DsRNA based on prodenia litura Ter94 gene as well as preparation method and application of dsRNA

By preparing dsRNA of the Ter94 gene of Spodoptera litura and combining it with chemical insecticides, the ecological damage and pesticide resistance problems of chemical control of Spodoptera litura were solved, and efficient and environmentally friendly pest control effects were achieved.

CN120758500APending Publication Date: 2025-10-10NANYANG NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510873345.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-27
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

Existing chemical methods for controlling Spodoptera litura have problems such as ecological damage, safety hazards and pest resistance, making it difficult to effectively control the damage caused by Spodoptera litura.

Method used

Using RNA interference technology, dsRNA based on the Ter94 gene of Spodoptera litura was prepared. Specific primers were designed for PCR amplification, purification and in vitro transcription to obtain dsRNA, which was then combined with chemical insecticides to improve the control effect.

Benefits of technology

The combined use of dsRNA and chemical insecticides significantly increased the mortality rate of Spodoptera litura larvae, reduced the use of chemical pesticides, and provided an environmentally friendly and efficient means of pest control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758500A_ABST
    Figure CN120758500A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of pest control, and discloses dsRNA based on a prodenia litura Ter94 gene as well as a preparation method and application of the dsRNA. The preparation method comprises the following steps: firstly, obtaining a full-length sequence of the prodenia litura Ter94 gene, designing a dsRNA primer based on the sequence, and further synthesizing the dsRNA of the prodenia litura Ter94 gene based on the primer. The dsRNA of the Ter94 gene obtained by the invention can cause the total death rate of prodenia litura larvae on the fifth day to be 26.67%; dsRNA of the Ter94 gene is wrapped with chitosan to form nano-particles, the nano-particles are applied to 3-instar larvae through epidermal permeation, and the death rate of the prodenia litura larvae is increased to 36.67% after 5 days; after the dsRNA nano-particles and emamectin benzoate with the sublethal concentration of 5 mg / L or emamectin benzoate with the sublethal concentration of 5 mg / L jointly act, the death rates of larvae are increased to 90% and 83.33% respectively.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of pest control, and in particular to a dsRNA based on the Ter94 gene of Spodoptera litura, and a preparation method and application thereof. Background Art

[0002] Transitional endoplasmic reticulum ATPase 94 (Ter94) is the insect homologue of the VCP / p97 (valosin-containing protein, VCP) protein family and belongs to the AAA-ATPase superfamily. VCP is highly conserved throughout evolution and is widely present in diverse eukaryotic cells. It is primarily distributed in the cytoplasm, with some located on the membranes of subcellular organelles such as the Golgi apparatus, endoplasmic reticulum, and mitochondria. A small amount is localized in the nucleus, where it assists in chromatin degradation and nuclear protein quality control. Functional VCP proteins are homohexamer proteins. Each VCP monomer is composed of four domains: an amino acid ubiquitin-binding domain (N-terminal domain), two ATPase domains (D1 and D2 domains), and a carboxyl-terminal region (C-terminal domain). As an ATPase, VCP can bind to various cofactors and participate in diverse cellular activities, such as regulating intracellular protein homeostasis, participating in endocytosis and autophagy, mediating membrane fusion, and regulating the cell cycle.

[0003] In insects, Ter94 is a key factor in cell cycle regulation and protein quality control. Studies have shown that it participates in mitochondrial homeostasis, stress granule clearance, and endoplasmic reticulum function maintenance by regulating the extraction and degradation of ubiquitinated substrates. In Drosophila, Ter94 can regulate wing size by inhibiting the Hippo signaling pathway. As a component of the endoplasmic reticulum-associated degradation pathway, Ter94 can inhibit intestinal stem cell proliferation and maintain intestinal homeostasis in adult flies. As a new member of the BMP signaling pathway, Ter94 is required for Mad phosphorylation in Drosophila S2 cells. Ter94 mutations lead to mitochondrial fragmentation, muscle cell death, and neurodegenerative phenotypes. In addition, Ter94 plays an important role in maintaining normal insect life activities by regulating cell membrane fusion and organelle reorganization during insect development, affecting germ cell differentiation and tissue homeostasis.

