Gene editing system for developing Staphylococcus aureus mastitis resistant Holstein dairy cow aiming at ADAM10 gene and application of gene editing system

Abstract

The invention discloses a gene editing system for developing a Staphylococcus aureus mastitis resistant Holstein cow aiming at an ADAM10 gene and application of the gene editing system. According to the invention, a novel single-base gene editing ABE technology is used to carry out gene editing on dairy cow fibroblasts, amino acids at main action sites of cell surface receptors ADAM10 of alpha-hemolysin are mutated, and the affinity activity between the two is reduced. Experiments prove that compared with a wild type, the inflammatory sensitivity of the mutated cow mammary epithelial cells to alpha-hemolysin is greatly reduced. Then, gene editing individuals are cultivated through cell nucleus transfer and embryo transfer technologies, and the mastitis resistance of the individuals is achieved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a gene editing system for developing a Holstein cow resistant to Staphylococcus aureus mastitis by targeting the ADAM10 gene and an application thereof. Background Art

[0002] Mastitis is a common disease in dairy cows, resulting in decreased milk production and quality. Excessive use of antibiotics during treatment can lead to an increase in drug-resistant strains and antibiotic residues in milk, severely threatening dairy product safety and significantly impacting my country's dairy industry. Currently, the only common preventative measures for mastitis are farm hygiene and vaccination, but neither completely eliminates the disease.

[0003] With the development of gene editing breeding technology, anti-mastitis gene editing breeding has gradually become a new approach to preventing mastitis in dairy cows. The patent for anti-mastitis breeding in dairy cows (publication number CN1970750A) published by the Military Veterinary Research Institute of the Academy of Military Medical Sciences of the Chinese People's Liberation Army (PLA) is to construct an antimicrobial peptide gene in a mammary tissue-specific expression vector, extract the exogenous gene for transfection of donor cells, and use all fibroblasts as donor cells for nuclear transplantation. After screening, the positive cells obtained are electrofused with mature enucleated oocytes cultured in vitro to construct reconstructed embryos. The activated reconstructed embryos are cultured in vivo, and then the normally developed reconstructed embryos are surgically transferred into the uterus of a host cow in synchronized estrus. Finally, transgenic cloned cows are obtained and transgenic cows are obtained through somatic cell cloning technology. However, this transgenic breeding technology that introduces exogenous genes still has safety concerns.

[0004] The published anti-mastitis transgenic technology, which confers changes in transgenic animals’ traits, may lead to genomic instability and unpredictable changes, with the following potential risks:

[0005] 1. Off-target effects: While traditional CRISPR / Cas9 technology has high editing efficiency, it can cause off-target effects, i.e., mutations at non-target sites. These mutations can interfere with the function of other genes and even lead to adverse biological effects, affecting the health and production performance of dairy cows.

[0006] 2. Large-segment gene mutation: Existing technologies often perform editing by knocking out or knocking in large segments of genes, which may lead to the complete loss of target gene function or the introduction of unnecessary genes, affecting the normal growth and development of animals and other important traits.

[0007] 3. Ethical Issues: Gene knockout or knock-in techniques may be considered "excessive modification" by regulatory agencies in some countries or regions, sparking ethical controversy. In particular, large-scale modifications to animal genomes may face stricter legal and regulatory restrictions, limiting the application and promotion of this technology.

[0008] In summary, the current transgenic breeding technology of food animals still faces ethical and safety controversies regarding food safety and ecological safety, and is subject to varying degrees of regulation around the world. Summary of the Invention

[0009] The purpose of the present invention is to address the above-mentioned deficiencies in the prior art and to provide an SgRNA expression vector combination for point mutation of threonine 703 and serine 706 in the ADAM10 gene of Holstein cows.

[0010] The second object of the present invention is to provide a gene editing system for accurately editing the ADAM10 gene of Holstein cows to enhance the cows' resistance to mastitis.

[0011] The third object of the present invention is to provide a nuclear donor cell for creating gene-edited cloned cattle.

[0012] The fourth object of the present invention is to provide a gene editing method for accurately editing the ADAM10 gene to enhance the resistance of dairy cows to mastitis.

[0013] The fifth object of the present invention is to provide the application of the above-mentioned SgRNA expression vector combination, gene editing system, and nuclear donor cells.

