A SNP molecular marker related to snapper anti-streptococcus iniae disease and application thereof

Abstract

The application discloses a SNP molecular marker related to the resistance of yellowfin snapper to streptococcus iniae disease, which is characterized by being located at the 10398424th base of the 5th chromosome of the yellowfin snapper; the sequence of the SNP molecular marker is shown as SEQ ID NO:1, and the 251th base from the 5' end is G or A; the resistance of the individual with the GG or GA genotype to the streptococcus iniae disease is higher than that of the individual with the AA genotype. The application further discloses primers, a kit for detecting the SNP molecular marker, a method for breeding the yellowfin snapper with the resistance to the streptococcus iniae disease, and the application of the above-mentioned primers, the kit and the method in breeding the yellowfin snapper with the resistance to the streptococcus iniae disease.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology for aquatic animals, specifically relating to a SNP molecular marker for yellowfin seabream that is associated with resistance to streptococcal disease in dolphins and its application. Background Technology

[0002] Yellowfin seabream ( Acanthopagrus latus ), also known as yellowfin or yellowfoot, belongs to the perch family ( Pencoidei Seabream (family: seabream) Sparidae ) genus *Spinytail* Acanthopagrus This fish, widely distributed along the coast of my country, is an important economic fish species with great potential for aquaculture in recent years in the South China coastal region. It is rich in nutrients, has delicious meat, and is highly adaptable to aquaculture, making it a highly valuable economic species. In both marine and brackish water aquaculture, it has become a leading species supporting farmers' income and generating significant economic benefits.

[0003] With the intensive development of aquaculture, disease problems have become increasingly prominent, becoming a key bottleneck restricting the industry's green and high-quality development. Among these, *Streptococcus dolphinus* is a significant pathogen affecting yellowfin seabream farming, infecting over 40 species of fish, including the yellowfin seabream. Yellowfin seabream infected with *Streptococcus dolphinus* often exhibit acute symptoms, specifically: rapid death, no typical external symptoms, and autopsy revealing hepatic hemorrhage and enlargement, blackened spleen, and ascites. A few cases present with subacute infection, exhibiting fin erosion, fin base hemorrhage, congested and detached eyes, anal swelling, and cerebral congestion, in addition to visceral abnormalities. This *Streptococcus dolphinus* disease has a rapid onset and high mortality rate, easily causing "pond collapses" within a short period, resulting in significant economic losses for the aquaculture industry.

[0004] Currently, antibiotics and vaccines are the main means of controlling streptococcal disease in dolphins, but these methods have significant limitations: 1) Antibiotics are prone to leaving residues in fish, leading to antibiotic resistance in pathogens and environmental pollution, thus their application is strictly limited; 2) Vaccines are difficult to cope with strain variations, resulting in unstable control effects. Therefore, improving the disease resistance of breeds at the genetic level—that is, cultivating superior breeds through disease-resistant breeding—is the fundamental way to solve the disease problem.

[0005] Traditional breeding techniques have poor predictability, long breeding cycles, and difficulty in controlling variation direction due to lack of analysis of genetic structure and molecular mechanism of disease resistance traits. In contrast, molecular marker-assisted breeding technology can achieve precise selection through molecular markers associated with disease resistance traits, significantly improving breeding efficiency. Genome-wide association study (GWAS) is based on the principle of linkage disequilibrium in populations, which can systematically detect genetic variations (mainly single nucleotide polymorphisms (SNPs)) in the genome, and mine molecular markers significantly associated with target phenotypes (such as disease resistance). Such markers can be directly applied to marker-assisted breeding, which can detect the genotype of candidate individuals early, quickly screen individuals carrying disease-resistant superior alleles, and significantly shorten the breeding cycle, providing efficient technical support for genetic improvement of fish disease resistance.

[0006] Currently, there are still few molecular markers for yellowfin grouper resistance to Streptococcus iniae disease, and the number of markers found is limited. The disease resistance-associated markers in different populations and genetic backgrounds are different, and new functional markers still need to be further explored to enrich the tool library for disease resistance molecular breeding. SUMMARY

[0007] The present application aims to provide a SNP molecular marker associated with yellowfin grouper resistance to Streptococcus iniae disease, and to provide new genetic marker resources for disease resistance molecular breeding of yellowfin grouper.

[0008] The present application also aims to provide primers and kits for detecting the above-mentioned SNP molecular marker, and a method for breeding yellowfin grouper with resistance to Streptococcus iniae disease using the primers.

[0009] The present application further aims to provide the application of the above-mentioned primers or kits in breeding yellowfin grouper with resistance to Streptococcus iniae disease.

