Polypeptide for improving plant disease resistance and application thereof

Abstract

The invention relates to the field of agricultural products, and particularly discloses a polypeptide for improving plant disease resistance, and the polypeptide is LAND2 small peptide and homologous peptide thereof. The LAND2 small peptide disclosed by the invention is screened and found from an arabidopsis thaliana proteome, and homologous peptides of the LAND2 small peptide are respectively derived from chilies and cucumbers. Tests prove that when the LAND2 small peptide is externally applied to arabidopsis thaliana, the local and systematic resistance of plants to botrytis cinerea can be enhanced, and the LAND2 small peptide has broad-spectrum immunocompetence in chilies and cucumbers. The polypeptide is practically applied to agricultural production, can enhance the disease resistance of plants and improve the yield and quality of the plants, and has practical popularization and application values.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a polypeptide for improving plant disease resistance and application thereof. Background Art

[0002] Plants face the constant risk of pathogen infection throughout their growth cycle. Fungal diseases, due to their sudden onset and severe devastation, have become a key bottleneck restricting crop yield and quality. Research shows that plant pathogens causing significant economic losses worldwide include: Botrytis cinerea, which causes gray mold; Pyricularia oryzae, which causes rice blast; Colletotrichum gloeosporioides, which infects peppers; and Fusarium oxysporum, which causes wilt. These pathogens can cause a range of diseases, seriously threatening crop health and agricultural production. Botrytis cinerea, a typical necrotrophic pathogen, has become a primary threat to the safe production of horticultural crops. The gray mold it causes is a serious fungal disease that poses a threat to a wide range of plants, particularly vegetables, fruit trees, and flowers. Gray mold can cause grape rot and leaf drop on grapevines; rot and wilting of strawberry fruits; water-soaked lesions and rot on the leaves and petioles of tomato seedlings; and it can damage the flowers, stems, leaves, and stems of cucumbers, causing petal rot and the development of a gray-brown mold. Therefore, the prevention and control of gray mold is an important issue in agricultural production, and effective management measures and the application of new biological pesticides are needed to control the spread and development of the disease.

[0003] In the field of plant disease control, while the large-scale application of chemical pesticides can suppress the proliferation of pathogenic microorganisms in the short term, it inevitably leads to secondary risks such as excessive pesticide residues and accumulated ecotoxicity. Therefore, developing strategies to induce disease resistance based on the plant's own immune system has become a key research direction to break through the bottleneck of traditional disease control. In recent years, research has revealed that plant peptides, as key signaling molecules, play an important role in regulating plant immunity. Column 3 specifically emphasizes the priority development of peptide-based biopesticides. Therefore, it is necessary to develop peptides that can enhance plant disease resistance and effectively combat plant diseases. Summary of the Invention

[0004] In view of this, the present invention aims to provide a polypeptide for improving plant disease resistance, wherein the polypeptide is a LAND2 peptide and a homologous peptide thereof; the amino acid sequence of the LAND2 peptide is shown in SEQ ID NO: 1;

[0005] The homologous peptides include the CalAND1 small peptide whose amino acid sequence is shown in SEQ ID NO: 3, and the CsLAND1 small peptide whose amino acid sequence is shown in SEQ ID NO: 4.

[0006] The present invention also provides a use of the aforementioned polypeptide in preparing a plant immune inducer for improving plant disease resistance.

[0007] Furthermore, the plants include Arabidopsis thaliana, pepper, and cucumber.

[0008] Furthermore, the amino acid sequence of the polypeptide that improves disease resistance in Arabidopsis thaliana is shown as SEQ ID NO: 1; the amino acid sequence of the polypeptide that improves disease resistance in pepper is shown as SEQ ID NO: 1 or SEQ ID NO: 3; and the amino acid sequence of the polypeptide that improves disease resistance in cucumber is shown as SEQ ID NO: 1 or SEQ ID NO: 4.

[0009] Furthermore, the disease resistance includes resistance to pathogenicity caused by biotic stress or resistance to pathogenicity caused by abiotic stress.

[0010] Furthermore, resistance to biotic stress-induced pathogenicity is resistance to infection by plant pathogens.

[0011] Furthermore, the plant pathogenic bacteria include Botrytis cinerea.

[0012] Furthermore, resistance to abiotic stress pathogens is resistance to extreme environmental stimuli.

[0013] Furthermore, the extreme environment includes high salt, low temperature, high temperature and / or darkness.

[0014] The present invention also provides a plant immune inducer, which is a preparation prepared by taking the aforementioned polypeptide as an active ingredient and adding auxiliary materials acceptable to plants.

[0015] The present invention also provides a recombinant Agrobacterium containing a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 5; the Agrobacterium includes Agrobacterium GV3101.

[0016] Finally, the present invention provides a method for constructing a disease-resistant plant, which comprises using genetically engineered bacteria to mediate the transformation of the plant to express the aforementioned polypeptide;

[0017] The plant comprises Arabidopsis thaliana; the Arabidopsis thaliana is a four-week-old Columbia type Arabidopsis thaliana;

[0018] The genetically engineered bacteria include the aforementioned recombinant bacteria.

[0019] The polypeptides used in the present invention to enhance plant disease resistance are LAND2 peptides and their homologous peptides. The LAND2 peptide was discovered by screening the Arabidopsis thaliana proteome, and its homologous peptides are derived from peppers and cucumbers. Experiments have shown that exogenous application of the LAND2 peptide to Arabidopsis thaliana can enhance the plant's local and systemic resistance to Botrytis cinerea and exhibit broad-spectrum immune activity in peppers and cucumbers. The practical application of the polypeptides of the present invention in agricultural production can enhance plant disease resistance, improve plant yield and quality, and possess practical application value.

[0020] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0021] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Arabidopsis thaliana small peptide precursor screening process;

[0023] Figure 2 Schematic diagram of the location of the preLANDs family on Arabidopsis chromosomes;

[0024] Figure 3 Motif distribution of LAND family members;

[0025] Figure 4 Amino acid composition and structural analysis of the preLANDs family (A: amino acid composition of the preLANDs family; B: gene structure of the preLANDs family);

[0026] Figure 5 Distribution of cis-acting elements in preLANDs family members (A: motif composition and distribution of cis-acting elements in the preLANDs family; B: number of cis-acting elements with different functions in the preLANDs family);

[0027] Figure 6 Weblogo image of the LANDs peptide family;

[0028] Figure 7 genes co-expressed with LANDs family members;

[0029] Figure 8 Expression of preLANDs family members after infection with Botrytis cinerea (A: expression of preLANDs genes after infection with Botrytis cinerea in NCBI SRP055503; B: expression of preLAND2 gene after infection with Botrytis cinerea verified by qRT-PCR. Error bars represent SE of the mean (n>3). Statistically significant differences (p<0.05) are indicated by different letters);

[0030] Figure 9Expression levels of PreLAND2 in different tissues (error bars indicate SE of the mean (n>3). Statistically significant differences (p<0.05) are indicated by different letters);

[0031] Figure 10 PreLAND2 protein localization prediction map;

[0032] Figure 11 Subcellular distribution of PreLAND2-GFP in tobacco leaf cells;

[0033] Figure 12 LAND2 induces ROS burst;

[0034] Figure 13 Superoxide anion accumulation in Arabidopsis leaves under LAND2 treatment (A: NBT staining of superoxide anions in Arabidopsis leaves under LAND2 treatment, B: NBT staining intensity index. Error bars represent SE of the mean (n>3). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar: 1 cm);

[0035] Figure 14 LAND2-induced callose deposition in plant leaves (A: fluorescence microscopy imaging of LAND2-induced callose deposition in plant leaves, B: fluorescence intensity statistics. Error bars represent SE of the mean (n>8). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar: 100 μM);

[0036] Figure 15 LAND2 induces stomatal closure (A: microscopic imaging of LAND2-induced plant leaf stomata, B: statistics of stomatal opening and closing. Error bars represent SE of the mean (n>50); statistically significant differences (p<0.05) are indicated by different letters; scale bar is 20 μM);

[0037] Figure 16 LAND2 induces MAPK activation;

[0038] Figure 17 LAND2 enhances the resistance of Arabidopsis leaves to Botrytis cinerea (A: Symptoms of Botrytis cinerea in Arabidopsis leaves under LAND2 treatment, B: Ratio of lesion area to total area of ​​Arabidopsis leaves 4 days after inoculation. Error bars represent SE of the mean (n>5). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar is 1 cm).