[0014] The purpose of the present invention can be achieved through the following technical solutions:

[0015] The invention discloses an SgRNA, comprising an SgRNA that can point mutate the threonine at position 703 of the ADAM10 gene of a Holstein cow to glycine and point mutate the serine at position 706 to alanine.

[0016] As a preferred embodiment of the present invention, any one or more of SgRNA1, SgRNA2, and SgRNA3 are selected: the SgRNA1 sequence is shown as SEQ ID NO.1, the SgRNA2 sequence is shown as SEQ ID NO.2, and the SgRNA3 sequence is shown as SEQ ID NO.3.

[0017] A sgRNA expression vector combination for point mutation of threonine 703 and serine 706 in the ADAM10 gene of Holstein cows, consisting of a pFYF1320 vector containing the SgRNA1, a pFYF1320 vector containing the SgRNA2, and a pFYF1320 vector containing the SgRNA3.

[0018] A gene editing system for precisely editing the ADAM10 gene in Holstein cows to enhance their resistance to mastitis consists of the sgRNA expression vector combination and the CP1041-ABEmax (NG-Cas9) vector.

[0019] As a preferred embodiment of the present invention, the CP1041-ABEmax (NG-Cas9) vector is obtained by using the CP1041-ABEmax plasmid as a vector, and using the NG-Cas9 in SpCas9-NG that can recognize the PAM sequence NG to replace the Cas9 (n) that recognizes the PAM sequence NGG in the original plasmid.

[0020] A nuclear donor cell for creating gene-edited cloned cattle is prepared by co-transfecting Holstein cow fetal fibroblasts using the gene editing system. After sequencing verification, gene-mutated monoclonal cells capable of inducing mutations at threonine 703 and serine 706 of the ADAM10 protein are selected as the nuclear donor cell.

[0021] A gene editing method for precisely editing the ADAM10 gene to enhance the resistance of dairy cows to mastitis comprises co-transfecting the gene editing system into host fibroblasts.

[0022] Application of substances that mutate threonine 703 and serine 706 of the ADAM10 gene of Holstein cows in creating mastitis-resistant dairy cows.

[0023] The application of the SgRNA expression vector combination and the gene editing system in creating mastitis-resistant dairy cows.

[0024] The application of the donor nucleus cells in creating mastitis-resistant dairy cows.

[0025] Beneficial effects:

[0026] The pathogens that cause long-term, highly harmful mastitis in dairy cows are mostly Gram-positive bacteria, the most prominent of which is Staphylococcus aureus. The α-hemolysin released by the bacteria can bind to the ADAM10 receptor on the surface of cow mammary epithelial cells, exerting its toxic effects and triggering a series of inflammatory reactions. The present invention provides a gene editing technology targeting ADAM10, the main action site of S. aureus. This technology reduces the sensitivity of gene-edited cattle to the toxic components of S. aureus without introducing exogenous genes, thereby reducing the incidence of mastitis and boasting high efficiency and safety. The experiment used a novel single-base gene editing (ABE) technology to gene-edit dairy cow fibroblasts, mutating the amino acids at the main action site of the cell surface receptor ADAM10 for α-hemolysin, reducing the affinity between the two. Gene-edited cloned cattle were then created through somatic cell cloning and embryo transfer techniques. In vitro experiments showed that when mammary epithelial cells from gene-edited cloned cattle were isolated and exposed to an inflammatory environment induced by S. aureus, the expression of inflammatory factors was significantly reduced, the breakdown of cell tight junctions was reduced, and the rate of cell apoptosis was reduced. Achieve a low level of cellular inflammatory response, thereby providing an environment conducive to cell repair and regeneration, enhancing the host's disease resistance, and effectively reducing the incidence of mastitis.

