ for 3 days.

[0040] 4) Transfer the co-cultured embryos to the recovery medium WLS-RES (MS basic medium, 2,4-D 0.5 mg / L -1 , picloram 2.2 mg L -1 , Cb (carbenicillin) 400 mg L -1 , Cef (cephalosporin) 100 mg L -1 ) and cultured in darkness for 5 days.

[0041] 5) After recovery, transfer the immature embryos to the first screening medium WLS-P5 (MS basic medium, 2,4-D 0.5 mg L-1 , picloram 2.2 mg L -1 , PPT (glufosinate) 15 mg L -1 、Cb 400 mg L -1 、Cef 100 mg L -1 ) and cultured in darkness for 14 days.

[0042] 6) The calli were then transferred to the first screening medium WLS-P10 (MS basic medium, 2,4-D 0.5 mg / L -1 , picloram 2.2 mg L -1 , PPT 10 mg L -1 、Cb 400 mg L -1 ) were cultured in darkness for 21 days.

[0043] 7) Transfer the above callus to differentiation medium LSZ-P5 (MS basic medium, PPT 5 mg L -1 ) and cultured under light for 2 weeks.

[0044] 8) Separate the wheat green shoots and place them on rooting medium MSF-P5 (MS medium, PPT 5 mg L -1 、IBA 0.5mg L -1 ) and cultured for 21 days.

[0045] Transplant the seedlings with grown roots into the soil and get pWMB110-Ruby and pWMB110-GUS The transgenic plants (respectively pWMB110-Ruby / Agrobacterium GV3101 infection resuspension and pWMB110-GUS / Agrobacterium GV3101 infection resuspension infection).

[0046] (III) Regeneration and identification of transgenic plants Callus tissue was induced and plants were regenerated on a culture medium containing a selection agent. The ploidy of the transformed callus tissue and regenerated plants was identified. The callus tissue was analyzed for ploidy by flow cytometry by Jindi Future Biotechnology (Beijing) Co., Ltd. ( Figure 3 ), the chromosome number of the transgenic plants before doubling was identified using the droplet method ( Figure 4 ), the specific steps are as follows: (1) When the transgenic seedlings grow to about 10 cm in height, select the candidate seedlings from the culture tank, cut a 1 cm long root tip, and place it in a 0.5 mL centrifuge tube that has been moistened with a watering can in advance and has a small hole drilled on the top. Place it on ice. After taking the root tip, place the transgenic seedling back into the original culture tank; then place the centrifuge tube containing the root tip sample in the nitrous oxide tank, let it in for about 3 minutes, close the air inlet valve, and after 2 hours of treatment, remove the centrifuge tube from the nitrous oxide tank and place it on ice; (2) Fix the root apex with 90% acetic acid for 5 minutes, then wash it with clean water three times; place it in 70% ethanol and store it in a -20℃ refrigerator until use.

[0047] (3) Remove the root tip with tweezers, place it on filter paper to absorb moisture, cut the milky white part of the root tip on a glass slide, and place it in the enzymatic solution prepared in advance and incubate in a 37°C water bath for 50 minutes; (4) After enzymatic hydrolysis, the root apex was washed twice with a small amount of 70% alcohol. 60 μL of alcohol was added and the root apex was crushed with a dissecting needle and dissolved in the alcohol in the tube. Centrifuge at 6000 rpm for 2 min, discard the supernatant, and invert at room temperature for a few minutes. (7) Add 30 μL of 100% acetic acid to the above centrifuge tube and gently vortex it on a vortex machine to mix it thoroughly.

[0048] (8) Prepare a paper box in advance, wet it with clean water, and place a glass slide in the box. Use a pipette to draw 7 μL of the suspension prepared in step 6 and drop it on the glass slide. (9) Chromosome samples were stained with 4',6-diamidino-2-phenylindole (DAPI) and then observed under a BX61 fluorescence microscope (Olympus, Tokyo, Japan). Figure 4 ).

[0049] It has been verified that before doubling, Figure 3 、 4 In the chromatin, the haploid has a peak at FLC=50 and has 21 chromosomes, while the diploid has a peak at FLC=100 and has 42 chromosomes.

[0050] (IV) Double treatment of haploid transgenic seedlings Before transplanting, the transgenic plants were treated by adding 10 mM colchicine to the surface of the culture medium. Thirty-two hours after the chromosome doubling treatment, the seedlings were removed from the culture medium, rinsed with running water for 3 minutes, and then transferred to pots for cultivation in a culture chamber.