[0004] Spodoptera litura is a widespread omnivorous and voracious pest in my country. Its larvae are highly destructive and prone to outbreaks, causing severe damage and economic losses to a wide range of crops. Currently, chemical control is the primary method of Spodoptera litura control, supplemented by physical and biological methods. Chemical pesticides are widely used for their ease of use, low toxicity, wide applicability, and effective control. However, their frequent and extensive use in production has led to increasing pest resistance, resulting in decreased disease control effectiveness, excessive pesticide residues, increased food safety risks, and disruption of ecological balance.

[0005] Nucleic acid pesticides, known as the "third revolution in pesticide history," utilize RNA interference (RNAi) technology to target key genes in pests, achieving highly effective gene silencing and effectively controlling pests and diseases. RNAi is highly evolutionarily conserved and widely present in most eukaryotic organisms, including protozoa, invertebrates, vertebrates, fungi, algae, and plants. Using RNAi technology for pest and disease control offers significant advantages, including target specificity, strong environmental compatibility, ease of use, environmental friendliness, high efficiency, and a residue-free environment.

[0006] Based on this, an insecticidal method based on RNAi and the Ter94 gene of Spodoptera litura is provided, which can provide a new, efficient and environmentally friendly pest control method for agricultural pest control. Summary of the Invention

[0007] In view of this, the present invention proposes a dsRNA based on the Ter94 gene of Spodoptera litura and its preparation method and application, aiming to solve the problems of ecological damage and safety hazards in the current chemical control methods for Spodoptera litura.

[0008] The present invention provides a method for preparing dsRNA based on the Ter94 gene of Spodoptera litura, comprising the following steps:

[0009] The Ter94 gene sequence of the known Lepidoptera model insect, Bombyx mori, was used for Blast sequence alignment to obtain the Ter94 gene sequence of Spodoptera litura, which is the full-length ORF gene sequence, as shown in SEQ ID NO: 1.

[0010] Based on the full-length gene sequence of the ORF, specific primers are designed and synthesized, and PCR amplification is performed to obtain an amplified product;

[0011] The amplified product was purified, connected to the pTOPO cloning vector, transformed into TOP10 competent cells, and cultured on plates and identified by colony PCR to obtain the full-length sequence of the Ter94 gene of Spodoptera litura;

[0012] Based on the full-length sequence of the Helicoverpa armigera Ter94 gene, an upstream primer with a T7 promoter sequence and a downstream primer are designed and synthesized, the sequence of the upstream primer is shown as SEQ ID NO: 4, and the sequence of the downstream primer is shown as SEQ ID NO: 5.

[0013] The full-length sequence of the Helicoverpa armigera Ter94 gene is used as a template for PCR amplification, and a DNA fragment containing a T7 promoter is obtained, and the sequence of the DNA fragment is shown as SEQ ID NO: 6.

[0014] The DNA fragment is purified and subjected to in vitro transcription, and the dsRNA of the Helicoverpa armigera Ter94 gene is obtained.

[0015] Preferably, the specific primers include an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are shown as SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0016] Preferably, the SEQ ID NO: 2 is specifically ATGGCAGATAGTAAAGGTAATCC, and the SEQ ID NO: 3 is specifically TTAGCTGTACAGGTCGTCGT.

[0017] Preferably, the specific primers are designed based on the Primer desing tool of NCBI.

[0018] Preferably, the SEQ ID NO: 4 is specifically ggatcctaatacgactcactataggCAGTTCTCCTGAAGGGCAAG, and the SEQ ID NO: 5 is specifically ggatcctaatacgactcactataggTCGTAACCGACAGCATTCAA.

[0019] Preferably, the length of the DNA fragment is 445 bp.

[0020] Preferably, the purification of the amplification product is performed by using a DNA gel recovery kit.