[0010] The first object of the present application is achieved by the following technical scheme:

[0011] A SNP molecular marker associated with yellowfin grouper resistance to Streptococcus iniae disease, the SNP molecular marker is located at base position 10398424 of chromosome 5 of yellowfin grouper, the mutation type is G / A, and is named SNP 5:10398424.

[0012] The sequence of the SNP molecular marker is shown as SEQ ID NO: 1, and the base at position 251 from the 5' end is G or A. When the genotype is GG or GA, the yellowfin grouper has strong resistance to Streptococcus iniae disease, that is, the resistance of individuals with GG or GA genotype to Streptococcus iniae disease is higher than that of individuals with AA genotype.

[0013] Specifically, the sequence of the SNP molecular marker is:

[0014] TTCGAAATCTTGTACAGGCAGTCATGGTTCCCGGGGGATGAATCCTAAAGACATTTCTGATCAACCCGACATTCCCTCTAGCACCACGAGCACATCCACGTTTTCACACACATTGTGACAATCTCAGCATCTATATCTGTGGTCAGACTTTTATGCTCGTTGCTAAGTAGCATATGTAAATATCCTAACCAAAATGGTCTGTACACCTGTTTAGCATTACAGTGTTACCACATTTTATTTTGAGTAAGTTGGCATATTTACATTAGAATTTAACTTAAAGCACTGATGTGCTGAAGTAGTCAAGTTTATATCAGGTTATATCAGGTATTTGTCAGGTTTCAAGGTCATTGTACAACACAGAGTTGCATGATGAAATAGGTGTTTGTCCTGCGTTCATGCTACACAAACACAAAGCATAAATACAGTCATTTCTATACATTTATTTATATTCATTGCTAGGTTAACAAGTATACACCCAGGAAATAATTCTGTAGTGCTTTT.

[0015] The second object of the present application is achieved by the following technical scheme:

[0016] A primer for detecting the SNP molecular marker, the primer comprising an upstream primer and a downstream primer, the sequence of the upstream primer being shown as SEQ ID NO: 2, and the sequence of the downstream primer being shown as SEQ ID NO: 3.

[0017] The upstream primer (SEQ ID NO: 2) is 5'-CCCGACATTCCCTCTAGCAC-3';

[0018] The downstream primer (SEQ ID NO: 3) is 5'-GCATGAACGCAGGACAAACA-3'.

[0019] The present application further provides a kit for detecting the SNP molecular marker, the kit comprising the primer described above.

[0020] Further, the present application further provides a method for breeding yellow snapper with anti-streptococcosis, comprising the following steps:

[0021] (1) extracting the genomic DNA of the yellow snapper to be tested;

[0022] (2) using the primer pair shown as SEQ ID NO: 2 and SEQ ID NO: 3, the obtained DNA is specifically amplified to obtain an amplified product;

[0023] (3) the amplified product is subjected to sequencing analysis to determine the genotype of the SNP molecular marker (SNP 5:10398424); the ability of individuals with GG, GA genotypes in the SNP molecular marker to resist streptococcus iniae is higher than that of individuals with AA genotype.

[0024] The above last purpose of the present application can be realized by the following technical solutions: the above-mentioned primer, the above-mentioned kit, and the above-mentioned method are applied in the breeding of yellow croaker resistant to streptococcus iniae.

[0025] The present application has the following advantages:

[0026] (1) the SNP 5:10398424 screened by the present application through whole genome association analysis can be used as a molecular marker for breeding of yellow croaker resistant to streptococcus iniae based on the allelic frequency difference of the SNP site, which is a new functional marker, can supplement the existing disease-resistant marker resources, and lays a foundation for constructing a multi-marker coordinated precision breeding system, and has important supplementary value for promoting the industrialization application of disease-resistant molecular breeding of yellow croaker and ensuring the sustainable development of the industry.

[0027] (2) the target site can be quickly amplified by the specific primer pair, and the genotype can be determined by combining sequencing or typing technology, which is simple to operate and reliable in result;

[0028] (3) the SNP molecular marker, primer and kit provided by the present application have application prospects in molecular marker assisted breeding of disease resistance traits of yellow croaker, and the marker is not limited by the age and gender of individuals, can be used for early disease-resistant individual screening, significantly shortens the breeding cycle, and accelerates the cultivation process of disease-resistant lines of yellow croaker. BRIEF DESCRIPTION OF DRAWINGS

[0029] The present application will be further described below with reference to the accompanying drawings and examples.