[0039] Figure 18Construction of preLAND2-overexpressing plants and morphological comparison with wild-type plants (A: PCR identification of two T3 generation homozygous preLAND2-overexpressing transgenic plants, B: Morphological comparison of preLAND2-overexpressing plants and wild-type plants; scale bar, 1 cm);

[0040] Figure 19 PreLAND2 overexpression enhances plant resistance to Botrytis cinerea (A: Comparison of symptoms on leaves of preLAND2-overexpressing and wild-type Arabidopsis after infection with Botrytis cinerea; B: Ratio of lesion area to total area; error bars represent SE of the mean (n>5); statistically significant differences (p<0.05) are indicated by different letters; scale bar, 1 cm);

[0041] Figure 20 Sequencing results of land2 mutant plants and morphological comparison with wild-type plants (A: DNA sequencing results of land2 gene-edited lines generated using CRISPR / Cas9; B: Morphological comparison of land2 mutant plants and wild-type plants. Scale bar, 1 cm);

[0042] Figure 21 The resistance of land2 mutant plants to Botrytis cinerea is weakened (A: Symptoms of Botrytis cinerea infection in WT and land2 mutant plants after application of ddH2O or LAND2 peptide; B: Ratio of lesion area to total area. Error bars represent SE of the mean (n>5). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar, 1 cm);

[0043] Figure 22 Principal component analysis of LAND2-treated Arabidopsis seedlings in transcriptome analysis;

[0044] Figure 23 Volcano plot of differentially expressed genes;

[0045] Figure 24 Statistics of transcription factor families after LAND2 treatment;

[0046] Figure 25 Cluster heatmap of differentially expressed genes;

[0047] Figure 26 KEGG pathway analysis of upregulated genes after LAND2 treatment;

[0048] Figure 27 GO functional enrichment analysis of upregulated genes after LAND2 treatment;

[0049] Figure 28 qRT-PCR validation of transcriptome data;

[0050] Figure 29LAND2-induced superoxide anion staining in Arabidopsis leaves (A: NBT staining of local and systemic superoxide anions in Arabidopsis under LAND2 treatment, B: NBT staining intensity index. Error bars represent SE of the mean (n>3). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar, 1 cm);

[0051] Figure 30 Local and systemic resistance of Arabidopsis leaves to Botrytis cinerea after LAND2 treatment (A: local and systemic infection symptoms of Botrytis cinerea on Arabidopsis leaves treated with LAND2, B: ratio of lesion area to total area. Error bars represent SE of the mean (n>5). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar, 1 cm);

[0052] Figure 31 Systemic expression of disease resistance-related genes under LAND2 treatment (error bars indicate SE of the mean. Statistically significant differences (p < 0.05) are indicated by different letters);

[0053] Figure 32 PreLAND2 expression is regulated by some hormones (error bars indicate SE of the mean. Statistically significant differences (p < 0.05) are indicated by different letters);

[0054] Figure 33 Expression pattern of preLAND2 under LAND2 treatment (error bars indicate SE of the mean. Statistically significant differences (p < 0.05) are indicated by different letters);

[0055] Figure 34 Expression pattern of preLAND2 under abiotic stress (error bars indicate SE of the mean. Statistically significant differences (p < 0.05) are indicated by different letters);

[0056] Figure 35 LAND2 induces MAPK activation in pepper and cucumber leaves (A: LAND2 induces MAPK activation in pepper leaves, B: LAND2 induces MAPK activation in cucumber leaves);

[0057] Figure 36 Symptoms of gray mold infection on pepper leaves under LAND2 treatment (A: Symptoms of gray mold infection on pepper leaves under LAND2 and CalAND1 treatments, B: Ratio of lesion area to total area of ​​pepper leaves 5 days after inoculation. Error bars represent SE of the mean (n≥5). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar: 1 cm);

[0058] Figure 37Symptoms of gray mold infection on cucumber leaves under LAND2 treatment (A: Symptoms of gray mold infection on cucumber leaves under LAND2 and CsLAND1 treatments, B: Ratio of lesion area to total area of ​​cucumber leaves 5 days after inoculation. Error bars represent SE of the mean (n≥5). Statistically significant differences (p<0.05) are indicated by different letters. Scale bar: 1 cm). DETAILED DESCRIPTION

[0059] Example 1 Screening of polypeptides capable of improving plant disease resistance and study of their functions and mechanisms of action

[0060] 1 Materials and Methods

[0061] 1.1 Test materials

[0062] 1.1.1 Plant materials

[0063] All Arabidopsis overexpression lines and mutants used in this study were based on the Columbia-type Arabidopsis thaliana (Col-0) background. Mutant lines bak1-4 (SALK_116202C), bak1-5, bik1 (SALK_005291C), and sobir1 (SALK_009453C) were maintained in the laboratory. Mutant lines fer-1 (SALK_017600C) and fer-2 (SALK_029056C) were purchased from AraShare. The mutant line at1g09560 was purchased from Biogen. Pepper seeds "Zhongjiao No. 6" were purchased from Zhongshu Seed Technology (Beijing) Co., Ltd.; cucumber seeds "Yousheng" were purchased from Tianjin Gengyun Seed Co., Ltd.

[0064] 1.1.2 Pathogen materials and storage

[0065] Botrytis cinerea was purchased from the China Agricultural Culture Collection Center (Accession No.: ACCC 36027), subcultured on potato dextrose agar (PDA) medium, and stored at 4°C.

[0066] 1.1.3 Plasmid vectors and competent strains

[0067] The plant expression vector pCAMBIA1305-HA was preserved in this experiment; Escherichia coli DH5α competent cells and Agrobacterium tumefaciens GV3101 competent cells were purchased from Sangon Biotechnology and stored in a -80°C ultra-low temperature freezer.

[0068] 1.2 Test methods

[0069] 1.2.1 Plant cultivation

[0070] For Arabidopsis sterile seedling culture, first the seed surface was sterilized with 75% ethanol, then sowed in 1 / 2Muashige-Skoog (MS) medium (0.8% agar, 1% sucrose, with or without inducer), after 2d vernalization at 4°C, it was placed in a phytotron for 10d. For four-week-old Arabidopsis plants, the seeds were sowed in nutrient soil (soil: vermiculite: perlite = 3:1:1) after vernalization. The growth environment of the two planting methods was in a short-day phytotron (light 12h, temperature 22°C, humidity 60%, light 5,500Lux).

[0071] 1.2.2 Bioinformatics analysis

[0072] Signal peptide prediction was performed using Signal 6.0, transmembrane domain prediction was performed using DeepTMHMM, phylogenetic analysis of LANDs family member sequences was performed using MUSCLE, and the generated tree file was visualized using iTOL 5. Sequence alignment was performed using Jalview 2.11.1.0, amino acid conservation analysis was performed using Weblogo, Motif prediction was performed using Multiple EM for Motif Elicitation (MEME), cis-acting element prediction was performed using PlantCARE, and gene fragment duplication and circos plot drawing were created using TBtools-II.

[0073] 1.2.3 Small peptide synthesis

[0074] All small peptides with a purity of 95% were synthesized by GenScript, including LAND2 (SEQ ID NO: 1: QAFQTSPGTVKHIKSKFQPKK), flg22 (SEQ ID NO: 2:

[0075] QRLSTGSRINSAKDDAAGLQIA), CaLAND1 (SEQ ID NO: 3: KTFQVGTKQVEKIKSRL APKK), and CsLAND1 (SEQ ID NO: 4: KTFQIGTDEVEEIKSKIAPKK).

[0076] 1.2.4 ROS burst

[0077] A luminol-based method was used to determine the burst level of ROS in plant leaves treated with small peptides (ddH2O as a control). Approximately 3 mm thick plant leaves were cut from 4-week-old soil-grown plants and incubated with 30 mL of water in a 96-well plate for 12 hours. Subsequently, 99 μL of reaction solution (200 μM luminol and 2 μg / mL peroxidase) and 1 μL of small peptide were added in sequence. Each well was measured once every minute for a total of 60 minutes. ROS production was expressed in relative light units (RLU) and plotted using Excel 2019. Each experiment was set up with 5 biological replicates, and each biological replicate was performed 4 times.