[0021] Preferably, after the full-length sequence of the Helicoverpa armigera Ter94 gene is obtained, the full-length sequence of the Helicoverpa armigera Ter94 gene is subjected to sequence comparison with homologous protein sequences of Ter94 of different lepidopteran insects, and the sequence conservation of the Helicoverpa armigera Ter94 in different lepidopteran insects is analyzed.

[0022] The application also provides the dsRNA obtained by the preparation method of the dsRNA based on the Helicoverpa armigera Ter94 gene.

[0023] The present invention also provides the use of the dsRNA described in the above technical solution in controlling the pest Spodoptera litura.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The dsRNA of the Ter94 gene obtained by the present invention can cause the total mortality of Spodoptera litura larvae to be 26.67% on the 5th day. After the dsTer94 is acted upon with the sublethal concentration of 20 mg / L emamectin benzoate, the total mortality of the larvae is 76.67% on the 5th day. After the dsTer94 is acted upon with the sublethal concentration of 60 mg / L emamectin hydrazide, the total mortality of the larvae is 83.33% on the 5th day.

[0026] Furthermore, the dsRNA of the Ter94 gene of Spodoptera litura obtained by the present invention was encapsulated with chitosan to form nanoparticles, and applied to third-instar larvae through epidermal penetration. After 5 days, the mortality rate of the Spodoptera litura larvae increased to 36.67%; after the nanoparticles were acted upon with a sublethal concentration of 5 mg / L of the chemical insecticide emamectin benzoate, the mortality rate was 90%, and after acting upon the nanoparticles with a sublethal concentration of 5 mg / L of emamectin hydrazide, the mortality rate was 83.33%; the Ter94 gene screened by the present invention has a significant lethal effect on both third-instar and fifth-instar larvae of Spodoptera litura, and can significantly increase the mortality rate of larvae after acting upon the nanoparticles with chemical insecticides, thereby providing a new strategy for the integrated prevention and control of Spodoptera litura and lepidopteran pests and for reducing the amount of chemical pesticides and increasing their efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Various other advantages and benefits will become apparent to those skilled in the art upon reading the detailed description of the preferred embodiment below. The accompanying drawings are for illustration purposes only and are not to be considered as limiting the present invention. The same reference symbols are used throughout the drawings to represent the same components. In the drawings:

[0028] Figure 1 This is a comparison chart of the relative expression levels of the Ter94 gene in the control group and the treatment group in Test Example 1 of the present invention;

[0029] Figure 2 This is a comparison chart of body weight between the control group and the treatment group in Test Example 1 of the present invention;

[0030] Figure 3 This is a comparison chart of the mortality rates of the control group and the treatment group in Test Example 1 of the present invention;

[0031] Figure 4 This is a comparison chart of the mortality rates of the control group and the treatment group after larvae were injected with dsRNA and fed with chemical pesticides in Test Example 1 of the present invention;

[0032] Figure 5This is a comparison chart of the mortality rates of the CS-dsGFP control group and the CS-dsTer94 treatment group in Test Example 2 of the present invention;

[0033] Figure 6 This is a comparison chart of the mortality rates of the CS-dsRNA and emamectin benzoate combined treatment group and the emamectin benzoate control group in Test Example 2 of the present invention;

[0034] Figure 7 This is a comparison chart of the mortality rates of the CS-dsRNA and emamectin combined treatment group and the emamectin control group in Test Example 2 of the present invention. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention are now described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention. It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention.

[0036] In addition, for numerical ranges in the present invention, it is understood that each intervening value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated value or intervening value in the stated range is also included in the present invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] The present invention provides a method for preparing dsRNA based on the Ter94 gene of Spodoptera litura, comprising the following steps:

[0041] The Ter94 gene sequence of the known Lepidoptera model insect, Bombyx mori, was used for Blast sequence alignment to obtain the Ter94 gene sequence of Spodoptera litura, which is the full-length ORF gene sequence, as shown in SEQ ID NO: 1.

