SNP (Single Nucleotide Polymorphism) site related to spikelet number per ear and grain number per ear of wheat and application of SNP site

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to the number of spikelet per ear and the number of grains per ear of wheat and application of the SNP site. The SNP site comprises a kit for identifying or assisting in identifying the number of spikelet per ear and the number of grains per ear of wheat, primers and application of the elements in identifying or assisting in identifying the number of spikelet per ear and the number of grains per ear of wheat. The invention provides a new method for molecular marker-assisted selective breeding of wheat, and has important significance in cultivation and research of high-yield wheat varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to SNP sites related to the number of spikelets per ear and the number of grains per ear of wheat and applications thereof. Background Art

[0002] As one of the world's major grain crops, improving wheat yield and quality is crucial for global food security. Grain number per ear is one of the three key factors contributing to yield, and increasing both the number of spikelets and grains per ear significantly impacts yield, thereby contributing to increased wheat yield. Therefore, the discovery of QTLs (quantitative trait loci) controlling spikelet and grain number per ear in wheat, along with their superior alleles, provides a theoretical basis for the genetic improvement of grain number per ear using molecular marker-assisted selection and the further application of major QTLs. This is also of great significance for the genetic improvement of wheat yield traits.

[0003] Currently, researchers have located numerous QTLs regulating spikelet number per ear and grain number per ear. Spikelet number in wheat influences grain number per ear, which in turn influences wheat yield. Professor Zheng Youliang's research team at the Wheat Research Institute of Sichuan Agricultural University used a wheat 55K SNP array and SSR markers to genotype a 199-line recombinant inbred line population created by crossing the winter wheat line '20828' with the nationally approved Sichuan Agricultural No. 16 wheat variety (Liu et al. 2018). The phenotypes of spikelet number in this population were also characterized across three years and eight ecological sites. QTL mapping for the number of spikelets per panicle was performed, and a total of five stable QTLs were detected on chromosomes 2D, 4B, 5A, 5B and 5D. Among them, QSns.sau-2D (LOD=3.47-38.24, PVE=10.16-45.68%) was detected in all eight environments, explaining 10.16-45.68% of the phenotypic variation and was located on chromosome 2DS. 660K SNP chip typing was performed on the parents '20828' and Sichuan Agricultural University 16, and the KASP marker KASP-AX-94721936, which is tightly linked to QSns.sau-2D, was successfully developed using the SNP typing data. This marker was used to validate the major QTL QSns.sau-2D in two populations with different genetic backgrounds. T-test results showed that lines containing the '20828' synergistic locus of this major QTL had spikelet numbers per panicle increased by 6.93% to 14.72%, with an average of 11.38%, compared to lines without this locus. Further analysis revealed significant differences in flowering time, plant height, panicle length, 1000-grain weight, and number of grains per panicle between lines containing this major QTL and those without it (P<0.05, Figure 4 ), indicating that the number of spikelets per ear was correlated with these traits.

[0004] Zhang Qianqian et al. used a population of recombinant inbred lines (KJ-RILs) derived from Kenong 9204 and Jing 411 to analyze the grain number per ear trait under 10 environments. They located qKnps-2A within the range of 78.5-83.0 cM of Ax-111707919-Ax-111626797. To further clarify the genetic effect of QTL-qKnps-2A, they used the marker Ax-110454852, which is closely linked to qKnps-2A, to conduct genetic analysis on 188 KJ-RIL families. The results showed that the superior haplotype qKnps-2A significantly increased grain number per ear, grain weight per ear, and the number of spikelets per ear, resulting in an average yield increase of 3.72% per plant. However, this superior haplotype had a negative effect on 1000-grain weight. An analysis of the application of qKnps-2A using 310 varieties (lines) revealed that the superior haplotype qKnps-2A has been selected by breeders but its utilization rate is low, indicating significant potential for genetic improvement. These results provide a theoretical basis for genetic improvement of grain number per ear and for further application of the major QTL, qKnps-2A.

