Dermatophagoides farinae prevention and control alpha-enolase target gene and preparation method and application of Dermatophagoides farinae prevention and control dsRNA

Abstract

The invention provides a dermatophagoides farinae prevention and control alpha-enolase target gene and a preparation method and application of dermatophagoides farinae prevention and control dsRNA, the dermatophagoides farinae prevention and control alpha-enolase target gene is used as the target gene, a high-quality dust alpha-enolase gene is cloned and expressed, the dsRNA of the gene is prepared, and the dsRNA is used as a biological acaricide for preventing and controlling the dermatophagoides farinae. The content of alpha-enolase of dermatophagoides farinae is reduced; the reproduction of mites is reduced; in addition, the Dermatophagoides farinae enolase and human enolase can form a cross antigen to cause autoimmune diseases of a human body, and the Dermatophagoides farinae alpha-enolase gene dsRNA can be used as an acaricide to reduce the autoimmune diseases of the human body caused by the Dermatophagoides farinae alpha-enolase.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a preparation method and application of a target gene for controlling α-enolase of dust mites and a dsRNA for controlling dust mites. Background Art

[0002] The dust mite (Dermatophagoides farinae) belongs to the Acari, Aspidata, and Ophiophaga families. It has a wide range of habitats, often breeding in flour, Chinese medicinal herbs, house dust, air conditioning screens, bedding, sofas, and floor mats. Dust mites can breed in stored items, causing them to mold and spoil. Their secretions, metabolites, and the decomposition of dead mites are important allergens, inducing allergic diseases such as allergic rhinitis and asthma, seriously impacting patients' academic performance, work, and daily life. Previous studies have shown that dust mite secretions, excretions, shed skins, and carcasses are important sources of indoor allergens.

[0003] The current control methods for dust mites include physical control, chemical control, and biological control. Among them, the application of chemical drugs for control is the current main control method. However, chemical control itself has certain limitations, such as the chemical drugs used in chemical control, such as pyrethroids,

[0004] Most chemical acaricides are toxic to a certain extent, or the problem of drug resistance caused by years of use is becoming increasingly serious. They also cause environmental pollution and harm to human body. There is a lack of safer and more environmentally friendly biological control methods.

[0005] Therefore, it is necessary to provide a biological control method for dust mites. Summary of the Invention

[0006] The present invention aims to provide a method for preparing and using a target gene and dsRNA for controlling α-enolase for controlling dust mites. The invention clones and expresses a high-quality dust mite enolase gene, and uses this gene to prepare dsRNA. Using the dsRNA of the dust mite enolase gene as a miticide is not only safer and more environmentally friendly, but also more targeted in silencing the dust mite enolase gene, leading to the death of mites, thereby reducing the number of mites in the environment and the risk of autoimmune diseases in humans.

[0007] The technical solutions of the present invention are as follows:

[0008] The target gene for controlling α-enolase for controlling dust mites provided by the present invention has a sequence as shown in SEQ ID NO. 1, specifically:

[0009] ATATATAATTAACTGTCATTGAGCAAACTGCCTCAAAGTCAACGTTCGTCAACCACTATTATTATC

[0010] AAAAAATTTTTAACAACATTCAAAATGTCCATTCAAAAGATTTATGCTCGTCAAATTTTCGATTCA

[0011] CGAGGAAATCCAACTCTGGAAGTTGATTTAACAACAGATTTCGGTGTTTTCCGAGCTGCTGTTCCA

[0012] AGTGGTGCTTCGACCGGTATTCATGAAGCATTAGAACTTCGTGACAAAGATAAAGCTCATTATCAT

[0013] GGAAAATCCGTGTTGAAGGCCATTGCCAATGTCAATGATGTAATCGCACCGAAATTAATAAGCCAG

[0014] GGTCTCGATGTTACAAAACAAAAAGAAATTGATGACTTGTTGATCCAATTGGACAATACACCCAAC

[0015] AAACAAAACCTTGGTGGTAATGCTATCCTTGGTGTGTCCTTGGCTGTGGCTAAAGCTGGCGCTGCC

[0016] AAAAAGAAAGTTCCATTGTATCAGCATATTTCCGACTTGGCTGATATCAAAGAATTTGTATTACCT

[0017] GTTCCAGCATTCAATGTTATCAATGGCGGTTCACATGCTGGCAATCGTTTAGCCATGCAAGAATTC

[0018] ATGATTTTGCCAACAGGTGCATCATCGTTTACTGAAGCCATGAAAATGGGCTCTGAAGTTTATCAT

[0019] CATCTTAAGAATGTTATCAAACAACGTTATGGCTTGGATGCTACCTGTGTCGGCGATGAAGGTGGT

[0020] TTTGCACCAAACATTCAAAGCAACAAAGAAGCTTTGGATTTGATTATGACATCCATCCAAATGGCT

[0021] GGCTATAGTGGTAAAAATTGATATTGGAATGGATGTTGCTGCTTCAGAATTTTATCGTGAAGGCAAA

[0022] TATGATTTGGATTTTAAGAATGCTAATTCAGATAAATCAGCATGGTTGGAACCATCTCAATTGGCC

[0023] GACGTTTATCGAGGATTCGTCAAAGACTATCCAATTGTTTCAATTGAAGATCCTTTCGATCAAGAT

[0024] GCTTGGGATGATTGGACTGCTTTCACCAGCAGTGTTAGTTGCCAGGTTGTTGGTGATGATTTAACT

[0025] GTAACAAATCCGAAACGTATACAAACGGCCGCTGAAAAGAAATGTTGTAATTGTTTGCTCTTGAAG

[0026] GTCAATCAAATTGGTACCGTCAGTGAATCGATTCAAGCTCATTTATTGGCCAGATCAAATGGCTGG

[0027] GGAACAATGGTTTCACATCGTTCAGGAGAAACTGAAGATACATTCATTGCTGATTTGGTTGTCGGT

[0028] TTATCTACTGGCCAAATAAAAACTGGTGCACCATGTCGTTCAGAACGTTTGGCTAAATATAATCAA

[0029] ATTCTTAGGATTGAAGAAGAATTGGGTGCCAAAGCAAAATATGCTGGAAAAAATTTCCGTCATCCA

[0030] ATTTAAATTGATTGATTTTTTTCTGTCATGATTGTCAGCAATCAGTTCCAATGATGAGTGAGTGGAGTGTGT;

[0031] The method for preparing dsRNA for controlling dust mites provided by the present invention uses the target gene for controlling α-enolase of dust mites to synthesize dsRNA, comprising the following steps:

[0032] 1) Extract total RNA from dust mites, obtain cDNA after reverse transcription, and perform PCR amplification using the first strand of cDNA as a template;

[0033] 2) Connect the target gene to pMD 18-T and react;

[0034] 3) Cloning and sequencing;

[0035] 4) Plasmid extraction and sequencing;

[0036] 5) Synthesize dsRNA.

[0037] In step 1), the sequence of the forward primer for PCR amplification is: GGCTTGGATGCTACCTGTGT, as shown in SEQ ID NO.2; the sequence of the reverse primer is: AAACCATTGTTCCCCAGCCA, as shown in SEQ ID NO.3.

[0038] In step 1), the PCR amplification process is: 94°C, 5 min; 94°C 15 s, 60°C 15 s, 68°C 15 s, 35 cycles; and stored at 4°C.

[0039] In step 1), the PCR product is recovered and purified;

[0040] In step 2), the reaction procedure is to react at 16° C. for 30 min;

[0041] In step 3), competent cells of the E. coli cell line E. coli DH5α are used.

[0042] In step 4), Plasmid Mini Kit I (Omega, USA) was used to extract the plasmid.