[0042] Based on the full-length gene sequence of the ORF, specific primers are designed and synthesized, and PCR amplification is performed to obtain an amplified product;

[0043] The amplified product was purified, connected to the pTOPO cloning vector, transformed into TOP10 competent cells, and cultured on plates and identified by colony PCR to obtain the full-length sequence of the Ter94 gene of Spodoptera litura;

[0044] Based on the full-length sequence of the Spodoptera litura Ter94 gene, an upstream primer and a downstream primer with a T7 promoter sequence were designed and synthesized. The sequence of the upstream primer is shown in SEQ ID NO: 4, and the sequence of the downstream primer is shown in SEQ ID NO: 5.

[0045] PCR amplification was performed using the full-length sequence of the Spodoptera litura Ter94 gene as a template to obtain a DNA fragment containing the T7 promoter, the sequence of which is shown in SEQ ID NO: 6;

[0046] The DNA fragment is purified and transcribed in vitro to obtain the dsRNA of the Spodoptera litura Ter94 gene.

[0047] The Ter94 gene sequence of the known Lepidoptera model insect, Bombyx mori, was used for Blast sequence alignment to obtain the Ter94 gene sequence of Spodoptera litura, which is the full-length ORF gene sequence, as shown in SEQ ID NO: 1.

[0048]

[0049] Based on the full-length gene sequence of the ORF, specific primers are designed and synthesized, and PCR amplification is performed to obtain an amplified product;

[0050] In the present invention, the specific primers were designed based on the NCBI Primer design tool; after synthesizing the specific primers, PCR amplification was performed; Spodoptera litura larvae were selected and ground with liquid nitrogen, total RNA was extracted according to the instructions of Trizol reagent (Invitrogen), and the total RNA was reverse transcribed into first-strand cDNA using the RevertAid First Strand cDNA Synthesis Kit (Promega), which served as a template for amplification of the full-length sequence of the Ter94 gene ORF of Spodoptera litura;

[0051] In the present invention, the specific primers include an upstream primer and a downstream primer, and their sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0052] In the present invention, the SEQ ID NO: 2 is specifically ATGGCAGATAGTAAAGGTAAT CC; the SEQ ID NO: 3 is specifically TTAGCTGTACAGGTCGTCGT.

[0053] In the present invention, the purification of the amplified product is performed using a DNA gel recovery kit.

[0054] The amplified product was purified, connected to the pTOPO cloning vector, transformed into TOP10 competent cells, and cultured on plates and identified by colony PCR to obtain the full-length sequence of the Ter94 gene of Spodoptera litura;

[0055] In the present invention, after obtaining the full-length sequence of the Spodoptera litura Ter94 gene, the method further includes comparing the obtained full-length sequence of the Spodoptera litura Ter94 gene with homologous protein sequences of Ter94 of different lepidopteran insects to analyze the sequence conservation of Spodoptera litura Ter94 in different lepidopteran insects.

[0056] Based on the full-length sequence of the Spodoptera litura Ter94 gene, an upstream primer and a downstream primer with a T7 promoter sequence were designed and synthesized. The sequence of the upstream primer is shown in SEQ ID NO: 4, and the sequence of the downstream primer is shown in SEQ ID NO: 5.

[0057] The upstream primer and the downstream primer were designed using the Primer design tool of NCBI.

[0058] In the present invention, the SEQ ID NO: 4 is specifically ggatcctaatacgactcactataggCAGTTCTCCTGAAGGGCAAG, and the SEQ ID NO: 5 is specifically ggatcctaatacgactcactataggTCGTAACCGACAGCATTCAA.