[0078] 1.2.5 Superoxide anion staining

[0079] Four-week-old Arabidopsis leaves were placed in a Petri dish containing either 1 μM peptide or ddH2O. The leaves were incubated in each environment for 1.5 hours. 0.5 mg / mL NBT staining solution was added and stained in the dark for 8 hours. The leaves were then eluted with an elution buffer (ethanol:glycerol:acetic acid = 3:1:1) at 95°C for 15 minutes. The leaves were photographed and analyzed. Measurements and calculations were performed using ImageJ software. Three biological replicates were set up for each experiment, with three technical replicates for each replicate.

[0080] 2.2.6 Callose deposition

[0081] Four-week-old Arabidopsis leaves were injected with small peptides (with ddH2O as a control) and left overnight for approximately 12 hours. The leaves were fixed in FAA solution (10% formaldehyde, 5% acetic acid, 50% ethanol) for 24 hours. The leaves were then decolorized in anhydrous ethanol for 6 hours and then incubated in 50% ethanol for 30 minutes. After removing the ethanol, the leaves were placed in aniline blue staining solution (0.01% aniline blue, 67mM K2HPO4, pH 12) and incubated overnight. Callose deposition was observed under UV light using an optical microscope and photographed. The callose deposition area was quantified using ImageJ software. Three biological replicates were set up for each experiment, and three technical replicates were set up for each replicate.

[0082] 2.2.7 Stomatal aperture

[0083] Four-week-old Arabidopsis leaves were placed in ddH2O and incubated under illumination (5,500 Lux) for 2-3 hours. Water or a small peptide was added to the samples at a final concentration of 1 μM. After 2 hours of continuous illumination, the lower leaf epidermis was observed under an Olympus BX-53 light microscope. Stomatal aperture was measured using ImageJ software. Each experiment was performed with three biological replicates and five technical replicates per replicate.

[0084] 2.2.8 MAPK phosphorylation detection

[0085] 2.2.8.1 Sample preparation

[0086] For Arabidopsis, 10-day-old sterile seedlings were selected, and for cucumber and pepper, 4-week-old leaves were selected. 5 mm discs were punched with a hole punch and soaked in ddH2O for overnight equilibration. These plant samples were then induced with 1 μM of a small peptide for 15 minutes. The liquid on the seedlings and discs was removed with tweezers and blotted dry. The seedlings were then wrapped in tin foil and quickly frozen in liquid nitrogen until ready for use.

[0087] 2.2.8.2 Total protein extraction

[0088] (1) Place the liquid nitrogen-frozen seedlings in a pre-cooled mortar, grind into powder, and transfer to a 1.5 mL centrifuge tube;

[0089] (2) Add 100 μL of protein extract (Tris-HCl: 1.97 g; SDS: 4 g; glycerol: 20 mL; β-mercaptoethanol: 5 mL; bromophenol blue: 5 mg) to the 1.5 mL centrifuge tube containing the sample, mix quickly and place on ice until ready to use;

[0090] (3) Place the mixed sample in (2) in a 95°C metal bath and heat for 10 min; (4) Centrifuge the heated sample at 12,000 rpm for 15 min; (5) Transfer the supernatant to a new 1.5 mL centrifuge tube and store at -20°C; (6) Use NanoDrop 2000 to measure and record the total protein concentration.

[0091] 1.2.8.3 Western Blot

[0092] (1) Preparation of SDS-PAGE protein gel: Select a 1.5 mm glass plate, add 12% separation gel, wait for the separation gel to solidify, add 5% stacking gel and insert a comb; (2) Sample loading: Load the determined total protein concentration at 20 mg / mL for each sample, keeping the total protein content of all samples consistent;

[0093] (3) Electrophoresis: first adjust the voltage to 80V and run for 30min. After all the samples have moved out of the stacking gel, adjust the voltage to 120V and run for 60min. (4) After the samples are subjected to SDS-PAGE gel electrophoresis, take the separation gel and soak it in TBST buffer (20mL1M Tris-HCl, 8.8g NaCl, 0.5mL Tween 20, and dilute to 1L with sterile water). (5) Cut a PVDF membrane of appropriate size and soak it in methanol for 5min. (6) Use dry transfer method to transfer the membrane. Place the filter paper, membrane, and gel in order to avoid bubbles when placing them. (7) Current 2.5A, voltage 25V, run for 7min. (8) Place in blocking solution (1g skim milk powder; 20mL TBST) and incubate at room temperature for 2h. (9) After incubation in blocking solution, wash with TBST buffer, soak and wash for 5min, and repeat three times. (10) Bind to the primary antibody (Phospho-p44 / 42MAPK Rabbit) and incubated in a 4°C refrigerator overnight; (11) After the primary antibody incubation was completed, the primary antibody was recovered and the membrane was washed on a shaker using TBST buffer, with each wash repeated three times for 15 minutes;

[0094] (12) Bind to the secondary antibody and incubate at room temperature for 2 h; (13) After the secondary antibody incubation is completed, recover the secondary antibody and wash the membrane with TBST buffer on a shaker, repeating the wash three times for 5 min each time; (14) Prepare the color development solution and take pictures using an ultra-high-sensitivity Western blot imaging system; (15) After taking pictures, stain the membrane with Ponceau S to compare whether the protein content of the samples is consistent.

[0095] 1.2.9 Botrytis cinerea inoculation test

[0096] Gray mold was cultured in PDA medium at 22°C for 3-4 weeks with a 12h / 12h light / dark cycle. After the mycelium filled the plate, the mycelium was scraped off with a 5% sterile glucose solution spore suspension, shaken for 10 minutes, and filtered through four layers of gauze to obtain a spore suspension. The spores were counted under a microscope using a hemocytometer and the concentration was adjusted to 2×10 6 / mL. A 1μM concentration of small peptide solution and ddH2O were sprayed on 4-week-old Arabidopsis, cucumber and pepper leaves. After the leaves were completely absorbed, the leaves were cut and placed in a 9 cm diameter culture dish with wet filter paper on the bottom. Then, each leaf was inoculated with 10μL of gray mold spore suspension and cultured in an artificial climate chamber. Pictures were taken after 5 days. ImageJ software was used to measure and calculate the size of the lesions of the diseased plant materials. Three biological replicates and three technical replicates were set up for each experiment.

[0097] 1.2.10 Experimental study on the expression of LAND2 precursor gene and disease resistance gene under different treatments

[0098] 1.2.10.1 Sample preparation for hormone and peptide treatment

[0099] Arabidopsis seedlings cultured on 1 / 2 MS medium for 10 days were equilibrated overnight in ddH2O. Subsequently, the equilibrated leaves were treated with the following solutions: 1 μM LAND2 peptide, 100 μM GA3, 50 μM JA, 10 μM indole-3-acetic acid (IAA), and 10 μM ABA. Treatment times were 1 hour, 3 hours, and 6 hours, respectively. A mock control consisted of ddH2O without any hormones. Each experiment involved three biological replicates, with three technical replicates per replicate.

[0100] 1.2.10.2 Sample preparation for abiotic stress

[0101] Stress treatments included cold, heat, darkness, and salt stresses on Arabidopsis seedlings grown for 10 days on 1 / 2 MS medium. Cold stress was induced by exposing the plants to 4°C for 1, 3, and 6 hours; heat stress was induced by exposing the plants to a 37°C growth chamber for 1, 3, and 6 hours; dark stress was induced by exposing the plants to darkness in the growth chamber for 1, 3, and 6 hours; and salt stress was induced by exposing the plants to 150 mM NaCl solution for 1, 3, and 6 hours. The control group consisted of Arabidopsis plants grown under normal conditions. Each experiment had three biological replicates, with three technical replicates per replicate.

[0102] 1.2.10.3 Arabidopsis RNA extraction and reverse transcription

[0103] Total RNA was extracted from Arabidopsis seedlings or leaves using a plant RNA rapid extraction kit. The material was ground in liquid nitrogen. Then, 100 mL of the ground powder was transferred to a centrifuge tube, lysate was added, and total RNA was extracted according to the manufacturer's instructions. Finally, 50 μL of RNase-free HO preheated to 65°C was added for dissolution. After extraction, RNA content was determined using a NanoDrop 2000 microspectrophotometer, and RNA integrity and purity were assessed by agarose gel electrophoresis.