[0005] Although a large number of QTLs related to the number of spikelets per ear and the number of grains per ear have been located, the vast majority of these QTLs have small phenotypic contributions and poor reproducibility across different years and environments, making them difficult to apply to the genetic improvement of the number of spikelets per ear and the number of grains per ear in wheat. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide SNP sites related to the number of spikelets per ear and the number of grains per ear of wheat and applications thereof.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] The use of a SNP site, wherein the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO. 1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B;

[0009] The use is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear traits of wheat, wherein the number of spikelets per ear and / or the number of grains per ear traits are: wheat homozygous for genotype A is greater than or is a candidate to be greater than wheat homozygous for genotype B.

[0010] A method for identifying or assisting in identifying the number of spikelets per spike and / or the number of grains per spike of wheat, comprising: performing PCR amplification on any DNA fragment containing the SNP site described in claim 1 in the genomic DNA of the wheat to be tested, and performing enzyme digestion identification on the PCR amplification product, wherein the enzyme digestion comprises the following steps: using the wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 to 50 times, using the same as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; digesting the PCR product with the restriction endonuclease SmaI; if the PCR product cannot be digested, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product can be digested, the nucleotide polymorphic site is G / G and the genotype is B; the number of spikelets per spike and / or the number of grains per spike of wheat is: the number of wheat homozygous for genotype A is greater than, or the candidate number is greater than, the number of wheat homozygous for genotype B;

[0011] The DNA fragment amplified by PCR is 473-571 bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0012] Use of a primer combination, the primer combination being primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5 in the sequence listing;

[0013] The use is to identify or assist in identifying the wheat spikelet number per ear and / or grain number per ear traits of wheat by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the wheat spikelet number per ear and / or grain number per ear traits are: wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B.

[0014] Use of a reagent or kit, the reagent or kit comprising at least the primer combination according to claim 2 and necessary restriction endonuclease components;

[0015] The use is to identify or assist in identifying the wheat spikelet number per ear and / or grain number per ear traits of wheat by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the wheat spikelet number per ear and / or grain number per ear traits are: wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B.

[0016] More preferably, the restriction endonuclease is SmaI enzyme.

[0017] Further preferably, the reagent or kit further comprises template DNA, a buffer required for PCR amplification, dNTPs and other necessary components for gene detection.

[0018] Further preferably, the target DNA fragment amplified by PCR in the reagent or kit is designed to be 473-571 bp at the 5' end of SEQ ID NO.1.

[0019] Further preferably, the PCR amplification specific primer combination includes: primer pair 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5.

[0020] The beneficial effects of the above technical solution are as follows: Through genetic variation analysis and extensive data processing within a naturally occurring wheat population, the present invention ultimately identified a stable major SNP corresponding to significant phenotypic differences, corresponding to position 498 from the 5' end of SEQ ID NO. in the sequence listing. By designing a dCAPS marker for this SNP, it was discovered that this SNP exists in two genotypes: genotype A (C) and genotype B (G). Multiple experiments and data verification revealed that the number of spikelets per ear and the number of grains per ear in the homozygous forms of these two genotypes were greater in wheat homozygous for genotype A than for wheat homozygous for genotype B. The research findings of the present invention are of great significance to wheat breeding. The present invention provides clear associations with target traits: by identifying SNP loci associated with the number of spikelets per ear and the number of grains per ear in wheat, it provides specific, actionable targets for wheat breeding. Breeders can directly screen for these loci, improving the targetedness and efficiency of breeding. The present invention also developed molecular markers, detection kits, and identification methods based on these markers, enabling targeted screening and cultivation through molecular marker-assisted selection (MAS) during breeding. MAS can accurately identify the genotype of wheat in the early stages of growth, reducing the uncertainty and time cost of relying on phenotypic selection in traditional breeding. The present invention can use molecular markers to determine the genotype of wheat in the seed or seedling stage, thereby screening out individuals with desired traits in advance, which can greatly shorten the breeding cycle. The identification method based on SNP sites of the present invention is more accurate and reliable than traditional phenotypic identification, can reduce the impact of environmental factors on the phenotype, and can more truly reflect the genetic potential of wheat. The primer combination and gene detection kit constructed by the present invention provide wheat breeders with convenient tools, which are convenient for use in different laboratories and breeding environments. In terms of the potential for wheat breeding, the technology based on the present invention is expected to increase the number of spikelets per ear and the number of grains per ear of wheat by screening and cultivating wheat with specific SNP genotypes, thereby potentially increasing wheat yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a schematic diagram of the gene structure of the SNP site and its associated gene (KeNong 9204) of the present invention.