[0051] (V) Identification of T0 generation transgenic positive plants (1) Extraction of genomic DNA from wheat T0 transgenic plants The steps for extracting genomic DNA from wheat T0 transgenic plants were carried out according to the instructions of the plant DNA extraction kit (CW0531M NuClean Plant Genomic DNA Kit) produced by Jiangsu Kangwei Century Biotechnology Co., Ltd.

[0052] (2) Detection of T0 generation overexpression vector transgenic plants use bar (Depend on bar-F and bar-R composition), GUS (Depend on GUS-F and GUS-R composition) and Ruby (Depend on Ruby-F and Ruby-R The T0 generation transgenic plants were tested using gene-specific primers (specific for the gene composition) to screen for transgenic-positive plants. Primers were synthesized by Shanghai Sangong Biotechnology Co., Ltd.; 2× Es Taq MasterMix (Dye) (CW0690L) used in PCR was purchased from CWBIO Reagent Co., Ltd. The primer sequences are as follows: bar-F : ACCATCGTCAACCACTACATCG (SEQ ID NO: 1); bar-R :GCTGCCAGAAACCCACGTCATG (SEQ ID NO: 2); GUS-F :CGAAAGCAAGCTGACCGACA (SEQ ID NO: 3); GUS-R :GTACGGATAGTGTGCGGTCC (SEQ ID NO: 4); Ruby-F :TTTAGCCCTGCCTTTCATACGCT (SEQ ID NO: 5); Ruby-R :CGAGCCTTCTTCTAATGCCAGAT (SEQ ID NO: 6).

[0053] The specific PCR amplification conditions are as follows: bar Gene: Pre-denaturation at 95 ºC for 5 min; then perform the following three reaction procedures: (1) denaturation: 95 ºC / 30 s, (2) annealing: 60 ºC / 20 s, (3) extension: 72 ºC / 20 s, for a total of 28 cycles; finally extension at 72 ºC for 5 min.

[0054] GUSGene: Pre-denaturation at 95 ºC for 5 min; then perform the following three reaction procedures: (1) denaturation: 95 ºC / 30 s, (2) annealing: 60 ºC / 20 s, (3) extension: 72 ºC / 1 min, for a total of 35 cycles; finally extension at 72 ºC for 5 min.

[0055] Ruby Gene: Pre-denaturation at 95 ºC for 5 min; then perform the following three reaction procedures: (1) denaturation: 95 ºC / 30 s, (2) annealing: 60 ºC / 20 s, (3) extension: 72 ºC / 1 min, for a total of 35 cycles; finally extension at 72 ºC for 5 min.

[0056] The PCR products were analyzed using 1% agarose gel. Figure 5 、 6 and 7. From Figure 5 It can be seen that all the transgenic plants in the T0 generation were positive; Figure 6 Lanes 3, 6, 8-10 are transfected GUS gene-positive plants; Figure 7 Lanes 4, 6, and 7 indicate the Ruby Gene-positive plants.

[0057] (3) Phenotypic identification of T0 generation overexpression vector transgenic plants Counter-rotation pWMB110-GUS Gene-positive plant leaves were histochemically stained and identified. Fresh leaves were placed in a 2 mL centrifuge tube containing GUS staining solution (Biorigin (Beijing) Inc.) and incubated overnight in a 37°C oven. They were then washed three times with anhydrous ethanol, and the staining results were observed and photographed. Figure 8 ).from Figure 8 It can be seen that the turn GUS The leaves of gene-positive plants showed a distinct blue color, while the leaves of the wild-type control Fielder could not be stained blue.

[0058] change pWMB110-Ruby Gene-positive plants showed distinct red color on leaves, stems and spikes ( Figure 9 ).

[0059] (VI) Identification of T1 generation transgenic plants In the T1 generation, double haploid transgenic plants were analyzed by phenotypic evaluation, histochemical staining, PCR and other methods. Ruby or GUS Isolation of genes ( Figure 10 ), indicating that the transgenic plants obtained were homozygous. Example 2

[0060] (I) Haploid induction and identification During the flowering stage of wheat, the purple embryo marker ( ZmC1 and ZlUT The wheat haploid induced line (HIPE) with a gene (such as β-catenin) is used as the male parent and hybridized with wheat varieties (such as Fielder) to obtain the hybrid F1 generation. After hybridization, the haploid (white) and diploid (purple) can be distinguished by the color of the grain embryo.