[0104] Perform reverse transcription using a reverse transcription reagent. The reaction system is shown in Table 1. The reaction conditions are 37°C for 5 minutes and 85°C for 30 seconds. After completion of the reaction, cDNA is obtained and stored in a -20°C freezer.

[0105] Table 1 Reverse transcription system

[0106]

[0107] 1.2.10.4 Gene expression detection

[0108] Quantitative real-time PCR (qRT-PCR) was used to examine the expression patterns of LAND2 precursor genes and disease resistance-related genes under hormone and peptide treatments, as well as abiotic stress. The qRT-PCR reaction system was prepared according to Table 2, and the reaction program was set according to Table 3. After the reaction, fluorescence signals were acquired using the instrument software, and the cycle number (Ct value) at which the fluorescence signal reached the preset threshold for each sample was recorded. The relative expression of the target gene was calculated using the 2-ΔΔCt method, using the Arabidopsis thaliana internal reference gene ACTIN2 as a reference. Three biological replicates and three technical replicates were used for all experiments. The primer sequences for the genes tested in the qRT-PCR reactions are shown in Table 4.

[0109] Table 2 qRT-PCR reaction system

[0110]

[0111] Table 3 qRT-PCR reaction procedure

[0112]

[0113] Table 4 qRT-PCR primer sequences

[0114]

[0115]

[0116] 1.2.11 Transcriptome Sequencing and Analysis

[0117] Seedlings grown on 1 / 2 MS solid medium for 10 days were transferred to water for overnight recovery and then treated with 1 μM of a small peptide for 15 minutes. The seedlings were removed with forceps, dried, and snap-frozen in liquid nitrogen. Samples were then collected for transcriptome analysis. RNA sequencing was performed by Shanghai Meiji Biotechnology Co., Ltd. on the Illumina Nova Seq X Plus platform.

[0118] 1.2.11.1 Gene expression analysis

[0119] RNA-seq analysis estimates gene expression levels by counting sequencing reads mapped to genomic regions or exon regions, and calculates gene expression levels using the FPKM (Fagments per kilo base of transcript per million fragments mapped) method that eliminates gene length and measures differences.

[0120] Based on the FPKM values ​​of all genes in different samples, correlation analysis, cluster analysis, and principal component analysis (PCA) were performed between samples. Correlation analysis between samples was performed using the Pearson correlation method using the cortest function in R v3.5.1 software. PCA was performed using the SVD (singular value decomposition) covariance matrix decomposition method using the prcomp function in R v3.5.1 software.

[0121] DESeq2 software was used to perform differential expression analysis on samples treated with control and small peptides to detect small peptide-responsive genes. HTSeqv0.6.1 software was first used to calculate the number of reads measured for each gene. DESeq2 used a statistical model based on the negative binomial distribution to calculate the differential expression fold (Foldchange) and significance (p-value) of genes. The obtained p-value was subjected to a multiple comparison test according to the Beniaminli and Hochberg method to obtain the q-value, i.e., the FDR (False Discovery Rate). The detection criteria for DEGs were log2|(Fold change)|>1 and FDR<0.05.

[0122] 1.2.11.2 GO functional annotation analysis of differentially expressed genes

[0123] Gene Ontology (GO) classifies and annotates gene functions. Genes are assigned GO numbers through their IDs or sequence annotations, which in turn map them to terms. The number of DEGs annotated to each GO term was calculated, and a hypergeometric test was applied to identify GO terms that were significantly enriched in DEGs compared to the entire genomic background. After correcting the calculated p-value, GO terms that met this threshold of p ≤ 0.05 were defined as significantly enriched in DEGs.

[0124] 1.2.11.3 KEGG pathway analysis of differentially expressed genes

[0125] Hypergeometric test was applied to each pathway in Kyoto Encyclopedia of Genes and Genomes (KEGG) to perform enrichment analysis and identify pathways that were significantly enriched in DEGs.

[0126] 1.2.12 Gene cloning and Agrobacterium transformation

[0127] Specific primers were designed for the target gene using the Vazyme website (https: / / crm.vazyme.com / cetool / singlefragment.html). The target gene was amplified and purified using DNA polymerase, then ligated into the linearized target vector via homologous recombination. The procedure is described in the instructions. The nucleotide sequence of the target gene (SEQ ID NO: 5) is:

[0128] ATGGCTTCACCAACTCTTACTCTCCTCCTCCTCCTCACCACCGTCTCCTTCTTCATCTCCTCCTCCCGCAGATCCTGACATGCTTCAAGATCTCTGCGTCGCTGATCTTCCCTCTGGAATCAAAATCAATGGCTTCCCTTGCAAAGACGCAGCTACAGTCACATC AGCCGATTTCTTCTCACAAGGATTAGCTAAACCAGGTCTTACCAACAACACATTCGGTGCCTTAGTCACAGGAGCTAACGTTATGACAATCCCAGGACTCAACACACTTGGTGTCTCCCTCTCTCGTATCGACTACGCACCAGGAGGCTTAAACCCACCTCACA CCCACCCACGTGCCACTGAGGTCGTTTTCGTCCTCGAAGGAACACTTGACGTTGGGTTTCTCACTACTGCCAATAAGCTAATCTCTCAATCTCTCAAGAAAGGAGATGTCTTTGCTTTCCCCAAAGGACTTGTCCATTTCCAGAAGAACAATGGTGATGTCCCT GCTTCTGTTATTGCAGCTTTCAATAGTCAGCTTCCTGGAACTCAATCTCTTGGTGCTACTTTGTTTGGTTCTACTCCTCCTGTTCCTGACAACATCTTGGCTCAAGCCTTTCAGACTTCTCCAGGAACTGTTAAACACATCAAATCCAAGTTCCAACCCAAGAAA

[0129] 100 ng of the correctly sequenced plasmid was incubated with competent Agrobacterium tumefaciens GV3101 on ice for 5 minutes, snap-frozen in liquid nitrogen for 5 minutes, heat-shocked at 37°C for 5 minutes, and placed on ice for 5 minutes. Then, 1 mL of antibiotic-free LB medium was added and incubated at 28°C for 2-3 hours. 100 μL of the culture was spread onto an LB plate (50 μg / mL Rif, 100 μg / mL Kana) and incubated at 28°C for 2 days. Single colonies were selected for PCR identification.

[0130] 1.2.13 Construction of Arabidopsis stable overexpression lines

[0131] The scraped GV3101 containing the target gene was inoculated into the medium containing the corresponding antibiotic, and cultured at 28°C for 24h, then transferred to 400mL fresh medium, and cultured until the OD 600 about 1.2 (about 16h). The bacteria were collected by centrifugation at 5,500r / min for 20min, resuspended with the infection solution (1 / 2MS, 5% sucrose, 0.02% Silwet L-77, pH 5.7) to make the OD 600 about 0.8. The four-week-old Col-0 plants with dehiscent siliques and white open flowers were infected for 30s, and then dark treated overnight. The next day, the plants were placed in the long-day plant room to wait for seed collection.

[0132] The transgenic seeds were surface sterilized and then sown on 1 / 2MS solid medium containing the corresponding plant selection resistance. For the seedlings with true leaves, the above-mentioned resistance screening steps were repeated until homozygotes were screened out.

[0133] 1.2.14 Subcellular localization experiment

[0134] The pCAMBIA1305-LAND2-GFP plasmid was constructed and transformed into Agrobacterium GV3101 strain, and cultured in LB medium overnight until the OD 600 value reached 0.4-0.6. After centrifugation at 5,000r / min for 10min, the supernatant was discarded, and the bacteria were resuspended with an equal volume of bacterial infection solution, and the bacterial concentration was adjusted to OD 600 value of 0.4-0.6. The small peptide precursor bacterial solution was mixed with the membrane Marker bacterial solution at a ratio of 1:1, and then 200μM acetyl vanillin was added before use. The mixed bacterial solution was transformed into 4-5 week old tobacco (Nicotiana tabacum) leaves by pressure infiltration method. 48-72h after transformation, the transgenic tobacco leaves were collected and imaged using a confocal laser microscope.

