Soybean E3 ubiquitin ligase gene GmSAL17 and application thereof

By cloning and expressing the soybean E3 ubiquitin ligase gene GmSAL17, the problem of lagging research on soybean E3 ubiquitin ligase was solved, the salt tolerance of plants was improved, the seed germination rate under salt stress was increased, and the degree of wilting was reduced.

CN120758543APending Publication Date: 2025-10-10SHANDONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510709080.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

Research on soybean E3 ubiquitin ligase is lagging behind and lacks systematic studies, which affects the plant's response to environmental stress and improvement of stress resistance.

Method used

The soybean E3 ubiquitin ligase gene GmSAL17 was cloned and expressed. Through genetic engineering in Arabidopsis thaliana and soybean hairy roots, the expression level and activity of GmSAL17 were increased, and it was utilized to play a role in regulating plant salt tolerance.

Benefits of technology

It improves the salt tolerance of plants, which is manifested in high seed germination rate and low wilting degree under salt stress, and promotes the improvement of plant salt tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758543A_ABST
    Figure CN120758543A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant heredity and genetic engineering, and particularly relates to a soybean E3 ubiquitin ligase gene GmSAL17 and application thereof. Specifically, an E3 ubiquitin ligase gene GmSAL17 is separated from soybean Williams 82, and the GmSAL17 gene is expressed in Arabidopsis thaliana and soybean hairy roots, so that the germination rate of transgenic Arabidopsis thaliana seeds under salt stress is higher than that of a control, and the salt tolerance of soybean hairy root overexpression transgenic plants is higher than that of the control plants. Meanwhile, three haplotypes of GmSAL17 in a natural soybean population are identified, and the three haplotypes are found to have significant difference in salt tolerance, which is mainly manifested by significant difference of fresh weight and root length of seedlings under salt stress. It is fully proved that the GmSAL17 gene plays an important role in plant salt tolerance regulation and control and can be used for plant salt tolerance regulation and control, and therefore the GmSAL17 gene has good practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetics and genetic engineering, and particularly relates to a soybean E3 ubiquitin ligase gene GmSAL17 and an application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Plants exposed to the natural environment are often subject to various environmental stresses, such as drought, extreme temperatures, nutrient deficiencies, and pests and diseases. These environmental stresses not only restrict plant growth and development but also lead to reduced crop yields. Higher plants regulate their growth and development and their responses to environmental changes by regulating the expression of target genes. Biotic and abiotic stresses can adversely affect the growth and development of plants at risk. To counteract these adversities, plants have developed a variety of stimulation and activation strategies.

[0004] As core regulators of the ubiquitin-proteasome system, E3 ubiquitin ligases play a key role in plant stress tolerance (e.g., biotic and abiotic stress responses) and growth and development by specifically recognizing and ubiquitinating target proteins. The E3 ubiquitin ligase family is vast (e.g., over 1,500 species have been identified in Arabidopsis thaliana), and their substrate recognition mechanisms are highly specific (e.g., RING-type, U-box-type, and HECT-type structural differences). Although the functions of some E3 ubiquitin ligases have been reported, members of different species and subfamilies may participate in stress responses by regulating unique signaling pathways. A search revealed that research on soybean E3 ubiquitin ligases currently lags significantly behind that of model plants. As uncharacterized members, E3 ubiquitin ligases such as GmSAL17 may possess specific substrate selection, ubiquitination patterns, and downstream effector proteins. Filling this gap is crucial for improving the theoretical framework of the plant ubiquitin-proteasome system and its application in crop stress tolerance breeding. Summary of the Invention

[0005] To address the shortcomings of the prior art, the present invention aims to provide a soybean E3 ubiquitin ligase gene, GmSAL17, and its applications. Specifically, the present invention isolated the E3 ubiquitin ligase gene, GmSAL17, from soybean Williams 82. The gene locus number is Glyma.08G170400, and the reference genome annotation version is Glycine maxWm82.a2.v1 (G.max Wm82.a2.v1: Phytozome). Experimental studies have shown that GmSAL17 plays an important role in regulating plant salt tolerance. Based on these research findings, the present invention was completed.