[0061] (II) Genetic transformation of haploid embryos Take the F1 generation young seeds 15-18 days after hybridization, sterilize them with 75% alcohol for 1 minute, 15% sodium hypochlorite for 8 minutes, and wash them with sterile water three times. Peel off the embryos in the clean bench and select the haploid (white) embryos by the color of the embryo part. Figure 1 ), will contain Figure 2 Medium vector plasmid ( pWMB110-SpCas9-TaWaxy Vector) was used to infect and transform wheat haploid immature embryos.

[0062] The specific operations are as follows: 1) Before infection, pWMB110-SpCas9-TaWaxy Add 50 mg / L Kana to the Agrobacterium containing the vector -1 The cells were cultured in YEP liquid medium at 200 rpm and shaken overnight at 28°C in the dark.

[0063] 2) Centrifuge at 3,500 rpm for 10 min at room temperature to collect Agrobacterium cells. Discard the supernatant and resuspend in MS medium (1 / 10 MS basic medium (Beijing Ximeijie Technology Co., Ltd., Cat. No.: M519, glucose 10 g L) at a rate of 1 mL cells / mL. -1 )], resuspend the bacterial pellet and obtain pWMB110-SpCas9-TaWaxy / Agrobacterium GV3101 resuspension.

[0064] 3) Select the F1 generation embryos 15-18 days after interbreeding and use pWMB110-SpCas9-TaWaxy / Agrobacterium GV3101 resuspension for infection, and then spread on AS basic co-culture medium (1 / 2 MS basic culture medium, glucose 10 gL -1 , agar 8 g L -1 ) and cultured at 25℃ for 3 days.

[0065] 4) Transfer the co-cultured embryos to the recovery medium WLS-RES (MS basic medium, 2,4-D 0.5 mg / L -1 , picloram 2.2 mg L -1 , Cb (carbenicillin) 400 mg L -1, Cef (cephalosporin) 100 mg L -1 ) and cultured in darkness for 5 days.

[0066] 5) After recovery, transfer the immature embryos to the first screening medium WLS-P5 (MS basic medium, 2,4-D 0.5 mg L -1 , picloram 2.2 mg L -1 , PPT (glufosinate) 15 mg L -1 、Cb 400 mg L -1 、Cef 100 mg L -1 ) and cultured in darkness for 14 days.

[0067] 6) The calli were then transferred to the first screening medium WLS-P10 (MS basic medium, 2,4-D 0.5 mg / L -1 , picloram 2.2 mg L -1 , PPT 10 mg L -1 、Cb 400 mg L -1 ) were cultured in darkness for 21 days.

[0068] 7) Transfer the above callus to differentiation medium LSZ-P5 (MS basic medium, PPT 5 mg L -1 ) and cultured under light for 2 weeks.

[0069] 8) Separate the wheat green shoots and place them on rooting medium MSF-P5 (MS medium, PPT 5 mg L -1 、IBA 0.5mg L -1 ) and cultured for 21 days.

[0070] Transplant the seedlings with grown roots into the soil and get pWMB110-SpCas9-TaWaxy Transgenic plants (by pWMB110-SpCas9-TaWaxy / obtained by infection with Agrobacterium GV3101 infection resuspension).

[0071] (III) Regeneration and identification of transgenic plants Callus tissue was induced and plants were regenerated on a culture medium containing a selection agent. The ploidy of the transformed callus tissue and regenerated plants was identified. The callus tissue was analyzed for ploidy by flow cytometry by Jindi Future Biotechnology (Beijing) Co., Ltd. ( Figure 3 ), the chromosome number of the transgenic plants before doubling was identified using the droplet method ( Figure 4 ), the specific steps are as follows: (1) When the transgenic seedlings grow to about 10 cm in height, select the candidate seedlings from the culture tank, cut a 1 cm long root tip, and place it in a 0.5 mL centrifuge tube that has been moistened with a watering can in advance and has a small hole drilled on the top. Place it on ice. After taking the root tip, place the transgenic seedling back into the original culture tank; then place the centrifuge tube containing the root tip sample in the nitrous oxide tank, let it in for about 3 minutes, close the air inlet valve, and after 2 hours of treatment, remove the centrifuge tube from the nitrous oxide tank and place it on ice; (2) Fix the root apex with 90% acetic acid for 5 minutes, then wash it with clean water three times; place it in 70% ethanol and store it in a -20℃ refrigerator until use.