[0135] 1.2.16 Statistical analysis

[0136] The collected data was analyzed using IBM SPSS Statistics version 26. ANOVA was used for statistical analysis to determine the significance of the variables studied. The differences between the means of the groups were compared by Duncan's Multiple Range Test (DMRT) with a significance level of p<0.05. TBtools-II, Excel2019 and Origin 2019b were used for plotting.

[0137] 1.2.17 Accession Number

[0138] The transcriptome data SRP055503 for gene expression analysis and the raw transcriptome data PRJNA1171985 for LAND2-treated Arabidopsis thaliana are available at the NCBI Sequence Read Archive (SRA).

[0139] 2 Results and Analysis

[0140] 2.1 Identification of the PreLANDs family

[0141] 2.1.1 Screening of Arabidopsis small peptide dataset

[0142] To identify new small peptides from the model plant Arabidopsis thaliana, we first downloaded the Arabidopsis proteome database from the NCBI database. Subsequently, we used bioinformatics tools and combined them with the characteristics of small peptides to conduct a systematic screening process. These characteristics include: the number of amino acids between 25 and 250, the presence of a signal peptide sequence, and the absence of a transmembrane helical structure and an endoplasmic reticulum retention sequence. Through this stringent screening criteria, we ultimately identified 1,702 candidate Arabidopsis small peptide precursor sequences that met the above criteria ( Figure 1 ).

[0143] 2.1.2 Identification of members of the immune-related small peptide family

[0144] The classification of plant small peptides is often based on the conserved peptide motifs in their C-terminal regions. These motifs are highly conserved among small peptides from different families, providing a molecular basis for the identification and classification of family members. This study used public transcriptome database resources to screen out a family of small peptide precursors with potential immunomodulatory functions, preLANDs, which are included in the GLPs protein family that plays a key role in the plant immune system. Its members are: preLAND1 (AT1G02335), preLAND2 (AT1G09560), preLAND3 (AT3G05930), preLAND4 (AT3G62020), and preLAND5 (AT5G26700). In the Arabidopsis genome, the distribution of the precursor genes of the preLANDs family members on the chromosomes is shown below. Figure 2 As shown, there is a precursor gene of one family member on chromosome 1, two precursor genes of family members on chromosome 3, and one precursor gene of family member on chromosome 5.

[0145] 2.1.3 Motif distribution of PreLANDs family members

[0146] The MEME tool was used to perform motif prediction analysis on preLANDs family members. The results showed that 10 conserved motifs were identified in all members. These motifs were highly conserved in different preLANDs family members ( Figure 3 ), which may play an important role in its function and evolution. Further research on these conserved motifs can reveal their potential significance in gene expression regulation, protein interaction and biological function.

[0147] 2.1.4 Analysis of the structure and expression pattern of the PreLANDs family

[0148] Further structural analysis of the preLANDs family members showed that all family members showed high structural similarity and possessed typical features of secretory peptide precursors. Specifically, these members contain an N-terminal signal peptide, a highly conserved C-terminal region, and an intermediate variable region located between the signal peptide and the conserved motif ( Figure 4 A), and are composed of untranslated regions, introns, and coding sequences ( Figure 4 B) The N-terminal signal peptide is often involved in intracellular signal transduction and directional protein trafficking, while the conservation of the C-terminal region suggests that this region has been subject to strong selective pressure during evolution and may be closely related to its function. The presence of the intermediate variable region may provide functional diversity among different family members, enabling them to adapt to different biological environments and needs.

[0149] 2.1.5 Analysis of cis-acting elements of PreLANDs family members

[0150] Further cis-acting element analysis of the precursor genes of preLANDs family members showed that these genes contained motifs related to defense mechanisms and stress responses ( Figure 5 AB). The identification of these motifs suggests that members of the preLAND family may play a key role in plant immune responses. This discovery provides important clues to understanding the mechanisms by which preLANDs respond to pathogen infection and environmental stress, and suggests their potential function in regulating the plant immune system.

[0151] 2.1.6 Weblogo Analysis of the LANDs Peptide Family

[0152] Plant small peptides are usually divided into different families based on the conserved peptide motifs in their C-terminal regions, such as PIP1, SolP12, SCOOP12, etc. To further explore the characteristics of preLANDs family members, this study constructed a WebLogo diagram of the conserved motif sequence at its C-terminus ( Figure 6The results showed that the C-terminal amino acid sequences of preLANDs family members are highly conserved, particularly at the two terminal amino acid positions, both of which are lysines. Furthermore, this conserved sequence is rich in lysine residues. Given these characteristics, this family of predicted small peptides of unknown function was named "Lysine-rich plant peptides"—LANDs.

[0153] 2.1.7 Analysis of co-expressed genes of the LANDs peptide family

[0154] Co-expression analysis of LAND family members showed that LAND1 and LAND2 were co-expressed with AT1G02900 (AtRALF1) ( Figure 7 RALFs are a family of small secreted peptides that have been shown to be involved in reproductive development and immune regulation. Therefore, LAND1 and LAND2 may also play similar roles in plants, participating in key physiological processes such as growth and development and immune response. This provides important clues and theoretical basis for further research into the functions of LAND family proteins.

[0155] 2.2 LAND2 induces immune responses in Arabidopsis

[0156] 2.2.1 Detection of the expression level of the PreLANDs family after infection with Botrytis cinerea

[0157] Based on the identification of the conserved motif, this study conducted an in-depth study of its potential biological functions. Based on preLAND2, the most significantly upregulated small peptide family precursor gene expression after infection by Botrytis cinerea, its putative mature peptide LAND2 was subsequently synthesized and subsequently functionally analyzed ( Figure 8 A). To further verify this hypothesis, qRT-PCR technology was used to detect the effect of different time points (1h, 6h and 12h) after gray mold infection on the expression of LAND2 small peptide precursor gene. The experimental results showed that the expression of LAND2 small peptide precursor gene was significantly upregulated 1h and 6h after gray mold infection ( Figure 8 B), indicating that the expression of the LAND2 peptide is closely related to Botrytis cinerea infection. Therefore, this study decided to use LAND2 as the main research object in subsequent experiments to further explore its biological role and potential mechanisms during Botrytis cinerea infection.

[0158] 2.2.2 Expression levels of PreLAND2 in different tissues

[0159] To explore the expression characteristics of the LAND2 peptide precursor in different tissues of Arabidopsis thaliana, this study collected tissue samples from various parts of Arabidopsis thaliana, including flowers, roots, stems, leaves, pods, and seeds. The expression levels of the preLAND2 gene in different tissues were quantitatively analyzed using RNA extraction and qRT-PCR. The experimental results showed that the expression level of preLAND2 in leaves was significantly higher than that in other tissues, showing the highest level; followed by seeds and roots; while the expression level in flowers, stems, and pods was lower ( Figure 9 This finding suggests that LAND2 may play an important biological role in leaves. Based on this result, this study selected leaves as the key research tissue for subsequent experiments to further understand the function and biological significance of LAND2 in Arabidopsis.

[0160] 2.2.3 Subcellular localization of PreLAND2 in Nicotiana benthamiana cells

[0161] The maturation and function of proteins often depend on their localization in specific subcellular organelles. Each subcellular organelle contains a group of specific proteins, and the subcellular localization of proteins is an important basis for studying their functions. This study first used the ePlant tool to predict that the LAND2 protein is located outside the cell ( Figure 10 To further confirm that LAND2 protein can be secreted into plant exoplasts, this study constructed a preLAND2-GFP fusion expression vector and introduced it into Nicotiana benthamiana leaves for transient expression experiments. Laser confocal microscopy revealed that ( Figure 11 ), the green fluorescence signal of preLAND2-GFP and the red fluorescence signal of the cell membrane marker highly overlapped in spatial distribution, indicating that the preLAND2-GFP signal was mainly distributed in the cell membrane. This result was consistent with the localization of the OsSSP1 precursor in tobacco cells that had not undergone plasmolysis treatment.