[0043] In step 5), the MEGAscript RNAi Kit (Invitrogen, USA, AM1626) was used to synthesize double-stranded RNA (dsRNA) of the target gene fragment; the in vitro transcription reaction system was 20 μL, and after the system was mixed evenly, it was placed in a PCR instrument and incubated at 37°C for 3 hours; then incubated at 75°C for 5 minutes, and then cooled to room temperature.

[0044] The application of the dust mite control dsRNA prepared by the above method provided by the present invention is used for controlling dust mites. The specific application method is: using the dust mite control dsRNA solution as a liquid medicine and spraying it in the space where dust mites are present.

[0045] The design ideas of the present invention are as follows:

[0046] RNA interference (RNAi) refers to the phenomenon of gene silencing, in which cells utilize endogenous or exogenous double-stranded RNA (dsRNA) to induce the efficient and specific degradation of homologous mRNAs by specific enzymes. RNAi can target specific genes in pests, resulting in decreased expression of target genes. Furthermore, RNAi is easily degraded, poses no environmental risk, and is highly safe.

[0047] Sugar metabolism is the primary way organisms acquire energy. Glucose is converted into pyruvate, catalyzed by a series of enzymes, and then further into lactate, often under anaerobic conditions. This process is known as glycolysis. α-Enolase (α-Enolase), the rate-limiting enzyme in the glycolysis pathway, is one of the three enolase isoforms. It is primarily located in the cytoplasm but is also present in the cell membrane and nucleus of various eukaryotic cells. It plays a crucial role in cellular energy metabolism. During glycolysis, it converts 2-phosphoglycerate into phosphoenolpyruvate and can also catalyze the reverse reaction, converting phosphoenolpyruvate into 2-phosphoglycerate. Therefore, the α-Enolase gene plays a crucial role in maintaining normal physiological energy metabolism in dust mites.

[0048] The inventors have also discovered that α-enolase (α-enolase) is not only a catalytic enzyme involved in the glycolysis pathway in the body, but also a multifunctional molecule involved in the pathophysiology of various human diseases, including autoimmune diseases, allergic diseases, and cancer. Rattner et al. first reported the presence of anti-α-enolase antibodies in patients with systemic rheumatic diseases. Anti-α-enolase autoantibodies recognize membrane-bound α-enolase, interfering with its function and inducing local inflammatory responses. Many proteins in the human body share certain amino acid sequence homology with foreign antigens such as bacteria and pathogens, and these foreign antigens have the potential to cross-react with human proteins. Dermatophagoides farinae α-enolase, as a foreign antigen, shares up to 72% amino acid sequence homology with human α-enolase antigens, potentially forming a common cross-antigen. Antibodies against dust mite α-enolase, produced by the human body in response to this cross-antigen, can cross-react with human α-enolase in related tissues, potentially leading to autoimmune diseases. Dust mites are widely present in indoor environments where humans live and work around the world. In addition to the α-Enolase of dust mites causing immune damage to the human body, other substances contained in dust mites themselves can also cause a variety of allergic diseases. Their metabolites are strong allergens that can cause allergic rhinitis, mite asthma, atopic dermatitis and chronic urticaria.

[0049] Dermatophagoides farinae α-enolase and the human body's own α-enolase can act as cross-antigens, causing autoimmune diseases. Consequently, there is a lack of effective anti-mite agents specifically targeting Dermatophagoides farinae α-enolase. Furthermore, our understanding of enolase comes primarily from research on humans and pathogenic microorganisms, while research on Dermatophagoides farinae is minimal, leading to a lack of high-quality Dermatophagoides farinae enolase reference genes.

[0050] The present invention proposes a new biological control technology that reduces the content of dust mite enolase by silencing the dust mite α-enolase gene. On the one hand, the mite cannot normally synthesize α-enolase to meet its metabolic needs, resulting in its own death; on the other hand, it avoids the immune damage to humans caused by the dust mite α-enolase.