[0059] PCR amplification was performed using the full-length sequence of the Spodoptera litura Ter94 gene as a template to obtain a DNA fragment containing the T7 promoter, the sequence of which is shown in SEQ ID NO: 6;

[0060] SEQ ID NO:6 of the present invention is specifically: CAGTTCTCCTGAAGGGCAAGCGTC GCAAGGAGACAGTCTGCATTGTCCTCTCAGATGACAACTGTCCTGATGAGAAGATCCGCATGAATCGCGTTGTACGCAACAACTTGCGCGTACGTCTGTCTGATGTGGTGTCCATCGCGCCGTGCCCGTCCGTTAAGTACGGGAAACGCGTCCACATATTGCCCATTGATGACTCTGTTGAGGGCTTGACTGGAAACTTATTCGAGGTGTA CCTGAAGCCTTATTTCATGGAAGCCTACCGGCCAATCCACCGTGACGACACGTTCATGGTGCGCGGAGGTATGCGCGCTGTAGAGTTCAAGGTCGTGGAGACTGACCCTCGCCCTACTGCATCGTGGCTCCTGACACCGTCATCCATTGTGAGGGAGACCCCATCAAACGTGAGGAGGAAGAGGAAGCTTTGAATGCTGTCGGTTACGA.

[0061] In the present invention, the length of the DNA fragment is 445 bp.

[0062] The DNA fragment is purified and transcribed in vitro to obtain the dsRNA of the Spodoptera litura Ter94 gene.

[0063] The purification was performed using a DNA gel recovery kit (Omega) according to the T7 RiboMA X TM In vitro transcription was performed according to the instructions of the ExpressRNAi System kit.

[0064] The present invention also provides dsRNA obtained by the preparation method of dsRNA based on the Ter94 gene of Spodoptera litura described in the above technical solution.

[0065] The present invention also provides the use of the dsRNA described in the above technical solution in controlling the pest Spodoptera litura.

[0066] Example 1

[0067] Obtaining the full-length sequence of the Ter94 gene of Spodoptera litura

[0068] (1) Using the transcriptome database of Spodoptera litura, a bioinformatics method was used to search for the Ter94 gene of Spodoptera litura, and its full-length sequence was obtained, which is shown in SEQ ID NO: 1;

[0069] (2) Primer design for the Ter94 gene of Spodoptera litura

[0070] Based on the obtained full-length sequence, upstream and downstream primers were designed using the NCBI Primer design tool. The upstream primer is shown in SEQ ID NO: 2, specifically ATGGCAGATAGTAAAGGTAATCC, and the downstream primer is shown in SEQ ID NO: 3, specifically TTAGCTGTACAGGTCGTCGT. The designed primers were synthesized by BGI Genomics Co., Ltd.

[0071] (3) Preparation of Spodoptera litura cDNA template

[0072] Spodoptera litura larvae were selected and ground with liquid nitrogen. Total RNA was extracted according to the instructions of Trizol reagent (Invitrogen). The RNA was reverse transcribed into first-strand cDNA using the RevertAid First Strand cDNA Synthesis Kit (Promega) and used as a template for amplification of the full-length sequence of the Ter94 gene ORF of Spodoptera litura.

[0073] (4) Identification and analysis of the full-length sequence of the Ter94 gene in Spodoptera litura

[0074] PCR amplification was performed using the above-synthesized primers and cDNA template. The amplified product was detected by agarose gel electrophoresis. The target band was purified using a DNA gel recovery kit (Omega). The purified product was ligated with the pTOPO-TA cloning vector and transformed into TOP10 competent cells. After plate culture, positive colonies were picked and tested by PCR in the culture solution and sent to the company for sequencing.

[0075] The sequencing results were compared with known sequences, and finally the full-length sequence of the Spodoptera litura Ter94 gene ORF was obtained, which was 2421 bp in size and shown in SEQ ID NO: 1.

[0076] Sequence alignment of the Spodoptera litura Ter94 protein sequence with homologous Ter94 protein sequences from different lepidopteran insects revealed 100% similarity to that of Spodoptera frugiperda (XP_035435070.1), 99.87% similarity to that of Helicoverpa armigera (XP_021183018.1), 98.63% similarity to that of Ostrinia nubilalis (XP_063830826.1), 97.63% similarity to that of Bombyx mori (NP_001037003.1), and 96.27% similarity to that of Plutella xylostella (XP_037962294.1). This indicates that the Ter94 protein of Spodoptera litura has a high degree of sequence conservation among different Lepidoptera insects.