[0162] 2.2.4 LAND2 induces ROS burst in Arabidopsis

[0163] As a second messenger molecule, ROS participates in the immune response of plant cells to pathogen molecular patterns. Specifically, pathogen molecular patterns induce the release of ROS in plant cells, and this ROS burst is an important part of the plant immune response. Luminol luminescence assay detected that both flg22 and LAND2 peptide treatments caused ROS bursts in Arabidopsis. The flg22 treatment reached a peak of ROS burst at about 10 minutes; in contrast, the 1μM concentration of LAND2 peptide treatment group reached a peak at about 12 minutes, and the peak value of this concentration treatment was significantly higher than that of the 100nM concentration of LAND2 treatment group ( Figure 12These results indicate that LAND2 peptides can more effectively induce ROS production at higher concentrations.

[0164] NBT can react with superoxide anions (O2 - ) reacts and is reduced to a blue insoluble compound, which can be used to detect O2 in plant tissues - The accumulation of Figure 13 As shown in A, after NBT staining, the Arabidopsis leaves treated with the experimental group and the positive control group showed a large area of ​​blue staining, indicating that O2 - In contrast, the leaves of the negative control group showed no obvious staining, indicating that O2 - The accumulation level was low. Further statistical analysis of NBT staining intensity showed that the O2 - The accumulation amount was slightly lower than that of flg22 treatment group, but both were significantly higher than that of negative control group ( Figure 13 B) These results indicate that LAND2 peptide can effectively induce O2 - Although its intensity is slightly weaker than that of the classic PAMP molecule flg22, it still has significant activity.

[0165] 2.2.5 LAND2 induces callose deposition in Arabidopsis

[0166] Callose deposition is one of the important indicators for judging the immune response of plants. In order to explore whether LAND2 peptide can induce callose deposition in Arabidopsis leaves, this experiment used aniline blue staining to detect the callose deposition caused by LAND2 peptide. Figure 14 The experimental results of A showed that after aniline blue staining, Arabidopsis leaves under fluorescence illumination showed obvious callose fluorescence reaction in the flg22 and LAND2 treatment groups, which appeared as bright fluorescent spots, while the negative control group had almost no fluorescent signal. This shows that both flg22 and LAND2 peptides can induce callose deposition. The fluorescence intensity of callose was further quantified using ImageJ software. The results are shown in Figure 2. Figure 14 As shown in B. The callose fluorescence intensity of the flg22-treated group was significantly higher than that of the other two groups, while the fluorescence intensity of the LAND2-treated group was lower than that of the flg22 group, but significantly higher than that of the negative control group.

[0167] 2.2.6 LAND2 induces stomatal closure in leaves

[0168] Stomatal opening and closing play a crucial role in plant responses to environmental changes. When encountering pathogenic bacteria, plants often close stomata to limit the invasion of pathogenic bacteria, thereby reducing the damage caused by pathogenic bacteria. This study explores whether the exogenous application of 1 μM LAND2 peptide can cause the closure of stomata in Arabidopsis thaliana leaves. According to the experimental results shown in Figure 15 A, after the exogenous application of LAND2 peptide, the stomata of the lower epidermis of Arabidopsis thaliana leaves significantly closed, indicating that LAND2 peptide can induce stomatal closure. Statistical analysis of stomatal aperture shows that there is no significant difference in the effect of inducing stomatal closure between the LAND2 and flg22 treatment groups, and their stomatal apertures are about 0.3( Figure 15 B). In contrast, the stomatal aperture of the ddH2O negative control group is 0.42, which is significantly higher than that of the above two treatment groups. This indicates that LAND2 peptide may have similar effects to flg22 in inducing stomatal closure, both of which can effectively regulate the opening and closing of stomata to help plants resist pathogenic bacteria invasion.

[0169] 2.2.7 LAND2 induces MAPK activation

[0170] The MAPK cascade in plants is an important intercellular signaling module that regulates plant growth, development, reproduction, and responses to biological and non-biological stress. The experimental results are shown in Figure 16 A, flg22 treatment group and LAND2 treatment group have more obvious MAPK3 and MAPK6 phosphorylation than water negative control group, and flg22 treatment causes stronger MAPK phosphorylation than LAND2 at 15 min. The above results prove that LAND2 can cause MAPK phosphorylation in Arabidopsis thaliana seedlings, thereby activating the MAPK cascade to transmit immune signals downstream of Arabidopsis thaliana and activate downstream immune responses.

[0171] 2.2.8 LAND2 enhances the resistance of Arabidopsis thaliana leaves to Botrytis cinerea

[0172] To explore whether LAND2 peptide can improve the immune activity of Arabidopsis thaliana to resist Botrytis cinerea, this study inoculated Botrytis cinerea spores on Arabidopsis thaliana leaves after exogenous application of small peptides, and observed the leaf conditions after about 4 days. The experimental results are shown in Figure 17 A, the leaf lesion area of the LAND2 peptide treatment group and the flg22 peptide treatment group is significantly reduced compared with the ddH2O treatment group. To further quantify this observation, the ratio of lesion area to total leaf area was statistically analyzed( Figure 17 B). The statistical results are consistent with the difference in lesion area shown in the figure, indicating that LAND2 peptide can effectively reduce the damage of Arabidopsis thaliana leaves and enhance its resistance to Botrytis cinerea.

[0173] 2.3 Overexpression or mutation of the PreLAND2 gene affects Arabidopsis immunity

[0174] 2.3.1 PreLAND2 overexpression enhances resistance to Botrytis cinerea

[0175] To further verify the immune function of LAND2 at the genetic level, this study successfully constructed transgenic plants overexpressing the LAND2 precursor in the Arabidopsis Columbia ecotype (Col-0) using Agrobacterium-mediated transformation. Figure 18 A). The two 4-week-old LAND2 overexpression lines showed almost no significant difference in appearance from wild-type Arabidopsis ( Figure 18 B), indicating that the LAND2 precursor gene may not have a significant effect on plant growth and development. However, in the gray mold resistance experiment, the preLAND2 overexpression line showed significantly enhanced disease resistance. Specifically, Figure 19 As shown in A, the disease symptoms of preLAND2-overexpressing plants after infection with gray mold were relatively mild, with smaller lesion areas, indicating stronger resistance than the wild type. Further quantitative statistical analysis was consistent with the observation results ( Figure 19 B) Both preLAND2 overexpressing lines showed significantly enhanced resistance to Botrytis cinerea, indicating that the preLAND2 gene may play an important positive role in plant disease defense.

[0176] Amino acid sequence of overexpressed LAND2 precursor (SEQ ID NO: 6):

[0177] MASPTLTLLLLLTTVSFFISSSADPDMLQDLCVADLPSGIKINGFPCKDAATVTSADFFSQGLAKPGLTNNTFGALVTGANVMTIPGLNTLGVSLSRIDYAPGGLNPPHTHPRATEVVFVLEGTLDVGFLTTANKLISQSLKKGDVFAFPKGLVHFQKNNGDVPASVIAAFNSQLPGTQSLGATLFGSTPPVPDNILA QAFQTSPGTVKHIKSKFQPKK

[0178] Note: The underlined part is the LAND2 peptide, which is processed from the precursor in the transgenic plants.

[0179] 2.3.2 Land2 mutant plants have reduced resistance to Botrytis cinerea

[0180] This study also used CRISPR / Cas9 gene editing technology to obtain preLAND2 gene knockout mutant plants, and analyzed the mutation types of land2#1 and land2#2 by DNA sequencing. The results showed that there was a single nucleotide insertion in the land2#1 mutant, while there was a nucleotide deletion in the land2#2 mutant ( Figure 20 A). Morphologically, the 4-week-old land2 mutant showed no significant difference in appearance from wild-type Arabidopsis ( Figure 20 B). However, under infection with Botrytis cinerea, the land2 mutant showed weakened disease resistance compared to the WT. In addition, no significant difference in disease resistance was detected between the land2 mutant and the WT after exogenous application of LAND2 peptide ( Figure 21 AB), indicating that the application of exogenous small peptides can effectively restore the disease resistance of land2 mutants. In summary, preLAND2 can induce immune effects in plants and provide resistance to pathogen infection.