[0030] Figure 1 The Manhattan plot for whole genome association analysis of the disease resistance of yellow croaker to streptococcus iniae, wherein the black solid line represents the whole genome significance threshold, the black dotted line represents the suggestive significant threshold, and the arrow marks the position of the SNP 5:10398424 of the present application.

[0031] Figure 2 The QQ plot for whole genome association analysis of the disease resistance of yellow croaker to streptococcus iniae is used to verify the reliability of the association analysis result;

[0032] Figure 3To verify the sequencing peak chart results of SNP site SNP 5:10398424 in the resistant population (RG) and the susceptible population (SG) in Example 2, the difference in the genotype distribution of the site in the two types of populations is shown. DETAILED DESCRIPTION

[0033] The technical solutions of the present application will be described in detail below in conjunction with specific examples, so that those skilled in the art can better understand and implement the technical solutions of the present application. The following examples and drawings are only used for illustrative purposes and cannot be understood as limiting the present application. Unless otherwise specified, the reagents or materials used in the examples are obtained from commercial channels. Unless otherwise specified, the experimental instruments used are laboratory conventional instruments.

[0034] Example 1: Screening of SNP molecular markers related to yellow croaker resistance to Streptococcus iniae disease

[0035] 1. Experimental materials and challenge treatment

[0036] The experimental yellow croaker (Sannuperculis) used in this experiment was obtained from Guangdong Changfeng Aquatic Breeding Co., Ltd. (Zhuhai, China). 850 healthy individuals with an average body length of 10 cm were selected and acclimated for 1 week before challenge experiment. Acanthopagrus latus

[0037] Challenge method: 100 μL of Streptococcus iniae suspension with a concentration of cfu / mL was injected into the abdominal cavity of each fish, and the control group was injected with an equal amount of sterile normal saline. Continuous observation was conducted for 14 days, and the death time and symptoms of each fish were recorded. Streptococcus iniae

[0038] Population division: 96 individuals died in the peak period (2-3 days after challenge) were selected as the susceptible population; 96 individuals that survived after 14 days of challenge, with no damage to the body surface and normal activity, were selected as the resistant population. The fin tissue of all individuals was collected and stored in anhydrous ethanol at -20℃ for standby use.

[0039] 2. Genomic DNA extraction and quality detection

[0040] The genomic DNA of the fin tissue was extracted using the Marine Organism Tissue DNA Extraction Kit (Tiangen, China), and the specific operation was performed according to the kit instructions.

[0041] Quality detection: 1% agarose gel electrophoresis (120 V, 30 min) was used to detect the integrity of the DNA (a single clear band without tailing); the DNA concentration was determined using NanoDrop 2000 and the concentration was finally adjusted to 30 ng / μL.

[0042] 3. Simplified genomic sequencing and SNP detection​​

[0043] Library construction: 3 μg qualified DNA was randomly fragmented into 350 bp fragments by Covaris ultrasonic disrupter, and then ligated with Illumina universal adapters after end repair and 3' A tailing to construct a PE150 sequencing library.

[0044] Sequencing and data processing: Raw reads were obtained by sequencing on the Illumina NovaSeq 6000 platform. Clean reads were obtained by filtering low-quality reads using Trimmomatic (v0.39) (parameters: LEADING:3 TRAILING:3 SLIDINGWINDOW:5:20 MINLEN:50).

[0045] Alignment and variant detection: Clean reads were aligned to the yellow croaker reference genome (GCA_904848185.1) using bowtie2, and BAM files were sorted by SAMtools (v1.15). SNP calling was performed using bcftools, with filtering criteria of removing sites with a deletion rate higher than 20% and sites with a Hardy-Weinberg equilibrium less than 0.0001. Finally, 125,502 high-quality SNP sites were obtained.

[0046] 4. Genome-wide association analysis (GWAS)

[0047] GWAS analysis was performed using the mixed linear model (MLM, including population structure and kinship matrix) of Tassel 5.0 software to eliminate the effects of population stratification. The significance threshold was set as follows: based on Bonferroni correction, the whole-genome significant association threshold was -log 10 (0.05 / 125502) = 6.4, and the suggestive threshold was -log 10 (1 / 125502) = 5.1.