[0077] Example 2

[0078] Preparation of dsRNA of Ter94 Gene of Spodoptera litura

[0079] (1) Design of dsRNA primers for the Ter94 gene of Spodoptera litura

[0080] Based on the nucleotide sequence of the Ter94 gene of Spodoptera litura, upstream and downstream primers of dsRNA were designed using the NCBI Primer design tool. The upstream primer sequence is shown in SEQ ID NO:4; specifically, ggatcctaatacgactcactataggCAGTTCTCCTGAAGGGCAAG. The downstream primer sequence is shown in SEQ ID NO:5; specifically, ggatcctaatacgactcactataggTCGTAACCGACAGC ATTCAA. Both ends of the upstream and downstream primers contain T7 promoter sequences. The designed primers were synthesized by BGI Genomics Co., Ltd.

[0081] (2) Synthesis of dsRNA of Ter94 gene of Spodoptera litura

[0082] PCR amplification was performed using the above-mentioned primers and a plasmid containing the full-length ORF of the Ter94 gene of Spodoptera litura. The target band was purified using a DNA gel recovery kit (Omega). The concentration of the purified product was determined using a NanoDrop2000 (Thermoscientific). TM Perform in vitro transcription according to the Express RNAi System kit instructions to synthesize dsTer94. Simultaneously, synthesize dsGFP using the GFP gene as a control. dsRNA quality was assessed by agarose gel electrophoresis, and dsRNA concentration was quantified using a NanoDrop 2000, resulting in a final concentration of 2.5 μg / μL.

[0083] Test Example 1

[0084] Test on the lethality of dsRNA of Ter94 gene of Spodoptera litura to larvae

[0085] (1) Injection of Ter94 gene dsRNA of Spodoptera litura and detection of gene interference efficiency

[0086] The fifth-instar second-day Spodoptera litura larvae of uniform size, good growth condition, and half male and half female were selected. 5 μg of dsTer94 and negative control dsGFP were injected into the hemolymph of the abdominal segments of the larvae using a microinjector. 30 larvae were in each of the control and treatment groups. The injected Spodoptera litura larvae were raised in a constant temperature incubator. After 48 hours, the control and treatment groups of Spodoptera litura larvae were collected, total RNA was extracted, reverse transcribed into first-strand cDNA, and then the relative expression levels of the target gene Ter94 and the housekeeping gene Actin were detected by real-time fluorescence quantitative PCR, and their interference efficiency was calculated. The results are shown in Figure 2. Figure 1 As shown;

[0087] based on Figure 1 It can be seen that the expression level of Ter94 gene in the dsTer94-injected treatment group was significantly reduced by 76% compared with the dsGFP control group.

[0088] (2) Effects of dsTer94 injection on Spodoptera litura larvae

[0089] The weight of the Spodoptera litura larvae in the control group and the treatment group was recorded. Figure 2 As shown, based on Figure 2 It can be seen that compared with the control group injected with dsGFP, the total weight of the fifth-instar larvae of Spodoptera litura in the dsTer94 intervention group was lower than that of the control group within 5 days of dsRNA injection;

[0090] The mortality of Spodoptera litura larvae in the control group and the treatment group was recorded. Figure 3 As shown, based on Figure 3 The results showed that the larvae in the control group grew and developed normally, while the larvae in the dsTer94 intervention group began to die on the first day after intervention, and the cumulative mortality rate on the fifth day was 26.67%, which was significantly higher than that in the dsGFP control group.