[0181] 2.4 Transcriptome analysis of Arabidopsis seedlings treated with LAND2

[0182] To systematically dissect the molecular mechanisms by which LAND2 regulates growth and development and biotic stress resistance in Arabidopsis thaliana, this study used transcriptome sequencing (RNA-seq) to analyze the transcriptome of Arabidopsis seedlings treated with LAND2. This strategy not only reveals the regulatory role of LAND2 at the transcriptional level but also provides important clues for elucidating the molecular mechanisms by which plant peptides influence plant growth and development and stress responses by regulating gene expression networks. High-throughput RNA-seq data revealed genome-wide expression changes induced by LAND2 treatment, laying an important molecular foundation for a deeper understanding of the functional mechanisms of plant peptides.

[0183] 2.4.1 Principal component analysis of transcriptome

[0184] The transcriptome differences between the treatment group and the control group were evaluated by PCA. The results showed that after LAND2 peptide treatment, there was a clear boundary between the samples and the control group. Component 1 (PC1) accounted for 32.99%, and component 2 (PC2) accounted for 21.46%, accounting for 54.45% of the explained variation. Specifically, samples in the same treatment group clustered more closely in the principal component analysis diagram, while samples in different groups showed significant separation. This indicates that LAND2 treatment significantly changed the transcriptome characteristics of Arabidopsis thaliana. Compared with the control group, there were significant differences in gene expression patterns between the two ( Figure 22 ).

[0185] 2.4.2 Analysis of differentially expressed genes

[0186] Transcriptome analysis results showed that LAND2 treatment significantly induced 212 DEGs (log2|(Fold change)|>1, P-value≤0.05) in Arabidopsis seedlings, of which 126 genes were up-regulated and 86 genes were down-regulated Figure 23 ) Notably, the number of up-regulated genes was significantly higher than that of down-regulated genes, with an increase of 31.75% in the number of up-regulated genes compared to down-regulated genes. This significant difference indicates that LAND2 may mainly exert its biological function by activating the expression of specific genes.

[0187] 2.4.3 Statistical analysis of transcription factor families and cluster heat map analysis of differentially expressed genes

[0188] Statistical analysis of transcription factor families found that Ethylene response factor (ERF), which is closely related to plant disease resistance, was significantly overexpressed compared to other transcription factor families Figure 24 ) ERFs, as core regulatory factors in the plant hormone ethylene signaling pathway, play a key role in plant defense response and stress response, and their significant overexpression indicates that LAND2 may enhance plant biological stress resistance by regulating the ethylene signaling pathway. Hierarchical clustering of genes based on their differential expression and statistical significance revealed that samples showed a clear grouping trend in gene expression patterns, and the gene expression differences between the experimental and control groups resulted in two main clusters, indicating significant differences in gene expression patterns Figure 25 ) between them.

[0189] 2.4.4 KEGG pathway and GO function enrichment analysis of differentially expressed genes

[0190] To further analyze the molecular mechanisms of LAND2 regulating plant immune response, this study focused on KEGG pathway and GO function enrichment analysis of up-regulated genes induced by LAND2. KEGG pathway analysis results showed that the main biological processes (BPs) activated by LAND2 were closely related to plant-pathogen interactions Figure 26 ) These pathways play an important role in plant immune response, indicating that LAND2 may enhance plant defense against pathogenic bacteria by regulating these pathways. In addition, GO function enrichment analysis further revealed the biological functions of LAND2 up-regulated genes Figure 27 ) Among the biological process categories, cell response to abiotic stimuli and hypoxia response were significantly enriched, suggesting that LAND2 may enhance plant stress adaptability by regulating the expression of abiotic stress-related genes.

[0191] KEGG and GO analyses of LAND2-upregulated genes not only revealed its key role in plant immune responses but also suggested that LAND2 may enhance plant multidisease resistance by regulating the expression of genes associated with abiotic stress. These results provide important clues for further understanding the molecular mechanisms by which plant peptides enhance plant disease resistance by regulating gene expression networks.

[0192] 2.4.5 qRT-PCR verification analysis of differentially expressed genes

[0193] To ensure the reliability of RNA-seq data, this study used qRT-PCR technology to experimentally verify the transcriptome analysis results. Eight representative genes were selected from the DEGs and verified by qRT-PCR. The experimental results showed that the expression patterns of the selected genes were consistent with the differential expression trends in the RNA-seq data, further confirming the accuracy and reproducibility of differential expression ( Figure 28 ), providing a solid experimental basis for subsequent functional analysis and mechanism research. This verification process not only enhances the credibility of this study, but also provides a reliable technical reference for the study of plant small peptides regulating gene expression.

[0194] 2.5LAND2 induces systemic acquired resistance in Arabidopsis leaves

[0195] 2.5.1 LAND2 induces superoxide anion deposition in Arabidopsis leaf system

[0196] In addition to having an innate immune response, plants have also developed a mechanism called SAR. In this mechanism, the defense signals triggered by PTI and ETI are transmitted to adjacent areas and distal parts of the infected plant through local and systemic signal transduction pathways. This signal transduction process involves complex molecular recognition and response mechanisms, thereby establishing an extensive defense network in the plant body. The ROS burst was detected by NBT staining. Both the local treatment group and the systemic treatment group of Arabidopsis leaves caused significant staining of superoxide anions, forming dark purple or blue precipitates. This phenomenon indicates that the LAND2 peptide treatment effectively triggered the ROS burst ( Figure 29 A). Further quantitative statistical analysis of the staining intensity revealed that, consistent with the phenotypic results, the staining intensity of the local and systemic groups treated with LAND2 peptide was significantly higher than that of the negative control group treated with ddH2O, confirming that LAND2 peptide induced a strong immune response in Arabidopsis ( Figure 29 B).

[0197] 2.5.2 LAND2 induces systemic resistance to Botrytis cinerea in Arabidopsis leaves

[0198] To further investigate the effect of LAND2 peptide on plant SAR, this study analyzed local treatment and systemic responses in Arabidopsis plants. Four days after spraying the peptide and inoculating with Botrytis cinerea, the lesion area on the leaves of plants treated with LAND2 peptide (LAND-local) and the untreated leaves of the same plant (LAND-system) was significantly smaller than that on the negative control group treated with ddH2O ( Figure 30 AB). Specifically, the lesion area of ​​LAND2-local leaves was reduced by approximately 40% compared to the negative control, while the lesion area of ​​LAND2-system leaves was also reduced by approximately 35%, indicating that the LAND2 peptide not only activates local immune responses but also induces systemic immune responses. The reduction in lesion area of ​​LAND2-system leaves was similar to that of LAND-local leaves, indicating that LAND2-induced systemic immune signals can be rapidly transmitted and exerted within the plant. These results not only reveal the dual role of LAND2 peptides in plant immune regulation but also provide important experimental evidence for in-depth analysis of the plant immune signaling mechanism mediated by peptides.

[0199] 2.5.3 Upregulation of disease resistance-related gene systems in Arabidopsis leaves after LAND2 treatment

[0200] When plants encounter various stresses (such as pathogen infection, environmental pressure, etc.), they usually regulate the expression of specific genes, thereby initiating corresponding defense mechanisms. These defense responses can enhance the disease resistance of plants. This study analyzed the effects of LAND2 peptide treatment on the expression of disease-related genes in local and systemic leaves of Arabidopsis. The results of qRT-PCR detection showed that LAND2 treatment significantly induced the upregulation of the expression of PR2 and PR5 genes related to the disease process in local and systemic leaves of Arabidopsis, indicating that LAND2 can effectively activate the local and systemic plant immune response of Arabidopsis leaves. Specifically, the expression levels of both PR2 and PR5 genes increased significantly, reflecting the important role of LAND2 in regulating plant defense responses. In addition, the NPR1 gene showed significant upregulation in local leaves, and although there was a certain upregulation trend in systemic leaves, it did not reach statistical significance ( Figure 31 ).