[0006] In order to achieve the above technical objectives, the technical solutions provided by the present invention are as follows:

[0007] The first aspect of the present invention provides the use of the GmSAL17 gene or a biological material comprising the GmSAL17 gene in at least one of the following:

[0008] (a1) Regulation of plant salt tolerance;

[0009] (a2) improving and breeding plants;

[0010] The nucleotide sequence of the GmSAL17 gene is selected from:

[0011] (b1) the nucleotide sequence shown in SEQ ID NO. 1;

[0012] (b2) a nucleotide sequence that encodes a protein having the same amino acid sequence as the nucleotide sequence of (b1) but differs in sequence due to the degeneracy of the genetic code;

[0013] (b3) a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (b1) or (b2) and encodes a protein with the same or similar functional properties;

[0014] (b4) A nucleotide sequence complementary to any one of (b1) to (b3).

[0015] A second aspect of the present invention provides a preparation for improving plant salt stress tolerance, comprising at least one of the following (c1) to (c4):

[0016] (c1), an expression vector containing the GmSAL17 gene;

[0017] (c2), a recombinant host containing (c1);

[0018] (c3), a promoter or enhancer that enhances the expression of the GmSAL17 gene;

[0019] (c4), inducers that promote GmSAL17 gene expression;

[0020] The nucleotide sequence of the GmSAL17 gene cDNA is shown in SEQ ID NO.1.

[0021] The third aspect of the present invention provides a method for improving plant salt tolerance, comprising increasing the expression level and / or activity of the plant GmSAL17 gene with the preparation.

[0022] A fourth aspect of the present invention provides a method for improving and cultivating salt-tolerant plants, the method comprising increasing the expression level and / or activity of the GmSAL17 gene in the target plant.

[0023] A fifth aspect of the present invention provides a haplotype related to soybean salt tolerance, comprising a first haplotype, a second haplotype and / or a third haplotype;

[0024] The first haplotype includes at least one of Hap1-1, Hap2-1, and Hap3-1;

[0025] The second haplotype includes at least one of Hap1-1, Hap2-2, and Hap3-2;

[0026] The third haplotype includes at least one of Hap1-2, Hap2-1, and Hap3-2;

[0027] The Hap1-1 comprises at least two of SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12;

[0028] The Hap1-2 comprises at least two of the polymorphic forms of SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12;

[0029] The Hap2-1 comprises at least two of SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24;

[0030] The Hap2-2 comprises at least two polymorphic forms of SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24;

[0031] The Hap3-1 comprises at least two of SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38;

[0032] The Hap3-2 comprises at least two of the polymorphic forms of SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38.

[0033] Beneficial technical effects of one or more of the above technical solutions:

[0034] The above technical solution discloses for the first time the use of existing plant genetic engineering techniques to clone GmSAL17 from Williams82 and express it in Arabidopsis thaliana and soybean hairy roots. Experiments confirmed that the transgenic Arabidopsis thaliana exhibited higher salt tolerance than non-transgenic Arabidopsis, as evidenced by a higher seed germination rate under salt stress than the control. Transgenic soybean hairy root plants exhibited higher salt tolerance than the control, as evidenced by a lower degree of wilting under stress. Transgenic soybean hairy root RNAi plants exhibited lower salt tolerance than the control, as evidenced by a higher degree of wilting under stress. Furthermore, the present invention identified three haplotypes of GmSAL17 in a natural soybean population and found that they exhibited significant differences in salt tolerance, as evidenced by significant differences in seedling fresh weight and root length under salt stress. This fully demonstrates that the Williams 82 E3 ubiquitin ligase gene, GmSAL17, plays an important role in regulating plant salt tolerance and can be used for this purpose, thus possessing excellent practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without any creative work.

[0036] Figure 1Figure for the germination phenotype of 35S::GmSAL17 transgenic Arabidopsis under salt stress in the embodiment of the present application; wherein, L1 and L2 are two 35S::GmSAL17 transgenic homozygous lines respectively; Col-0 is the wild type control; the seeds of L1, L2 and Col-0 are respectively arranged on 0, 150 and 200 mM NaCl culture medium, and the results of 16 hours (8 hours of darkness) and 5 days of culture under the conditions of 20-22℃ of temperature and 70% of relative humidity under light are shown in the figure.