[0091] The control and treatment groups were injected with dsRNA and then fed with feed containing sublethal concentrations of chemical insecticides to test the lethal effect on the larvae. The results are as follows: Figure 4 As shown, based on Figure 4 It can be seen that after dsTer94 was co-acted with 20 mg / L sublethal concentration of emamectin benzoate, the mortality rate of 5th instar larvae of Spodoptera litura was 76.67% on the 5th day, and after being co-acted with 60 mg / L sublethal concentration of emamectin hydrazide, the mortality rate was 83.33% on the 5th day.

[0092] Test Example 2

[0093] Insecticidal effect of chitosan / dsRNA nanoparticles against Spodoptera litura

[0094] (1) In order to achieve effective delivery of dsRNA in pest control, chitosan (CS) is used to encapsulate dsRNA and deliver it through body surface penetration.

[0095] 0.1 g of chitosan powder was weighed and dissolved in a mixture of 59 mL of 0.1 mol / L acetic acid solution and 41 mL of 0.1 mol / L sodium acetate buffer, and magnetic stirring was performed overnight to prepare a 0.1% (w / v) chitosan solution; the dsRNA solution was added to a 0.1 mol / L sodium sulfate solution at a mass ratio of chitosan:dsRNA = 1:1, and then the 0.1% (w / v) chitosan solution was added. The solution was mixed evenly using a high-speed vortex, heated in a 55°C water bath for 1 min, mixed for 30 s using a high-speed vortex, and incubated at room temperature for 1 h to promote the formation of nanoparticles; the mixture was centrifuged at 12000 rpm at room temperature for 10 min, the supernatant was discarded, and the precipitated particles at the bottom of the tube were air-dried at room temperature for about 10 min, an appropriate amount of DEPC water was added, and the mixture was mixed evenly by pipetting or vortexing to uniformly disperse the nanoparticles in the solution.

[0096] The 3rd instar 2-day-old larvae of Spodoptera litura in good condition and of similar weight were selected. CS-dsRNA nanoparticles of the target gene and the control GFP were applied to the dorsal epidermis of the larvae, with the amount of dsRNA applied to each larva being 5 μg. The mortality of the two groups was recorded separately. The results are shown in the figure. Figure 5 As shown, based on Figure 5 It can be seen that compared with the CS-dsGFP control group, the mortality rate of larvae increased significantly on the second day after CS-dsTer94 treatment, and the mortality rates of larvae in CS-dsGFP and CS-dsTer94 treatments were 6.7% and 35% on the fifth day, respectively.

[0097] (2) Synergistic effect of chitosan / dsRNA nanoparticles on chemical pesticides

[0098] After CS-dsRNA was applied to third-instar larvae, the larvae were fed a diet containing sublethal concentrations of chemical insecticides to detect the lethal effect on the larvae.

[0099] When CS-dsRNA was combined with 5 mg / L sublethal concentration of emamectin benzoate, the mortality rate was recorded. The results are as follows: Figure 6 As shown, based on Figure 6 The results showed that the larval mortality rate of the CS-dsTer94 and emamectin benzoate combined group was significantly higher than that of the control group every day. On the fifth day, the larval mortality rate of emamectin benzoate alone was 56.67%, the larval mortality rate of CS-dsGFP and emamectin benzoate combined was 56.67%, and the larval mortality rate of CS-dsTer94 and emamectin benzoate combined was 90%. The larval mortality rate of the combined treatment of CS-dsTer94 and emamectin benzoate was 53.33% higher than that of emamectin benzoate alone or CS-dsGFP and emamectin benzoate.

[0100] When CS-dsRNA was combined with 5 mg / L sublethal concentration of emamectin, the mortality rate was recorded. The results are as follows: Figure 7 As shown, based on Figure 7 The results showed that the daily mortality of larvae treated with CS-dsTer94 and emamectin benzoate was significantly higher than that of the control group. On the fifth day, the mortality of larvae treated with emamectin benzoate alone was 50%, the mortality of larvae treated with CS-dsGFP and emamectin benzoate was 53.33%, and the mortality of larvae treated with CS-dsTer94 and emamectin benzoate was 83.33%. The combined treatment increased the mortality of larvae by 33.33% compared with emamectin benzoate alone and by 30% compared with CS-dsGFP and emamectin benzoate. This indicates that chitosan / dsRNA nanoparticles can significantly improve the delivery efficiency of dsRNA. The dsRNA of the Ter94 gene of Spodoptera litura not only has a high mortality rate for larvae, but also has a significant synergistic effect with different chemical insecticides.