[0072] (3) Remove the root tip with tweezers, place it on filter paper to absorb moisture, cut the milky white part of the root tip on a glass slide, and place it in the enzymatic solution prepared in advance and incubate in a 37°C water bath for 50 minutes; (4) After enzymatic hydrolysis, the root apex was washed twice with a small amount of 70% alcohol. 60 μL of alcohol was added and the root apex was crushed with a dissecting needle and dissolved in the alcohol in the tube. Centrifuge at 6000 rpm for 2 min, discard the supernatant, and invert at room temperature for a few minutes. (7) Add 30 μL of 100% acetic acid to the above centrifuge tube and gently vortex it on a vortex machine to mix it thoroughly.

[0073] (8) Prepare a paper box in advance, wet it with clean water, and place a glass slide in the box. Use a pipette to draw 7 μL of the suspension prepared in step 6 and drop it on the glass slide. (9) Chromosome samples were stained with 4',6-diamidino-2-phenylindole (DAPI) and then observed under a BX61 fluorescence microscope (Olympus, Tokyo, Japan). Figure 4 ).

[0074] It has been verified that before doubling, Figure 3 、 4 In the chromatin, the haploid has a peak at FLC=50 and has 21 chromosomes, while the diploid has a peak at FLC=100 and has 42 chromosomes.

[0075] (IV) Double treatment of haploid transgenic seedlings Before transplanting, the transgenic plants were treated by adding 10 mM colchicine to the surface of the culture medium. Thirty-two hours after the chromosome doubling treatment, the seedlings were removed from the culture medium, rinsed with running water for 3 minutes, and then transferred to pots for cultivation in a culture chamber.

[0076] (V) Identification of T0 generation transgenic plants (1) Extraction of genomic DNA from T0 generation gene-edited wheat plants The steps for extracting genomic DNA from wheat T0 transgenic plants were carried out according to the instructions of the plant DNA extraction kit (CW0531M NuClean Plant Genomic DNA Kit) produced by Jiangsu Kangwei Century Biotechnology Co., Ltd.

[0077] (2) Detection of T0 generation gene editing vector transgenic plants use Cas9 (Depend on Cas9-F and Cas9-R The T0 generation transgenic plants were tested using gene-specific primers (specific for the gene composition) to screen for transgenic-positive plants. Primers were synthesized by Shanghai Sangong Biotechnology Co., Ltd.; 2× Es Taq MasterMix (Dye) (CW0690L) used in PCR was purchased from CWBIO Reagent Co., Ltd. The primer sequences are as follows: Cas9-F :ACCTGAACGCGGTGGTCGGCA (SEQ ID NO: 7); Cas9-R :GTCGCCCCCGAGCTGAGACAGG (SEQ ID NO: 8).

[0078] Cas9 Gene: Pre-denaturation at 95 ºC for 5 min; then perform the following three reaction procedures: (1) denaturation: 95 ºC / 30 s, (2) annealing: 55 ºC / 20 s, (3) extension: 72 ºC / 1 min, for a total of 35 cycles; finally extension at 72 ºC for 5 min.

[0079] The PCR products were analyzed using 1% agarose gel. Figure 11 As shown. Figure 11 It can be seen that lanes 3, 4, 5, 7, 8, and 10 are Cas9 Gene-positive plants.

[0080] Then use TaWaxy-7A and TaWaxy-7D Specific primers for the above Cas9 Gene-positive plants were tested by PCR / PCR to identify the edited type of the plants. Primers were synthesized by Shanghai Sangong Company; 2×Es TaqMasterMix (Dye) (CW0690L) used in PCR was purchased from CWBIO Reagent Company. The primer sequences are as follows: TaWaxy-7A-F :GCAAAGCAGGAAACCGCACCGATT (SEQ ID NO: 9); TaWaxy-7A-R: AGTTGTTCTTGATCTTACCGTAGG (SEQ ID NO: 10); TaWaxy-7D-F :GTGCCTCTCCATGGTGGTGCCGG (SEQ ID NO: 11); TaWaxy-7D-R :TGGTGATCATCCAGCTCTCTC (SEQ ID NO: 12).

[0081] TaWaxy-7A Gene: Pre-denaturation at 95°C for 5 min; then perform the following three reaction procedures: (1) denaturation: 95°C / 30s, (2) annealing: 54°C / 20s, (3) extension: 72°C / 1 min, for a total of 35 cycles; finally, extension at 72°C for 5 min.