[0201] 2.6 Expression pattern of PreLAND2

[0202] 2.6.1 PreLAND2 expression is regulated by some hormones

[0203] In the field of plant biology, genes encoding small peptides are usually expressed specifically under certain conditions. This study explored the expression pattern of the LAND2 precursor gene under different hormone treatments to reveal its regulatory mechanism and potential function. Through experimental analysis, it was found that ABA treatment did not cause significant changes in the expression of the LAND2 precursor gene. However, under IAA treatment, the expression of the LAND2 precursor gene experienced a process of first decreasing and then increasing, suggesting that IAA may affect the expression of LAND2 through a complex regulatory network within a specific time window. In contrast, after 3h of GA3 treatment, the expression level of the LAND2 precursor gene was significantly increased. In addition, after JA treatment, the expression level of the LAND2 precursor gene was significantly reduced ( Figure 32 These results indicate that the expression of LAND2 peptide is significantly affected by GA3 and JA, suggesting that LAND2 peptide may be involved in regulating seed germination and plant growth in addition to plant immune function. In addition, it was found that LAND2 peptide dynamically regulates the expression of its precursor gene preLAND2 ( Figure 33 This self-regulatory mechanism may be achieved through negative or positive feedback loops to ensure that LAND2 expression levels in plants are precisely regulated. For example, when LAND2 peptides accumulate to a certain concentration, they may maintain expression balance by inhibiting the transcription of preLAND2 or promoting its degradation.

[0204] These results suggest that LAND2 not only participates in plant immune responses but also may participate in plant growth and development through a complex regulatory network. These findings provide important clues for further analysis of the multiple functions of LAND2 small peptides and their regulatory mechanisms, and also lay a theoretical foundation for exploring the role of small peptides in the cross-regulation of plant hormone signaling.

[0205] 2.6.2 Expression pattern of preLAND2 under abiotic stress

[0206] In plant biology research, abiotic stresses significantly affect plant growth and development. This study aimed to investigate the expression characteristics of the LAND2 precursor gene under various abiotic stress conditions, including salt stress (NaCl), high temperature stress (37°C), low temperature stress (4°C), and darkness. Using qRT-PCR, we systematically analyzed the dynamic expression of the LAND2 precursor gene at different stress treatment time points (0 h, 1 h, 3 h, and 6 h). The results showed that after 6 h of NaCl treatment, the relative expression of the LAND2 precursor gene was significantly upregulated compared with the control, reaching an expression level eightfold higher than that of the control. This finding suggests that the LAND2 gene may participate in the plant salt stress response mechanism through transcriptional regulation, providing important theoretical basis for further elucidating the molecular mechanisms of plant disease resistance. Furthermore, under high temperature stress, the expression level of the LAND2 precursor gene showed a downward trend, while under low temperature stress, its expression level significantly increased. These opposing trends suggest that the LAND2 precursor gene may be closely related to the plant temperature response mechanism. Under dark stress conditions, the expression level of the LAND2 precursor gene also increased significantly, indicating that LAND2 may be involved in regulating the plant's response to light changes ( Figure 34 These results not only reveal the potential role of the LAND2 precursor gene in plant response to abiotic stress, but also provide important clues for further studying the function of LAND2 peptides in plant growth, development and environmental adaptation.

[0207] 2.7 Broad-spectrum immune function and evolution of LAND2

[0208] 2.7.1 LAND2 peptide induces MAPK activation in pepper and cucumber

[0209] In the field of plant immune response, the mechanism of small peptides as signaling molecules in a wide range of species has always been a hot topic. However, only a few small peptides such as flg22 have been widely reported to have broad biological activity. In order to further understand the conservation and specificity of the LAND small peptide family among different species, we conducted a comparative analysis of the preLANDs family members across species. By comparing the gene sequences of Arabidopsis, Brassica napus, pepper, cucumber, watermelon (Citrullus lanatus), soybean (Glycine max), mung bean (Vigna radiata), tobacco, maize (Zea mays), and rice (Oryza sativa), we found that preLAND2 had highly conserved homologous sequences in these species. We then synthesized pepper LAND1 (CaLAND1) and cucumber LAND1 (CsLAND1) small peptides that were more similar to the LAND2 sequence to evaluate whether the application of LAND2 could effectively induce immune responses in different plant species. The results of the MAPK experiment showed that LAND2 and its homologous peptides could effectively activate the MAPK signaling pathway in multiple plant species. Figure 35 ) This result not only confirmed the important role of LAND2 in plant immune response, but also revealed its broad immune activity in different plant species.

[0210] 2.7.2 LAND2 small peptides enhance the resistance of pepper and cucumber to Botrytis cinerea

[0211] The experimental results showed that the resistance of pepper and cucumber leaves to Botrytis cinerea was significantly enhanced after the exogenous application of LAND2, CaLAND1, CsLAND1, and flg22. As shown in Figures Figure 36 A and Figure 37 A, the lesion area of the small peptide treatment group was significantly smaller than that of the negative control group. Statistical analysis of the lesion area showed that the ratio of lesion area to total area in the experimental and positive control groups was significantly lower than that in the negative control group Figure 36B and 37B). These data indicate that exogenous application of these compounds can effectively activate the plant's defense mechanisms, thereby significantly inhibiting the infection and spread of Botrytis cinerea. Furthermore, the experiment observed that the leaves in the treated group maintained a good physiological state after inoculation with Botrytis cinerea, with the leaves remaining green and showing no obvious wilting or yellowing, while the leaves in the negative control group showed obvious lesion expansion and leaf wilting. This result further supports the positive role of LAND2, CalAND1, CsLAND1, and flg22 in enhancing plant disease resistance. Exogenous application of LAND2, CalLAND1, CsLAND1, and flg22 can significantly enhance the resistance of pepper and cucumber leaves to Botrytis cinerea, reduce the area of ​​lesions, and delay the spread of lesions, providing new ideas and experimental basis for the biological control of plant diseases.

[0212] In summary, exogenous application of peptides from the LAND peptide family to plants (Arabidopsis thaliana, peppers, and cucumbers) enhanced local and systemic resistance to Botrytis cinerea, and exhibited broad-spectrum immune activity in peppers and cucumbers. The practical application of the peptides of this invention in agricultural production could enhance plant disease resistance and improve plant yield and quality, demonstrating their practical application value.

Claims

1. A polypeptide for improving plant disease resistance, characterized in that: The polypeptide is a LAND2 peptide and its homologous peptide; the amino acid sequence of the LAND2 peptide is shown in SEQ ID NO: 1; The homologous peptides include a CalAND1 small peptide having an amino acid sequence as shown in SEQ ID NO: 3, and a CsLAND1 small peptide having an amino acid sequence as shown in SEQ ID NO:

4.

2. Use of the polypeptide according to claim 1 in the preparation of a plant immune inducer for improving plant disease resistance.

3. The use according to claim 1, characterized in that The plants include Arabidopsis thaliana, pepper and / or cucumber.

4. The use according to claim 3, characterized in that The amino acid sequence of the polypeptide that improves disease resistance in Arabidopsis thaliana is shown in SEQ ID NO: 1; the amino acid sequence of the polypeptide that improves disease resistance in pepper is shown in SEQ ID NO: 1 or SEQ ID NO: 3; the amino acid sequence of the polypeptide that improves disease resistance in cucumber is shown in SEQ ID NO: 1 or SEQ ID NO:

4.

5. The use according to claim 2, characterized in that The disease resistance includes resistance to pathogenicity caused by biotic stress or resistance to pathogenicity caused by abiotic stress.

6. The use according to claim 5, characterized in that Resistance to biotic stress-induced pathogenicity is resistance to infection by plant pathogens; such plant pathogens include Botrytis cinerea.

7. The use according to claim 5, characterized in that Resistance to abiotic stress pathogens is resistance to extreme environmental stimuli; such extreme environments include high salinity, low temperature, high temperature and / or darkness.

8. A plant immune inducer, characterized in that The preparation is prepared by taking the polypeptide according to any one of claims 1 to 3 as an active ingredient and adding a plant-acceptable auxiliary material.

9. A recombinant bacterium, characterized in that: It is an Agrobacterium containing a gene fragment with a nucleotide sequence as shown in SEQ ID NO: 5; the Agrobacterium includes Agrobacterium GV3101.

10. A method for constructing a disease-resistant plant, characterized in that: The method comprises using genetically engineered bacteria to mediate transformation of plants to express the polypeptide according to any one of claims 1 to 3; The plant comprises Arabidopsis thaliana; the Arabidopsis thaliana is a four-week-old Columbia type Arabidopsis thaliana; The genetically engineered bacteria include the recombinant bacteria according to claim 9.

Images