[0027] Published anti-mastitis transgenic technology imparts changes to transgenic animals' traits, but this technology may lead to genomic instability and unpredictable changes. The point mutation gene editing technology adopted in this invention only modifies and changes a few amino acid sites in the animal's own genome, which is more targeted and eliminates the safety risks caused by the introduction of exogenous genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Gene editing breeding model diagram

[0029] Figure 2 Several macromolecular docking models with high confidence

[0030] Figure 3 Schematic diagram of the establishment of ADAM10 gene knockout bovine mammary epithelial cell line

[0031] Figure 4 Analysis of the anti-inflammatory effects of ADAM10 mutations at different sites on α-hemolysin

[0032] Figure 5 Verification of the ability of point mutation gene-edited cows and their mammary epithelial cells to resist α-hemolysin-induced inflammation DETAILED DESCRIPTION

[0033] Example 1

[0034] 1.1 ADAM10 macromolecular model construction and macromolecular docking

[0035] The cell surface ADAM10 receptor binds to the α-hemolysin heptamer, the primary toxin of Staphylococcus aureus, exerting its toxic effects and triggering mastitis at the macroscopic level. Therefore, ADAM10 is a potential key gene for anti-mastitis. This study focuses on this gene to develop a novel strategy for gene-editing breeding for anti-mastitis.

[0036] The ADAM10 receptor gene sequence (accession number: NM_174496.3) from the surface of Stan cow cells was downloaded from Geenbank. A protein macromolecular model was constructed using Alphafold2 software (QMEANDisCo score: 0.61±0.05 on the Swiss-model website). The α-hemolysin heptamer macromolecular model (PDB ID: 3ANZ) was obtained from the Global Protein Data Bank (RCSB) US Data Center. The ADAM10 macromolecular model was docked with the α-hemolysin heptamer model using ZDOCK software, and the 10 docking models with the highest confidence were obtained. The PDBePLSA website was used to analyze the amino acid sites of interaction between the two macromolecules in these 10 models.

[0037] The model with the lowest solvation free energy gain (ΔG) when forming an interface during macromolecular docking was selected, and the sites and key amino acids that formed hydrogen bonds or hydrophobic embedding structures in the two large models were analyzed. Finally, five potential gene editing sites were selected, namely aspartic acid at position 308 of ADAM10 (potential editing site No. 1), aspartic acid at positions 526 and 527 (potential editing site No. 2), arginine at position 557 (potential editing site No. 3), lysine at position 617 and tyrosine at position 618 (potential editing site No. 4), threonine at position 703, and serine at position 706 (potential editing site No. 5) for the next step of feasibility verification.

[0038] 1.2 Feasibility analysis of potential editing sites

[0039] 1.2.1 Establishment of ADAM10 gene knockout bovine mammary epithelial cell line

[0040] A bovine mammary epithelial cell line expressing ADAM10 gene knockout was established using Cas9 technology. Based on the gene sequence from Genomics, sgRNA targeting the ADAM10 gene was designed and two single-stranded DNA sequences were synthesized.

[0041] sgRNA F:5'-CACCGCTCTCCTGGGTTGCGGGGCT-3'

[0042] sgRNA R:5'-AAACAGCCCCGCAACCCAGGAGAGC-3'

[0043] The two DNA single strands were annealed at 95°C for 15 minutes to generate a double-stranded sgRNA. The commercial plasmid pSpCas9(BB)-2A-GFP (PX458) was treated with Bbs I restriction endonuclease to generate a linearized Cas9 plasmid vector. The double-stranded sgRNA was ligated to the linearized Cas9 plasmid vector using T4 ligase to construct a Cas9 targeting plasmid targeting the ADAM10 gene.

[0044] Search the Holstein cow genome at NCBI to identify the homology arms flanking the sgRNA. Using the Holstein cow genome as a template, use the primers listed in Table 1 below. High-fidelity PCR was performed using the primers Left arm F / Left arm R and Right arm F / Right arm R, respectively, to obtain the left and right homology arms flanking the sgRNA locus with complementary ends. High-fidelity PCR was performed using the pLV-EF1a-IRES-Puro (Plasmid #85132) plasmid as a template, using Ef1αF / Ef1αR and Puro F / Puro R, respectively, to obtain the Ef1α promoter and puromycin resistance gene with complementary sequences. PCR products were separated by agarose gel electrophoresis, and the target fragments were excised. Purification was performed using the QIAquick PCR Purification Kit.