[0082] TaWaxy-7D Gene: Pre-denaturation at 95°C for 5 min; then perform the following three reaction procedures: (1) denaturation: 95°C / 30s, (2) annealing: 64°C / 20s, (3) extension: 72°C / 1 min, for a total of 35 cycles; finally, extension at 72°C for 5 min.

[0083] Then use Bgl The PCR product was digested with restriction endonuclease II and incubated in a 37°C water bath overnight.

[0084] The enzyme digestion products were analyzed using 1% agarose gel. The electrophoresis results were as follows: Figure 12 As shown. Figure 12 a As can be seen from lanes 3, 5, 6, and 8, TaWaxy-7A Homozygous edited plants; Figure 12 b As can be seen, lanes 3, 5, 6, and 8 are TaWaxy-7B Homozygous edited plants. Sanger sequencing was then used to further sequence and analyze the PCR products of the homozygous edited plants ( Figure 13 、 14 ), sequencing results showed that all the gene-edited plants obtained were homozygous edited, mainly with deletions of 1-20 bp upstream of the PAM region on the sgRNA target site.

[0085] (3) Phenotypic identification of T0 generation gene-edited plants because TaWaxy The gene controls the synthesis of amylopectin, and amylopectin turns blue when exposed to potassium iodide. TaWaxy The cross sections of the mature grains of the mutants were stained with potassium iodide (I2-KI) to identify the changes in amylopectin in the grains. Figure 15It can be seen that the mutant kernels exhibited a reddish-brown color compared to the bluish-black color observed in the wild-type control, indicating altered starch properties.

[0086] (VI) Identification of T1 generation gene-edited plants In the T1 generation, double haploid gene-edited plants were analyzed by phenotypic evaluation PCR / RE and other methods. TaWaxy The mutations were all stably inherited, confirming that the T0 generation transgenic plants were all homozygous and genetically stable ( Figure 16 ).

[0087] These results indicate that haploid wheat immature embryos are highly suitable for Agrobacterium-mediated genetic transformation, can effectively deliver transgenic and genome editing vectors, and directly obtain transgenic and gene-edited homozygotes, greatly shortening the time of biological breeding.

[0088] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. A plant genetic transformation method based on a haploid induction line, characterized in that: Follow these steps: 1) Haploid induction and identification: Using a wheat haploid induction line carrying a visible marker gene and a haploid induction gene as the male parent, hybridizing with a wheat variety to obtain hybrid F1 grains. Haploid and diploid grains are distinguished by the color of the embryo. 2) Transformation of haploid embryos: Collect haploid embryos 15-18 days after hybridization and transfer the target gene or gene editing vector via Agrobacterium-mediated transfection. 3) Regeneration and identification of transgenic plants: Induce callus tissue and regenerate plants on a culture medium containing a selection agent. Identify T0 generation transgenic positive plants through PCR, histochemical staining, and phenotypic observation. 4) Chromosome doubling: The T0 generation haploid transgenic plants were treated with colchicine or propionamide to obtain homozygous doubled haploid plants. The ploidy was verified by flow cytometry and chromosome counting.

2. The plant genetic transformation method based on the haploid induction line according to claim 1, characterized in that: Step 1) The visual marker gene is a purple embryo gene marker, including ZmC1 and ZlUT Gene.

3. The plant genetic transformation method based on the haploid induction line according to claim 1, characterized in that: Step 1) The haploid induction gene is MTL Homologous genes, PLD3 Gene or DMP Gene.

4. The plant genetic transformation method based on haploid induction line according to claim 1, characterized in that: Step 1) The wheat haploid induction line is a haploid induction line HIPE with purple embryos; the wheat variety is Fielder.

5. The plant genetic transformation method based on haploid induction line according to claim 1, characterized in that: In step 1), the haploid is white and the diploid is purple.

6. The method for plant genetic transformation based on haploid induction lines according to claim 1, characterized in that: Step 2) The target gene is GUS and / or Ruby .

7. The plant genetic transformation method based on haploid induction line according to claim 1, characterized in that: Step 2) The gene editing vector is targeted TaWaxy CRISPR / Cas9 system for gene editing.

8. The plant genetic transformation method based on haploid induction line according to claim 1, characterized in that: Step 3) The histochemical staining is GUS dyeing.

9. The plant genetic transformation method based on haploid induction line according to claim 1, characterized in that: Step 3) The phenotypic observation is Ruby Red mark.

10. The plant genetic transformation method based on haploid induction line according to claim 1, characterized in that: The plant is wheat, corn, rice, barley, millet, tomato or Arabidopsis thaliana.

Images