[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in the field should understand that the specific implementation methods of the present invention can still be modified or replaced by equivalents. Any modification or equivalent replacement that does not depart from the spirit and scope of the present invention should be covered by the scope of protection of the claims of the present invention.

Claims

1. A method for preparing dsRNA based on the Ter94 gene of Spodoptera litura, characterized in that: The following steps are involved: The Ter94 gene sequence of the known Lepidoptera model insect, Bombyx mori, was used for Blast sequence alignment to obtain the Ter94 gene sequence of Spodoptera litura, which is the full-length ORF gene sequence, as shown in SEQ ID NO:

1. Based on the full-length gene sequence of the ORF, specific primers are designed and synthesized, and PCR amplification is performed to obtain an amplified product; The amplified product was purified, connected to the pTOPO cloning vector, transformed into TOP10 competent cells, and cultured on plates and identified by colony PCR to obtain the full-length sequence of the Ter94 gene of Spodoptera litura; Based on the full-length sequence of the Spodoptera litura Ter94 gene, an upstream primer and a downstream primer with a T7 promoter sequence were designed and synthesized. The sequence of the upstream primer is shown in SEQ ID NO: 4, and the sequence of the downstream primer is shown in SEQ ID NO:

5. PCR amplification was performed using the full-length sequence of the Spodoptera litura Ter94 gene as a template to obtain a DNA fragment containing the T7 promoter, the sequence of which is shown in SEQ ID NO: 6; The DNA fragment is purified and transcribed in vitro to obtain the dsRNA of the Spodoptera litura Ter94 gene.

2. The method for preparing dsRNA based on the Ter94 gene of Spodoptera litura according to claim 1, characterized in that: The specific primers include an upstream primer and a downstream primer, and their sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

3. The method for preparing dsRNA based on the Ter94 gene of Spodoptera litura according to claim 1, characterized in that: The specific SEQ ID NO: 2 is ATGGCAGATAGTAAAGGTAATCC; the specific SEQ ID NO: 3 is TTAGCTGTACAGGTCGTCGT.

4. The method for preparing dsRNA based on the Ter94 gene of Spodoptera litura according to claim 1, characterized in that: The specific primers were designed based on the Primer design tool of NCBI.

5. The method for preparing dsRNA based on the Spodoptera litura Ter94 gene according to claim 1, characterized in that: The SEQ ID NO: 4 is specifically ggatcctaatacgactcactataggCAGTTCTC CTGAAGGGCAAG, and the SEQ ID NO: 5 is specifically ggatcctaatacgactcactataggTCG TAACCGACAGCATTCAA.

6. The method for preparing dsRNA based on the Ter94 gene of Spodoptera litura according to claim 1, characterized in that: The length of the DNA fragment is 445 bp.

7. The method for preparing dsRNA based on the Ter94 gene of Spodoptera litura according to claim 1, characterized in that: The purification of the amplified product is performed using a DNA gel recovery kit.

8. The method for preparing dsRNA based on the Spodoptera litura Ter94 gene according to claim 1, characterized in that: After obtaining the full-length sequence of the Spodoptera litura Ter94 gene, the method further includes comparing the obtained full-length sequence of the Spodoptera litura Ter94 gene with homologous protein sequences of Ter94 of different lepidopteran insects to analyze the sequence conservation of Spodoptera litura Ter94 in different lepidopteran insects.

9. A dsRNA obtained by the method for preparing dsRNA based on the Spodoptera litura Ter94 gene according to any one of claims 1 to 8.

10. Use of the dsRNA according to claim 9 in controlling the pest Spodoptera litura.