[0051] Compared to existing technologies, the present invention clones and expresses a high-quality dust α-enolase gene and produces dsRNA derived from this gene, which is then used as a bio-acaricide to reduce dust mite α-enolase levels and mitigate mite reproduction. This method boasts high target specificity, excellent environmental friendliness, a low risk of drug resistance, and improved safety. Furthermore, it is proposed that dust mite enolase and human enolase form cross-antigens, leading to autoimmune diseases in humans. Using dust mite α-enolase gene dsRNA as an acaricide can reduce the autoimmune diseases caused by dust mite α-enolase in humans. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 This is the gel electrophoresis image of the PCR amplification product of step 2) in Example 1 (marked in red in the figure);

[0053] Figure 2 The figure shows the comparison of the expression levels of dust mite enolase after the dust mites were treated with the dsRNA solution of the present invention and the control group. DETAILED DESCRIPTION

[0054] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0055] Unless otherwise specified, the test materials and reagents used in the following examples can be obtained from commercial sources.

[0056] If no specific techniques or conditions are specified in the examples, they can be carried out according to the techniques or conditions described in the literature in the field or according to the product instructions.

[0057] Example 1

[0058] The specific experimental process of the dust mite α-enolase gene provided by the present invention is as follows:

[0059] 1) Total RNA extraction

[0060] Total RNA of D. farinae was extracted using Trizol reagent (Invitrogen, USA) according to the kit instructions, and the laboratory-reared D. farinae was used, 800 per tube. The collected RNA solution was quickly placed in a -80°C refrigerator for storage to prevent degradation after purification by GeneJET RNA Purification Kit (Thermo, K0731) kit.

[0061] 2) PCR product recovery and purification

[0062] The extracted D. farinae whole body RNA was reverse transcribed to obtain cDNA (PrimeScriptTM RT reagent Kit (Perfect Real Time) was used), and the first strand of cDNA was used as a template for PCR amplification. The PCR reaction system and reaction program are shown in Table 1 and Table 2.

[0063] Table 1 PCR amplification reaction system

[0064]

[0065] In Table 1, the sequence of the forward primer is: GGCTTGGATGCTACCTGTGT, as shown in SEQ ID NO. 2; and the sequence of the reverse primer is: AAACCATTGTTCCCCAGCCA, as shown in SEQ ID NO. 3.

[0066] Table 2 PCR reaction program

[0067]

[0068]

[0069] After PCR amplification, the PCR product was recovered and purified by E.Z.N.A. Gel Extraction Kit (Omega, USA) to obtain the target gene (D. farinae prevention α-enolase target gene), and the specific operation steps are described in the kit instructions.

[0070] The gel electrophoresis map of the PCR amplification product is shown in Figure 1 the red band.

[0071] 3) Cloning and sequencing

[0072] 3-1) Ligation:

[0073] pMD TMThe target gene was ligated to pMD 18-T using the 18-T Vector Cloning Kit. The reaction system is shown in Table 3. The reaction procedure was 16°C for 30 min.

[0074] Table 3 Connection liquid system

[0075]

[0076] 3-2) Transformation: Adjust the water bath to 42°C before transformation.

[0077] 3-2-1) Place 50 μL of E. coli DH5α competent cells in a 1.5 mL centrifuge tube, add 5 μL of ligation solution (ligation solution system in Table 3), and incubate on ice for 30 minutes;

[0078] 3-2-2) Place the centrifuge tube in a 42°C water bath for 90 seconds and then immediately place it in ice for 2-3 minutes;

[0079] 3-2-3) Add 500 μL of liquid LB medium to the centrifuge tube and incubate at 37°C with shaking at 180 rpm for 60 min.

[0080] 3-2-4) Spread 100 μL of bacterial solution evenly on solid LB medium containing ampicillin (Amp, final concentration 100 μg / mL) and incubate at 37°C for 10-16 hours to form single colonies.