[0045] Using a two-step overlap extension PCR method, equimolar amounts of the left arm and Ef1α promoter sequences, the puromycin resistance gene sequence, and the right arm were added to a high-fidelity PCR system without primers, and amplification was performed 10-15 times in a high-fidelity enzyme system. Subsequently, primers Left arm F / Ef1αR were added to the left arm and Ef1α promoter sequences, and Puro F / Right arm R were added to the puromycin resistance gene sequence and right arm sequences. Amplification was performed 35 times in a high-fidelity enzyme system to generate two overlapping extension DNA fragments. After electrophoretic separation and purification, the overlap extension PCR step was repeated. The two end sequences were mixed and amplified 10-15 times without primers. Then, Left arm F / Right arm R were added and amplified 35 times in a high-fidelity enzyme system to generate a long DNA fragment consisting of the left arm, Ef1α promoter, Puro, and right arm. This long sequence was combined with the finished linearized T vector pMD19 to construct a gene knockout donor vector.

[0046] Table 1: Primers required for constructing gene knockout donor vectors (including complementary ends)

[0047]

[0048] The donor vector and Cas9 targeting vector were co-electroporated into bovine mammary epithelial cells. Puromycin was added for drug screening 36 hours later. After 96 hours, single clones were picked under a microscope and verified by Juction PCR. It was found that the Ef1α promoter and puromycin resistance gene had been inserted into the target location, and the expression of the ADAM10 gene was blocked, verifying that the gene knockout was successful. The ADAM10 gene knockout bovine mammary epithelial cell line was obtained ( Figure 3 ).

[0049] 1.2.2 Feasibility Analysis of Gene Editing Sites

[0050] Based on the ADAM10 gene sequence, a biotechnology company synthesized the ADAM10 eukaryotic expression vector pcDNA3.1-ADAM10-EGFP-C using the plasmid pcDNA3.1-EGFP-C as a vector. Quickchange PCR primers were designed for the potential gene editing sites identified in 1.1, mutating them to glycine, the simplest amino acid in the molecular structure, to construct a point-mutated ADAM10 eukaryotic expression vector.

[0051] Table 2: Primers for Quickchange PCR construction of point mutation eukaryotic expression vectors

[0052]

[0053]

[0054] Quickchange PCR was performed using the synthetic ADAM10 eukaryotic expression vector pcDNA3.1-ADAM10-EGFP-C as a template, with primer pairs edit1 F / edit1 R, edit2 F / edit2 R, edit3 F / edit3 R, edit4 F / edit4 R, and edit5 F / edit5 R, respectively, using a high-fidelity enzyme. Following completion of the reaction, the methylated sites were digested with Dpn I to remove the unmutated DNA strand. The resulting plasmid was transformed into Escherichia coli DH5α and plated onto chloramphenicol-resistant culture plates. The next day, a single colony was picked, amplified, and the plasmid extracted and sent for testing. The point mutation ADAM10 eukaryotic expression vector plasmids were obtained and named pcDNA3.1-ADAM10-EGFP-C(edit1), pcDNA3.1-ADAM10-EGFP-C(edit2), pcDNA3.1-ADAM10-EGFP-C(edit3), pcDNA3.1-ADAM10-EGFP-C(edit4), and pcDNA3.1-ADAM10-EGFP-C(edit5).

[0055] The ADAM10 point mutation eukaryotic expression vectors were electroporated into ADAM10 knockout bovine mammary epithelial cell lines. Cells expressing the exogenous gene were sorted by flow cytometry using eGFP as a tag. The sorted cell lines were treated with 2 μg / ml α-hemolysin for 36 hours, and RNA was extracted. The expression of inflammatory factors was verified by qPCR.

[0056] The experimental results show that Figure 4 ) In bovine mammary epithelial cell lines expressing five point mutations in ADAM10, the inflammatory activity of α-hemolysin was reduced to varying degrees, with the most significant difference observed at the fifth potential gene editing site (threonine 703 and serine 706). Therefore, the fifth potential gene editing site was selected as a target for anti-mastitis gene editing for further gene editing breeding.

[0057] Example 2: Single-base gene editing technology to modify anti-mastitis gene editing targets

[0058] Based on the gene editing sites established in Example 1 (threonine 703 and serine 706), a method for point mutation of cell genes using ABE single-base gene editing technology was designed.