[0037] Figure 2 Figure for the observation of 7-day germination rate in the embodiment of the present application; wherein, L1 and L2 are two 35S::GmSAL17 transgenic homozygous lines respectively; Col-0 is the wild type Arabidopsis.

[0038]

[0039] Figure 3 Figure for the GmSAL17 gene soybean hairy root overexpression plant (OE) and its empty control (EV) after 5 days of treatment with water and 100 mM NaCl in the embodiment of the present application.

[0040] Figure 4 Data for the average fresh weight of GmSAL17 gene soybean hairy root interference plant (RNAi) and its empty control (EV) after 5 days of treatment with water and 100 mM NaCl in the embodiment of the present application, * represents Student's t-test, p<0.05 (n=15).

[0041] Figure 5 Figure for the GmSAL17 gene soybean hairy root interference plant (RNAi) and its empty control (EV) after 5 days of treatment with water and 100 mM NaCl in the embodiment of the present application.

[0042] Figure 6 Data for the average fresh weight of GmSAL17 gene soybean hairy root interference plant (RNAi) and its empty control (EV) after 5 days of treatment with water and 100 mM NaCl in the embodiment of the present application, * represents Student's t-test, p<0.05 (n=15).

[0043] Figure 7 Three main haplotypes of GmSAL17 gene in soybean cultivar population according to SNPs (single nucleotide polymorphism) and Indel (insertion and deletion mutation) in the embodiment of the present application, haplotype 1, haplotype 2 and haplotype 3.

[0044] Figure 8 ​The haplotype 1, haplotype 2 and haplotype 3 varieties in the embodiment of the present invention showed significant differences in multiple salt tolerance indicators (Student's t-test); wherein, NRL is the taproot length under salt; NFW is the fresh weight under salt.

[0045] Figure 9 This is the sequence alignment result of the GmSAL17 protein in the examples of the present invention and other proteins with high homology in Arabidopsis and rice. DETAILED DESCRIPTION

[0046] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0047] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this manual, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof. The present invention has used conventional techniques and methods in the field of genetic engineering and molecular biology. Those skilled in the art can adopt other conventional techniques, methods and reagents in this area on the basis of the embodiments provided by the present invention, without being limited to the limitation of the specific embodiments of the present invention.

[0048] As used herein, the term "identity" or "consistency" refers to sequence similarity to a nucleotide sequence. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.

[0049] To perform a sequence comparison, typically, one sequence is used as a reference sequence to which a test sequence is compared. When a sequence comparison algorithm is utilized, the test and reference sequences are input into a computer, the coordinates of the subsequences are specified, if necessary, and the parameters of the sequence algorithm program are specified. The sequence comparison algorithm then calculates the percent sequence identity (identity) of the test sequence relative to the reference sequence, based on the selected program parameters.

[0050] The gene (nucleic acid molecule) can be DNA, such as cDNA, genomic DNA or recombinant DNA.

[0051] In addition, a large number of transformation vectors that can be used for plant transformation are known to those skilled in the art of plant transformation, and the nucleic acid molecules of the present invention can be used in combination with any vector. The choice of vector will depend on the preferred transformation technology and target plant species for transformation and is not specifically limited here.

[0052] As mentioned above, soybean, an important economic crop, still lacks systematic research on the E3 ubiquitin ligase and its related functions in its genome, and the related molecular mechanisms and their application potential in stress-resistant breeding need to be revealed urgently.

[0053] In view of this, a typical embodiment of the present invention provides the use of the GmSAL17 gene or a biological material comprising the GmSAL17 gene in at least one of the following:

[0054] (a1) Regulation of plant salt tolerance;

[0055] (a2) improving and breeding plants;

[0056] The nucleotide sequence of the GmSAL17 gene is selected from:

[0057] (b1) the nucleotide sequence shown in SEQ ID NO. 1;

[0058] (b2) a nucleotide sequence that encodes a protein having the same amino acid sequence as the nucleotide sequence of (b1) but differs in sequence due to the degeneracy of the genetic code;

[0059] (b3) a nucleotide sequence having ≥90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence) identity with the nucleotide sequence shown in (b1) or (b2) and encoding a nucleotide sequence having the same or similar functional protein;

[0060] (b4) A nucleotide sequence complementary to any one of (b1) to (b3).