[0081] 3-3) Shaking bacteria and PCR detection:

[0082] 3-3-1) Pick a single colony and place it in 500 μL of liquid LB medium containing Amp (final concentration 100 μg / mL) and culture with shaking at 180 rpm at 37°C for 60 min to obtain a bacterial suspension;

[0083] 3-3-2) Take 1 μL of the bacterial solution and perform PCR amplification in 10 μL of the system (reaction system is shown in Table 4) using the pMD 18-T universal primers M13F / R; i.e., the forward primer M13F sequence is: 5'-CAGGAAACAGCTATGACC-3', as shown in SEQ ID NO. 4; the reverse primer M13R sequence is: 5'-TGTAAAACGACGGCCAGT-3', as shown in SEQ ID NO. 5.

[0084] Table 4 PCR amplification reaction system

[0085] Reagents Usage 5X Platinum TM II PCR Buffer 2μL 10mM dNTP mix 0.8μL 10μM forward primer 0.4μL 10μM reverse primer 0.4μL DNA 0.8μL <![CDATA[Platinum TM GC Enhancer]]> 2μL <![CDATA[Platinum TM ⅡTaq DNA Polymerase]]> 0.08μL Nuclease-free pure water 3.52μL Total 10 μL

[0086] 3-3-3) Transfer the bacterial suspension that has been confirmed by PCR to 10 mL of fresh liquid culture medium (see Table 5 for the formula) at a dilution ratio of 1:100 for expansion.

[0087] Table 5 is the preparation of 50mL liquid culture medium

[0088] Element Dosage Tryptone 0.5g yeast 0.25g Sodium chloride 0.5g Double distilled water 50mL Sodium hydroxide solution (1 mol / L) 37.5μL

[0089] 3-3-4) When the OD600 value of the bacterial solution reaches 0.4, pipette 1 mL of the bacterial solution and mix it with an equal volume of 50% glycerol aqueous solution. Store at -80°C. The remaining bacterial solution is used for plasmid extraction and subsequent steps.

[0090] 4) Plasmid extraction and sequencing

[0091] Plasmid Mini Kit I (Omega, USA) was used for plasmid extraction. For specific operation steps, please refer to the kit instructions.

[0092] The extracted plasmids were named and sent to the company for sequencing. After sequencing verification, the plasmids were stored at -20°C for future use. The sequencing results are shown in SEQ ID NO.6, which is as follows: TAAAAAGGTGTCTTGACAACATTCAAGCAACAAAGAAGCTTTGGATTTGATTATGACATCCATCCAAATGGCTGGCTATAGCGGTAAAATTGATATTGGAATGGATGTTGCTGCTTCAGAATTTTATCGTGAAGGCAAATATGATTTGGATTTTAAGAATGCTAATTCAGATAAATCAGCATGGTTGGAACCATCTCAATTGGCCGACGTTTATCGAGGATTCGTCAAAGACTATC CAATTGTTTCAATTGAAGATCCTTTCGATCAAGATGCTTGGGATGATTGGACTGCTTTCACCAGCAGTGTTAGTTGCCAGGTTGTTGGTGATGATTTAACTGTAACAAATCCGAAACGTATACAAACGGCCGCTGAAAAGAAATGTTGTAATTGTTTGCTCTTGAAGGTCAATCAAATTGGTACCGTCAGTGAATCGATTCAAGCTCATTTATTGGCCAGATCAAATGGCTGGGGACAAATGGTTTA.

[0093] 5) Synthesis of dsRNA

[0094] Specific primers were designed using Primer Premier 5.0, with the T7 promoter sequence (5'-ATTATGCTGAGTGATATCCC-3') added to the 3' end of the gene-specific primers. The sequence is shown in SEQ ID NO. 7. The product of the introduced plasmid and E. coli was amplified by PCR using dsRNA primers for the gene. The reaction system is shown in Table 6. The resulting PCR product was quality-tested and then synthesized into double-stranded RNA. The MEGAscript RNAi Kit (Invitrogen, USA, AM1626) was used to synthesize double-stranded RNA (dsRNA) of the target gene fragment. For detailed steps, refer to the kit instructions.

[0095] The in vitro transcription reaction system was 20 μL, as shown in Table 6. After mixing evenly with a pipette, the mixture was placed in a PCR instrument and incubated at 37°C for 3 h; then incubated at 75°C for 5 min, and then cooled to room temperature.