[0059] Based on the gene editing site, three ABE single-base editing sgRNA sequences were designed as follows: SgRNA1: CACTCCAAGTAGTAATCCAA (SEQ ID NO. 1); SgRNA2: TCCAAGTAGTAATCCAAAGT (SEQ ID NO. 2); SgRNA3: GCAGTGTACACACTCCAAGT (SEQ ID NO. 3). sgRNA expression vectors containing SgRNA1, SgRNA2, and SgRNA3 were synthesized using the pFYF1320 EGFP (Addgene plasmid #47511) plasmid as a vector. The specific method is as follows:

[0060] Table 3: Primers required for sgRNA expression vector construction

[0061]

[0062] The primers were synthesized according to Table 3. After phosphorylation of the above primers using T4 polynucleotide kinase, the pFYF1320EGFP plasmid was used as a template, and Universal R / sgRNA1 F, Universal R / sgRNA 2F, and Universal R / sgRNA3 F were used as primers, respectively. High-fidelity enzyme was used for PCR amplification to form blunt-end double-stranded DNA with 5' end phosphorylation. The methylated empty plasmid template in the product was eliminated using Dpn I, and the PCR product was recovered by electrophoresis. The three PCR products were recircularized using QuickLigase rapid ligase, and the sgRNA sequence was connected into the vector plasmid pFYF1320 EGFP. The resulting product was transformed into E. coli DH5α and screened with ampicillin. The plasmid was extracted, and the universal primer LKO.15'(GACTATCATATGCTTACCGT) was used for sequencing to verify that the sgRNA sequence had been inserted into the plasmid pFVF1320 EGFP. Three sgRNA expression vectors were obtained, and were named U6-sgRNA1, U6-sgRNA2, and U6-sgRNA3, respectively.

[0063] The CP1041-ABEmax(Addgene plasmid#119808) plasmid was used as a vector, and the NG-Cas9 that can recognize the PAM sequence as NG in SpCas9-NG(Addgene plasmid#138566) was used to replace the Cas9(n) that can recognize the PAM sequence as NGG in the original plasmid. The specific method is as follows:

[0064] Table 4: Primers required for construction of CP1041-ABEmax(NG-Cas9) vector (containing complementary ends)

[0065]

[0066] The primers were synthesized according to Table 4. The CP1041-ABEmax was used as a template, and the CP1041 F / CP1041 R was used as a primer pair. The SpCas9-NG was used as a template, and the Cas9-NG F / Cas9-NG R was used as a primer pair. High-fidelity enzyme was used for PCR amplification, and Dpn I endonuclease was used to eliminate the original plasmid in the reaction system. The DNA bands with lengths of 7100 bp and 4100 bp were recovered by electrophoresis. The two bands were mixed in equimolar amounts, and the two fragments were ligated using seamless cloning enzyme to obtain circularized DNA. The resulting product was transformed into E. coli DH5α, screened with chloramphenicol, and the plasmid was extracted to obtain a new single-base editing plasmid that can recognize the PAM sequence as NG, which is referred to as CP1041-ABEmax(NG-Cas9) hereinafter.

[0067] The three sgRNA expression vectors (U6-sgRNA1, U6-sgRNA2, and U6-sgRNA3) constructed above for the ADAM110 gene functional site were co-transfected with CP1041-ABEmax (NG-Cas9) into fetal fibroblasts using electroporation. First, prepare electroporation buffer and clone cell lysis buffer: the electroporation buffer formula is 120mM KCl, 0.15mM CaCl2, 10mM K2HPO4, and 5mM MgCl2 (pH 7.6);

[0068] Clone cell lysis buffer formula: 50mM KCl, 10mM Tris-HCl, pH 8.5, 1.5mM MgCl2, 0.5% Tween-20, 0.5% NP-40 and 400g / mL proteinase K.