[0022] Figure 2 The electrophoresis detection results of the dCAPS-labeled enzyme digestion products were developed for the SNP of the present invention; after two rounds of PCR amplification with primers F2 and R2, the PCR product was 99 bp, and the polymorphism can be recognized by SmaI respectively; among them, primer F2 itself contains a SmaI site that can cut a 13 bp fragment, so the size of genotype A (C / C) after enzyme digestion is 86 bp; the size of genotype B (G / G) after enzyme digestion is 86 bp and 74 bp.

[0023] Figure 3Schematic diagram of the association analysis results between the SNP site of the present invention and the number of spikelets per ear in natural wheat populations.

[0024] Figure 4 Schematic diagram of the association analysis results between the SNP loci of the present invention and the number of grains per ear in natural wheat populations. DETAILED DESCRIPTION

[0025] The following examples illustrate the present invention in detail. All raw materials and equipment used in the present invention are commercially available and can be directly purchased from the market. The wheat materials used in the following examples were obtained from the China National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm). For material information, please refer to the China Crop Germplasm Information Network, http: / / icgr.caas.net.cn.

[0026] It should be understood that when used in the specification of this application and the appended claims, the term "comprising" indicates the presence of the described features, integers, steps, operations, and elements, but does not exclude the presence or addition of one or more other features, integers, steps, operations, and elements. It should also be understood that the term "and / or" used in the specification of this application and the appended claims refers to any combination and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0027] As used in this specification and the appended claims, the term "if" can be interpreted as "when" or "upon" or "in response to determining" or "in response to detecting," depending on the context. Similarly, the phrase "if it is determined" or "if [described condition or event] is detected" can be interpreted as meaning "upon determination" or "in response to determining" or "upon detection of [described condition or event]" or "in response to detecting [described condition or event]," depending on the context.

[0028] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description and are not to be understood as indicating or implying relative importance. References to "one embodiment" or "some embodiments" etc. described in the present application specification mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized.

[0029] Example 1: SNP-specific primers and sequence analysis

[0030] Based on our research and extensive data analysis and verification, we discovered a SNP with stable and significant phenotypic differences in the coding region of the wheat (Ke Nong 9204) genome, corresponding to position 498 from the 5' end of SEQ ID NO.1. By designing dCAPS markers for this SNP site, we found that this site has two genotypes in the natural variation population of wheat: genotype A or I: C; genotype B or II: G

[0031] Based on the sequence differences of different wheat genomes, specific primers were designed to PCR amplify DNA fragments containing the SNP sites:

[0032] F1: CGACCATGCCGTACGCCGGC (SEQ ID NO: 2);

[0033] R1: CACATTAGTACGTGGTCCGT (SEQ ID NO: 3);

[0034] F2: ACCACAGGGGCCCGGGCGCCGGCCC (SEQ ID NO: 4);

[0035] R2: TGCTGCCGCGCACGTCCATC (SEQ ID NO: 5);

[0036] The target sequence amplified by PCR using primers F1 and R1 is shown in the sequence listing as position 383-1441 of SEQ ID NO: 1; the target sequence amplified by PCR using primers F2 and R2 is shown in the sequence listing as position 473-571 of SEQ ID NO: 1. Enzyme digestion analysis showed that the polymorphism was recognized by SmaI.

[0037] Example 2: PCR-enzyme digestion polymorphism detection and genotyping of SNPs

[0038] 1) Extracting genomic DNA from the wheat to be tested;

[0039] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (20 μL) was as follows: 16.8 μL ddH2O, 0.2 μL KOD, 1 μL dNTP, 0.5 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (50-100 ng / μL).