[0048] Figure 1 The results showed that a total of 2 SNP sites were significantly associated with the anti-dolphin streptococcosis trait. However, after verification, the allele frequency of SNP 18:28739733 was not significantly different between the resistant / susceptible populations (P>0.05); while SNP 5:10398424 (located at 10398424 on chromosome 5, mutation type G / A) had a significant difference (P<0.05), which was the SNP molecular marker related to the anti-dolphin streptococcosis of the yellow croaker according to the present application. P ​

[0049] Example 2: Validation experiment of SNP 5:10398424

[0050] 1. Validation population and primer design

[0051] A population of yellowfin seabream independent of Example 1 was selected, and after the same challenge experiment, 48 susceptible individuals (who died 2-3 days after challenge) and 48 resistant individuals (who survived for more than 14 days) were selected, and fin DNA was extracted (method as in Example 1).

[0052] Subsequently, using the extracted DNA as a template, PCR amplification was performed using SEQ ID NO:2 and SEQ ID NO:3 as primers to obtain a gene fragment containing SNP 5:10398424, as shown in SEQ ID NO:1.

[0053] 2. PCR amplification; total volume 20 μL, specific reaction system as shown in Table 1.

[0054] Table 1 PCR amplification reaction system

[0055] Components Volume 2 x Taq Master Mix 10 μL Upstream / Downstream Primer 1 μL each Template DNA 3 μL ddH2O 5 μL Total Volume 20 μL

[0056] The specific amplification procedure is as follows: 95℃ pre-denaturation for 30 min; 35 cycles of 95℃ denaturation for 10 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s; final extension at 72℃ for 5 min; 2 μL of the reaction product was analyzed by 1% agarose gel electrophoresis, and qualified samples were used for subsequent sequencing to determine the genotype of each individual sample in SNP 5:10398424.

[0057] 3. Verification Results

[0058] In the resistant population (RG), the frequency of the A allele was 0.72 and the frequency of the G allele was 0.28; in the susceptible population (SG), the frequency of the A allele was 0.84 and the frequency of the G allele was 0.16. A chi-square test showed a significant difference in allele frequencies between the two groups. P <0.05), where the G allele was enriched in the resistant population and the A allele was enriched in the susceptible population.

[0059] like Figure 3 As shown, individuals with the GG and GA genotypes accounted for a larger proportion in the resistant population (RG) and a smaller proportion in the susceptible population (SG), meaning that the number of these two genotypes in the resistant population (RG) was greater than the number in the susceptible population (SG); while individuals with the AA genotype accounted for a larger proportion in the susceptible population (SG) and a smaller proportion in the resistant population (RG).

[0060] Based on the difference in allele frequency of the SNP 5: 10398424, it can be used as a molecular marker for breeding of disease-resistant varieties of yellowfin grouper: screening individuals carrying G allele as parents, increasing the frequency of G allele in the offspring population through marker-assisted selection (MAS), thereby enhancing the overall disease resistance of the population.

[0061] The above examples demonstrate that the G allele of SNP 5: 10398424 is closely associated with the disease resistance to Streptococcus iniae in yellowfin grouper. The genotype rapid identification technology combined with specific primers can realize the efficient breeding process of "early individual → accurate screening → disease-resistant family construction", providing a direct and practical technical tool for disease-resistant molecular breeding of yellowfin grouper, and breaking through the bottleneck of long breeding cycle and low selection efficiency in traditional breeding.

[0062] The above examples are only used to illustrate the present application, and the protection scope of the present application is not limited to the above examples only. The skilled in the art can achieve the purpose of the present application according to the above disclosure of the present application, and any improvement and deformation based on the concept of the present application also falls within the protection scope of the present application, and the specific protection scope is subject to the claims.

Claims

1. A SNP molecular marker related to the yellowfin snapper (Seriola quinqueradiata) against Streptococcus iniae disease, characterized by, The sequence of the SNP molecular marker is shown as SEQ ID NO:1, and the base at the 251th position from the 5' end is G or A.

2. A primer for detecting the SNP molecular marker of claim 1 or a kit containing the primer in the breeding of yellow snapper resistant to Streptococcus iniae disease; the primer comprises an upstream primer and a downstream primer, the sequence of the upstream primer is shown as SEQ ID NO:2, and the sequence of the downstream primer is shown as SEQ ID NO:

3.

3. A method for breeding yellowfin snapper with resistance to Streptococcus iniae disease, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of the yellow snapper to be tested; (2) using the primer pair shown as SEQ ID NO:2 and SEQ ID NO:3 to specifically amplify the obtained DNA to obtain an amplification product; (3) sequencing and analyzing the amplification product to determine the genotype of the SNP molecular marker of claim 1; Screening individuals carrying G alleles as parents to increase the frequency of G alleles in the offspring population through marker-assisted selection, thereby enhancing the overall disease resistance of the population.

4. The method of claim 3 in the breeding of yellow snapper resistant to Streptococcus iniae disease.

Images