[0069] Fetal fibroblasts were passaged into 60mm dishes and digested when they reached 90% confluence. All cells in the 60mm dishes were digested and mixed with electroporation working solution: 600μL of electroporation solution, 200μL of Opti-MEM (Thermo Fisher Scientific), 4μg of dapoxetine, and 1μg of dapoxetine were mixed in a 1.5mL centrifuge tube. The mixture was gently pipetted into a BTX electroporation cuvette and allowed to rest for 10 minutes. Electroporation conditions were: 510V, 1-2 2ms pulses, and 10 minutes at room temperature. The cell suspension was gently plated evenly into two 100mm culture dishes, culture medium was added, and the dishes were returned to the incubator for continued culture. After 48 hours of culture, the cell culture medium was replaced with a final concentration of 2μg / mL puromycin for drug selection. The medium was changed every two days and cell growth was observed. After one week of puromycin selection, cells were observed under a fluorescence microscope, and the formation of positive monoclonal cell clusters exhibiting green fluorescence was observed. Positive monoclonal clones were picked using an inverted stereomicroscope, numbered, inoculated into 48-well plates, and about 15% of the cells were taken for subsequent PCR identification. Genomic DNA was extracted from the transfected cells, the target region was amplified by PCR, and Sanger sequencing was performed on multiple positive monoclonal gene editing sites to detect base changes at the editing sites. Genetic mutation monoclonal cells that can induce mutations in threonine 703 and serine 706 of ADAM10 protein were selected as donor cell somatic cells. Finally, a strain NKLS02000010.1[51675111..51675131] position sequence mutation was screened out.

[0070] A positive clone with the gene CACGCTCCAAGTGGTAATCC was constructed. Threonine 703 and serine 706 of this positive clone were mutated to glycine (with a hydrogen atom as the R group) and alanine (with a methyl group as the R group), respectively. This single clone was used as a nuclear donor for the creation of gene-edited cloned cattle.

[0071] Example 3: Creation of Gene-Edited Cloned Cattle

[0072] Single cells carrying the edits were isolated from the edited cell population, and gene-edited cloned cows were obtained through somatic cell cloning and embryo transplantation technology.

[0073] 3.1 Somatic Cell Nuclear Transfer

[0074] (1) Preparation of oocytes for nuclear transfer

[0075] Preheat the egg collection solution PBS (NaCl 8.05 mg / mL, KCl 0.203 mg / mL, KH2PO4 0.2 mg / mL, Na2HPO4 1.153 mg / mL, sodium pyruvate 0.036 mg / mL, D-glucose 1 mg / mL, CaCl2·H2O 0.132 mg / mL, MgCl2·H2O 0.121 mg / mL, heparin sodium 0.4 mg / mL, FBS 5%, fixed with ultrapure water, pH 7.0, 295-300 mOsm / kg) on ​​a 37°C hot plate. Then, add 10% FBS (v / v), 0.2 mmol / L sodium pyruvate, and 0.075 IU / mL of oocyte maturation medium (OM) (Medium-199, Sigma) to 2 mL of oocyte maturation medium (OM). HMG, 1 g / mL estradiol, 10 ng / mL epidermal growth factor, and 1% insulin-transferrin-selenium (pH 7.0, 295–300 mOsm / kg) were added to a 12-well plate and equilibrated in a 38.5°C incubator for at least 2 hours. Ovaries were collected from a slaughterhouse in Baoji City, Shaanxi Province, and placed in a thermos of saline solution containing double-antibody at 20–25°C. They were then transported to our laboratory within 3–4 hours. The ovaries were placed in a beaker that had been previously sterilized in a dry oven and cooled. The ovaries were rinsed with saline to remove blood and other impurities. The surrounding mesentery and connective tissue were trimmed as thoroughly as possible using sterile scissors and forceps. The ovaries were then placed in fresh PBS and rapidly rinsed with 75% alcohol for disinfection. The ovaries were then rinsed with saline to remove the alcohol and rinse the surface thoroughly. The ovaries were then placed in a 60 mm dish containing 5 mL of prewarmed PBS, with 5–7 ovaries per dish. Next, use a sterilized puncture needle to puncture the ovarian follicles on the surface and gently squeeze to release the follicular fluid containing cumulus-oocyte complexes (COCs). Under a stereomicroscope, use the oocyte puncture needle to select uniformly sized COCs with intact granulosa cells and place them in a new 30mm dish filled with 2mL of preheated PBS. Once all COCs in the dish have been detected, rinse them twice in preheated PBS and count them until all impurities are removed. Finally, remove the clean COCs and place them in equilibrated OM (OM) maturation medium. The number of oocytes in 2mL of maturation medium should not exceed 180. Mature the oocytes in an incubator at 38.5°C and 5% CO2 for 21-24 hours. After maturation, remove the oocytes, blow off all surface cumulus cells, and treat with hyaluronidase for 3-5 minutes. Use the oocyte puncture needle again to remove any remaining cumulus cells. No cumulus cells should remain, as this will interfere with subsequent microscopy. The obtained naked eggs were placed in PBS, and oocytes with complete and plump cytoplasm and obvious first bodies were picked out one by one under a microscope and placed in OM for later use. The donor nucleus cells were derived from the positive monoclonal cells constructed and successfully identified in Example 2, and the number of generations was within 3.