[0096] Table 6 PCR amplification system using gene dsRNA primers

[0097]

[0098] To remove DNA and ssRNA from the synthesized dsRNA, the following steps were performed. The reaction system was 50 μL, as shown in Table 7. After mixing, the mixture was incubated at 37°C for 1 h. The kit used was Invitrogen TM MEGAscript TM RNAi Kit: This kit is used in step 5) dsRNA synthesis and subsequent steps of the present invention.

[0099] Table 7 DNA removal reaction system

[0100] Reagents Usage dsRNA 20 μL Nuclease-free Water 21 μL 10×Digestion Buffer 5μL DNase I 2μL RNase 2μL

[0101] 6) Purification of dsRNA:

[0102] 6-1) Assemble a dsRNA binding mixture using the product obtained in the previous step as a template. For the specific system, see Table 7. Pipette and mix thoroughly.

[0103] Table 7 Assembly of dsRNA reaction system

[0104] Reagents Usage dsRNA 50 μL 10×Binding Buffer 50 μL Nuclease-free Water 150μL 100% ethanol 250 μL

[0105] 6-2) Add 500 μL of dsRNA to the adsorption column containing the collection tube, centrifuge at 12,000 rpm for 2 minutes, and discard the filtrate;

[0106] 6-3) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 12,000 rpm for 2 minutes, and discard the filtrate;

[0107] 6-4) Repeat step 6-3);

[0108] 6-5) Discard the filtrate, place the adsorption column in a collection tube, centrifuge the empty tube at 12,000 rpm for 30 seconds, air dry, and place the adsorption column in a new 1.5 ml EP tube.

[0109] 6-6) Add 100 μL of Elution Solution (pre-heated to 95°C) to the adsorption column, centrifuge at 12,000 rpm for 2 minutes, and collect the filtrate;

[0110] 6-7) Add 100 μL of Elution Solution to the adsorption column, centrifuge at 12,000 rpm for 2 minutes, collect the filtrate, and store the synthesized dsRNA at -20°C.

[0111] Example 2

[0112] Application of dust mite α-enolase gene in the control of dust mites, and conducting the impregnation experiment of dust mite α-enolase gene dsRNA:

[0113] For the impregnation experiment with dsRNA from the α-enolase gene of the dust mite, refer to Example 2 (slide impregnation method) of patent document CN 113519544A. Cut foam tape into 2-3 cm lengths and attach it to one end of a microscope slide. Use a brush to select uniformly sized, active mites and adhere their backs to the foam tape (be careful not to stick to the legs, palps, or mouthparts). Apply three rows of tape to each piece, with 10 mites per row. After observation under a dissecting microscope, dead or inactive individuals were removed and immersed in a solution of α-Enolase gene dsRNA of dust mite (123 ng / μl, the solvent was RNase-free water) as a drug solution for 5 seconds. The samples were taken out and the floating drug on the glass slide and the insect body was gently absorbed with absorbent paper. The samples were placed in a conical flask sealed with sealing film and placed in a constant temperature incubator (temperature 25±2°C, relative humidity RH=80±5%). The death was observed at 6h, 12h, and 24h respectively. The mite body was observed under a dissecting microscope and the mite body was poked with a needle. The mite that did not move was considered dead. The above experiment was repeated three times.

[0114] The same method as above was used to add equal amount of dsGFP (double-stranded RNA of green fluorescent protein)

[0115] As a control group, mites were immersed, and after reaching the corresponding time gradient, the viable mites were collected and the corresponding mortality rate was calculated.

[0116] qPCR verification of live mites: Live mites were collected 6 h, 12 h, and 24 h after the experiment in Example 2, and qPCR verification was performed.

[0117] As a control group, the dust mite α-Enolase gene dsRNA solution was replaced with the same amount of RNase-free water, and the dust mite was treated in the same manner.