[0040] The PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0041] 3) The PCR product from step 2) was diluted 20- to 50-fold and used as a template for PCR amplification using primers F2 and R2. The PCR amplification system (20 μL) was as follows: 7 μL ddH2O, 10 μL 2× Taq Mix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).

[0042] PCR amplification conditions were as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 10 s, 72°C for 10-12 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0043] 4) The PCR product obtained in step 3) was digested with SmaI to obtain a digestion product, which was detected by 4% agarose gel electrophoresis. It was recorded whether the PCR product was cut into two fragments. The status of the wheat to be tested at the site was determined and recorded according to the following method:

[0044] If the enzyme cleavage product is one or larger fragments, the wheat to be tested is C homozygous (expressed as C / C) at the site ( Figure 1 Lane G in the figure);

[0045] If the enzyme cleavage product is two or smaller fragments, the wheat to be tested is G homozygous (expressed as G / G) at the site ( Figure 1 Lane A in the figure).

[0046] 5) Based on the results of step 4), the wheat is classified into two types, I and II, at the site:

[0047] I: C / C (i.e., homozygous for genotype A);

[0048] II: G / G (i.e., homozygous for genotype B);

[0049] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0050] Example 3: Typing of natural populations using dCAPS markers and association analysis with the number of spikelets per ear and the number of grains per ear

[0051] Each wheat in a natural population of 320 hexaploid wheats was used as the test wheat, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0052] Table 1 The situation of the polymorphic sites in natural wheat populations

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 4: Association analysis between SNPs and the number of spikelets per ear in natural wheat populations

[0059] In 2018, the above-mentioned natural population wheat was planted in arid-hot land and dry land, hydrothermal land and water land at the Luancheng Experimental Station of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng, Hebei); in 2019, in arid-hot land and dry land, hydrothermal land and water land at the Hengshui Experimental Farm of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng and Hengshui, Hebei); in 2020, the wheat was planted in arid land and arid-hot land at the Institute of Crop Sciences of the Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The number of spikelets per ear and the number of grains per ear of each wheat variety were investigated, and the Tassel2.1 software was used to perform association analysis on the number of spikelets per ear and the number of grains per ear with the polymorphic loci. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, and P<0.05 was set as the significance level. The results are shown in Table 2.

[0060] Table 2 Association analysis results between TaWFZP-2D gene polymorphisms and the number of spikelets per ear in natural populations

[0061]

[0062] The results of the association analysis in Table 2 indicate that the differences in the number of spikelets per ear between the two types of wheat, formed from the natural populations of 320 hexaploid wheat accessions shown in Table 1, were significant (P < 0.05). Type I wheat had a higher number of spikelets per ear than Type II wheat. Across several environments, Type I wheat materials had 0.25, 0.21, 0.36, 0.20, 0.17, 0.17, -0.05, 0.14, and 0.15 more spikelets per ear than Type II wheat, respectively. Studies on natural populations have shown that Type I is an excellent genotype for increasing the number of spikelets per ear in wheat.

[0063] Table 3 Association analysis results between TaWFZP-2D gene polymorphisms and grain number per ear in natural populations

[0064]

[0065]

[0066] The results of the association analysis in Table 3 indicate that the differences in grain number per spikelet between the two types of wheat from the natural populations of 320 hexaploid wheat accessions shown in Table 1 were significant (P < 0.05). Type I wheat exhibited a higher number of grains per spikelet than Type II wheat. Across several environments, Type I wheat had 4.47, 3.07, 4.03, 2.03, 3.30, 2.39, 1.99, -0.54, 2.78, and 3.42 more spikelets per spikelet than Type II wheat, respectively. Studies of natural populations have shown that Type I is an excellent genotype for increasing grain number per spikelet in wheat.