[0076] (2) Somatic cell nuclear transfer

[0077] The selected oocyte containing the first polar body was transferred into nuclear transfer solution (7.5 μg / mL cytochalasin B + 10% (v / v) FBS + 90% (v / v) Medium 199 with HEPES). The fixation and enucleation needles were pre-installed and the oocytes were aligned longitudinally. The oocytes were fixed with the fixation needle on the left side. Because the cytoplasm of goat oocytes is darkly stained, making the nucleus difficult to visualize, the nucleus was enucleated by blind aspiration at the cytoplasm. On the right side, the oocyte was manipulated with the enucleation needle so that the polar body and cytoplasm were aligned, with the polar body at the 6 o'clock position and the cytoplasm at the 3 o'clock position. The needle was inserted into the cytoplasm, passing through the zona pellucida, and the cytoplasm, along with the cytoplasm, was simultaneously aspirated to remove the cytoplasm, the first polar body, and the surrounding cytoplasm. At this point, the nucleus was considered removed. After all oocytes were enucleated, the prepared positive single clones were sequentially injected into the zona pellucida of the enucleated oocytes. After injection, the oocytes were returned to the OM and allowed to recover in a 38.5°C incubator for half an hour.

[0078] (3) Electrofusion

[0079] After half an hour of recovery, the oocytes were transferred to a droplet of electrofusion solution (BTXpress Cytofusion, BTX, 47-0001) for two rinses. The oocytes were then transferred to the electrofusion solution for manipulation. The positive and negative electrodes of the electrofusion probes were placed on either side of the oocyte, aligned horizontally. A single electric pulse of 35V for 10μs was applied to promote fusion of the donor cell and oocyte membranes. After the procedure was completed, the reconstructed oocytes were placed back into the OM for recovery. After 2 hours of recovery, parthenogenetic activation was performed.

[0080] (4) Activation of reconstructed embryos

[0081] The oocytes were removed from the OM and activated in three 5 μM ionomycin (ION, Yoshi, I0634) droplets for 3 to 5 min to induce Ca 2+ Oocytes are activated by fluctuations in OM, then rinsed for 5 minutes in microdrops of 2 mM 6D (6-DMAP, GLPBIO, GC60532-250). The oocytes are then placed in a final droplet and incubated at 38.5°C for 3–5 hours to inhibit the extrusion of the second polar body. Following the 6D treatment, oocytes are transferred to microdrops of embryo culture medium G1 (vitrolife, 509850), washed four times for 3 minutes each, and finally placed in an incubator with G1. Embryos are cultured until they reach 2 cells for transfer.

[0082] 3.2 Embryo Transfer

[0083] The reconstructed embryo transplantation method uses a surgical transplantation method, and the day when the recipient's estrus ends is the day 0 of the reconstructed embryo development for the reconstructed embryo transplantation. First, the recipient cow's surgical area is shaved, and the lumbar nerve conduction anesthesia is performed. The surgical area is disinfected with iodine tincture, and after 5 minutes, the alcohol cotton is deiodinated; a wound towel is placed on the surgical area and fixed with a towel clamp; a scalpel is used to cut the skin and muscles at the right flank or the midline of the abdomen to expose the uterus. The length of the incision depends on the size of the cow, generally 15-20 cm, and gauze is used to press and stop bleeding or hemostatic forceps are used to stop bleeding; the rectus abdominis and transverse abdominal muscles are exposed, and a thin layer of mucosal wall is found between the two muscles. A scalpel is used to make an incision of about 1 cm; the uterine horn on one side is gently pulled out, and the ovary and fallopian tube are partially pulled out of the wound; the pulled organ tissue is soaked with gauze soaked in preheated saline, and the micro-transplant tube loaded with about 15 to 25 embryos is carefully inserted into the fallopian tube through the fallopian tube fimbria, about 3 to 5 The embryo is injected into the uterus at a position 1 cm from the ovary. After embryo injection, the ovarian tissue and uterine horn are gently returned to their original positions. Gauze is applied to stop bleeding, and preheated saline is added through the incision to prevent dehydration and organ adhesion. A sterile round needle is used to suture the mucosal wall with a continuous suture technique, and the muscle tissue with an interrupted suture technique. The outer skin is sutured with a three-edged needle using interrupted sutures. Finally, the sutured incision is disinfected with tincture of iodine. After the surgery, the recipient cow is given an intramuscular injection of 50 mL of penicillin (800,000 units) and streptomycin (1,000,000 units). Within 60 days after transplantation, if the recipient cow has not returned to estrus, ultrasound examination is performed to check for pregnancy, and the number of pregnancies is counted.