[0118] Total RNA from mites was extracted using Trizol reagent and reverse transcribed into cDNA. Gene primers were used, and the primer sequences were as follows: the forward primer for qPCR was GGTGCTTCGACCGGTATTCA, as shown in SEQ ID NO.8. The reverse primer for qPCR was TGTAACATCGAGACCCTGGC; as shown in SEQ ID NO.9, and real-time fluorescence quantitative PCR experiments were performed (Table 8: Addition of each reagent in the qPCR plate). The relative expression of genes was calculated using the 2-ΔΔCt method, and the housekeeping gene α-tubulin was used as an internal reference for quantification. The upstream primer F for the α-tubulin gene was CGTCTATCCAGCACCACAAG, and the sequence was shown in SEQ ID NO.10; the downstream primer R for the α-tubulin gene was CAGATGTCGTAGATGGCTTCA, and the sequence was shown in SEQ ID NO.11.

[0119] Table 8 Addition of each reagent in qPCR plate

[0120] Reagents Usage TB Green Premix Ex TaqⅡ 10 μL Upstream primer 0.8μL Downstream primer 0.8μL cDNA 2μL <![CDATA[ddH2O]]> 6.4μL Total 20 μL

[0121] The reaction process was as follows: pre-incubation at 95°C for 30 seconds, 1 cycle; 2-step amplification reaction: 95°C for 5 seconds and 60°C for 30 seconds, 40 cycles.

[0122] The results show that the present invention can reduce the expression of α-enolase in dust mites. Figure 2 shown.

[0123] The present invention uses dust mite α-enolase gene dsRNA as a mite remover to replace chemical mite removal drugs, using a biological control technology that is more friendly to the environment and humans. It is more targeted than traditional mite removers and uses dust mite α-enolase gene dsRNA to directly block the production of dust mite enolase, causing the death of mites and reducing autoimmune diseases caused by dust mite enolase in humans. The present invention provides a dust mite α-enolase reference gene and a preparation method of the dsRNA, facilitating subsequent experimental research.

[0124] The above embodiments are described to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A target gene for controlling α-enolase of dust mites, characterized in that: Its sequence is shown in SEQ ID NO.1 shown.

2. A method for preparing dsRNA for controlling dust mites, characterized in that: The preparation method is prepared by using the dust mite control α-enolase target gene according to claim 1 as the target gene, and the preparation method comprises the following steps: 1) Extract total RNA from dust mites, obtain cDNA after reverse transcription, and perform PCR amplification using the first strand of cDNA as a template; 2) Connect the target gene to pMD 18-T and react; 3) Cloning and sequencing; 4) Plasmid extraction and sequencing; 5) Synthesize dsRNA.

3. The preparation method according to claim 2, characterized in that In step 1), the sequence of the forward primer for PCR amplification is: GGCTTGGATGCTACCTGTGT, as shown in SEQ ID NO.2; the sequence of the reverse primer is: AAACCATTGTTCCCCAGCCA, as shown in SEQ ID NO.

3.

4. The preparation method according to claim 2 or 3, characterized in that In step 1), the PCR amplification process is: 94°C, 5 min; 94°C 15 s, 60°C for 15 s, 68°C for 15 s, cycle 35 times; store at 4°C.

5. The preparation method according to claim 2, characterized in that The reaction in step 2) is carried out at 16° C. for 30 min.

6. The preparation method according to claim 2, characterized in that In step 3), competent cells of the E. coli cell line E. coli DH5α are used.

7. The preparation method according to claim 2, characterized in that In step 5), the target gene fragment dsRNA was synthesized using the MEGAscript RNAi Kit under the following conditions: incubation at 37° C. for 3 h; incubation at 75° C. for 5 min, and then cooling to room temperature.

8. Use of the dsRNA for controlling dust mites prepared by the preparation method according to any one of claims 2 to 7, characterized in that: Used to prevent and control dust mites.

9. The use according to claim 8, characterized in that Use the dust mite control dsRNA solution as a liquid medicine and spray the space where dust mites are present.

Images