[0067] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0068] From the above examples, it can be seen that the present invention discloses SNP sites related to the number of spikelets per ear and the number of grains per ear of wheat and their applications. The present invention analyzes the genetic variation of the TaWFZP-2D gene coding region in the natural variation population of wheat and finds a SNP, corresponding to the 498th position from the 5' end of Sequence Table 1. This SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis shows that in the homozygous types of these two genotypes, the number of spikelets per ear and the number of grains per ear are as follows: wheat homozygous for genotype A > wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of spikelets per ear and grains per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research. The scientific research results of the present invention are of great importance to wheat breeding. The present invention provides a clear association of target traits: by determining the SNP sites related to the number of spikelets per ear and the number of grains per ear of wheat, a specific and actionable target is provided for wheat breeding. Breeders can directly screen for these sites, thereby improving the pertinence and efficiency of breeding. The present invention also develops molecular markers and detection kits and identification methods based on these markers, which enable targeted screening and breeding through molecular marker-assisted selection (MAS) during the breeding process. MAS can accurately identify the genotype of wheat in the early growth stage, reducing the uncertainty and time cost of relying on phenotypic selection in traditional breeding. The present invention can use molecular markers to determine the genotype of wheat at the seed or seedling stage, thereby screening out individuals with the desired traits in advance, greatly shortening the breeding cycle. The identification method based on SNP sites of the present invention is more accurate and reliable than traditional phenotypic identification, reduces the impact of environmental factors on the phenotype, and can more truly reflect the genetic potential of wheat.

[0069] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. The use of SNP sites is characterized by: The SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.

1. When the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B. The use is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear traits of wheat, wherein the number of spikelets per ear and / or the number of grains per ear traits are: wheat homozygous for genotype A is greater than or is a candidate to be greater than wheat homozygous for genotype B.

2. A method for identifying or assisting in identifying the number of spikelets per ear and / or the number of grains per ear of wheat, characterized in that: A DNA fragment containing the SNP site of claim 1 in any section of the wheat genomic DNA to be tested is PCR amplified, and the PCR amplification product is subjected to enzyme digestion identification, wherein the enzyme digestion comprises the following steps: using the wheat genomic DNA as a template and primers 1F and 1R as a primer pair to amplify to obtain a PCR product; diluting the PCR product 20 to 50 times, using it as a template and primers 2F and 2R as a primer pair to amplify to obtain a PCR product; digesting the PCR product with restriction endonuclease SmaI; if the PCR product cannot be cleaved, the nucleotide polymorphic site is C / C and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphic site is G / G and the genotype is B; the number of spikelets per ear and / or the number of grains per ear of wheat is: the wheat homozygous for genotype A is greater than or the candidate is greater than the wheat homozygous for genotype B; The DNA fragment amplified by PCR is 473-571 bp at the 5' end of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

3. The use of the primer combination, characterized in that: The primer combination is primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5; The use is to identify or assist in identifying the wheat spikelet number per ear and / or grain number per ear traits of wheat by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the wheat spikelet number per ear and / or grain number per ear traits are: wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B.

4. Use of a reagent or kit, characterized in that: The reagent or kit comprises at least the primer combination according to claim 3 and necessary restriction endonuclease components; The use is to identify or assist in identifying the wheat spikelet number per ear and / or grain number per ear traits of wheat by detecting the single nucleotide polymorphism of the following SNP site in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, when the site is homozygous for C / C, the corresponding genotype is A; when the site is homozygous for G / G, the corresponding genotype is B; the wheat spikelet number per ear and / or grain number per ear traits are: wheat homozygous for genotype A is greater than, or is potentially greater than, wheat homozygous for genotype B.

5. The use according to claim 4, characterized in that: The restriction endonuclease is SmaI enzyme.

6. The use according to claim 4 or 5, characterized in that: The reagents or kit also include template DNA, buffer required for PCR amplification, dNTPs and other necessary components for gene detection.

7. The use according to claim 4, 5 or 6, characterized in that: The target DNA fragment amplified by PCR in the reagent or kit is designed to be 473-571 bp at the 5' end of SEQ ID NO.

1.

8. The use according to claim 4, 5, 6 or 7, characterized in that: The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

Images