[0084] Gene-edited calves were obtained through pregnancy and delivery by recipient cows. The calves were in good physical condition, survived normally, and had no abnormal performance. They were identified as ADAM10 gene-edited individuals, which shows that the site is safe. Mammary epithelial cells were isolated from gene-edited calves and treated with α-hemolysin. Compared with wild-type Holstein cows, the expression of inflammatory factors in mammary epithelial cells of gene-edited calves was significantly reduced. This result shows that after the functional site of the ADAM10 gene was edited, the gene-edited cattle obtained by site mutation showed a certain degree of resistance to α-hemolysin, the main toxic component of Staphylococcus aureus ( Figure 5 ).

[0085] It can be seen from the above technical solution that compared with the existing technology, the present invention discloses a gene editing method for precisely editing the ADAM10 gene to enhance the resistance of dairy cows to mastitis. Under inflammatory conditions caused by α-hemolysin infection, the content of pro-inflammatory factors expressed by mammary epithelial cells is significantly reduced, thereby having a resistance effect to α-hemolysin, the main virulence factor of Staphylococcus aureus, the main pathogen of mastitis.

Claims

1. An sgRNA, characterized in that The method is composed of SgRNAs that point mutate the threonine at position 703 of the Holstein cow ADAM10 gene to glycine and the serine at position 706 to alanine.

2. The sgRNA according to claim 1, characterized in that Any one or more selected from SgRNA1, SgRNA2, and SgRNA3: the SgRNA1 sequence is shown in SEQ ID NO.1, the SgRNA2 sequence is shown in SEQ ID NO.2, and the SgRNA3 sequence is shown in SEQ ID NO.

3.

3. An sgRNA expression vector combination for point mutation of threonine 703 and serine 706 in the ADAM10 gene of Holstein cows, characterized in that: It consists of a pFYF1320 vector containing the SgRNA1 described in claim 2, a pFYF1320 vector containing the SgRNA2 described in claim 2, and a pFYF1320 vector containing the SgRNA3 described in claim 2.

4. A gene editing system for precise editing of the ADAM10 gene in Holstein cows to enhance their resistance to mastitis, characterized in that: It consists of the SgRNA expression vector combination according to claim 3 and the CP1041-ABEmax (NG-Cas9) vector.

5. The gene editing system according to claim 4, characterized in that The CP1041-ABEmax (NG-Cas9) vector is obtained by using the CP1041-ABEmax plasmid as a vector and replacing the Cas9 (n) that recognizes the PAM sequence NG in the original plasmid with the NG-Cas9 that recognizes the PAM sequence NG in SpCas9-NG.

6. A donor cell for gene editing cloned cattle creation, characterized in that: Holstein cow fetal fibroblasts are co-transfected using the gene editing system described in claim 4 or 5, and after sequencing verification, gene mutation monoclonal cells that can induce mutations at threonine 703 and serine 706 of the ADAM10 protein are selected as the nuclear donor cells.

7. A gene editing method for precisely editing the ADAM10 gene to enhance the resistance of dairy cows to mastitis, characterized in that: The gene editing system according to claim 4 or 5 is co-transfected into host fibroblasts.

8. Application of substances that mutate threonine 703 and serine 706 of the ADAM10 gene of Holstein cows in creating mastitis-resistant dairy cows.

9. Use of the sgRNA expression vector combination of claim 3 and the gene editing system of claim 4 or 5 in creating mastitis-resistant dairy cows.

10. Use of the donor nucleus cells according to claim 6 in creating mastitis-resistant dairy cows.

Images