[0061] As described above, the soybean E3 ubiquitin ligase gene can be used to regulate soybean salt tolerance.

[0062] In a specific embodiment of the present invention, the biological material includes a recombinant expression vector, a transgenic cell line, a host bacteria or a transgenic plant.

[0063] The expression vector is any one or more of a viral vector, a plasmid, a phagemid, a cosmid, or an artificial chromosome; no specific limitation is made here.

[0064] The transgenic cell line is an isolated, in vitro, cultured plant cell or a part of a plant; wherein the plant cell is a cell of any plant selected from Arabidopsis thaliana, soybean, tobacco, corn, rice, and wheat; and is not specifically limited here.

[0065] The host bacteria are eukaryotic or prokaryotic bacteria, including bacteria, fungi, and actinomycetes.

[0066] Furthermore, the bacteria may be from the genus Escherichia, Flavobacterium, Agrobacterium, Pseudomonas, Bacillus, etc., and further may be Escherichia coli, Agrobacterium tumefaciens, Bacillus subtilis or Bacillus pumilus.

[0067] Furthermore, the fungus may be yeast. The fungus may be from the genus Fusarium, Verticillium, Aspergillus, Cephalosporium, etc. The actinomycetes may be from the genus Streptomyces, Nocardia, Neurospora, etc.

[0068] The transgenic plant is any one of Arabidopsis, soybean, tobacco, corn, rice, and wheat, which are not specifically limited here.

[0069] In a specific embodiment of the present invention, in (a1), the regulation of plant salt tolerance is specifically manifested as follows: the GmSAL17 gene is expressed in Arabidopsis thaliana and soybean hairy roots, then the salt tolerance of transgenic Arabidopsis thaliana is higher than that of non-transgenic Arabidopsis thaliana, which is mainly reflected in the higher seed germination rate under salt stress than the control; the salt tolerance of transgenic soybean hairy root plants is higher than that of control plants, which is mainly reflected in the lower degree of wilting under salt stress, that is, promoting / improving plant salt tolerance; and silencing the expression of the GmSAL17 gene in soybean hairy roots (using RNAi interference technology) is manifested as a higher degree of wilting under salt stress, that is, inhibiting / reducing plant salt tolerance.

[0070] In some specific embodiments of the present invention, the RNAi target sequence of the gene GmSAL17 is shown as SEQ ID NO.2.

[0071] In the above (a2), improving and cultivating plants specifically refers to improving and cultivating plant varieties with salt tolerance.

[0072] In a specific embodiment of the present invention, the plant is Arabidopsis, soybean, tobacco, corn, rice and wheat. Preferably, the plant is soybean.

[0073] In another embodiment of the present invention, a preparation for improving plant salt tolerance is provided, comprising at least one of the following (c1) to (c4):

[0074] (c1), an expression vector containing the GmSAL17 gene;

[0075] (c2), a recombinant host containing (c1);

[0076] (c3), a promoter or enhancer that enhances the expression of the GmSAL17 gene;

[0077] (c4), inducers that promote GmSAL17 gene expression;

[0078] The nucleotide sequence of the GmSAL17 gene cDNA is shown in SEQ ID NO.1.

[0079] In another embodiment of the present invention, a method for improving plant salt tolerance comprises using the formulation to increase the expression and / or activity of the plant's GmSAL17 gene. Alternatively, the formulation comprises a nucleic acid molecule encoding the GmSAL17 protein, and the amino acid sequence of the GmSAL17 protein is shown in SEQ ID NO. 3.

[0080] In one embodiment of the present invention, the plant is soybean.

[0081] In another embodiment of the present invention, a method for improving and cultivating salt-tolerant plants is provided, the method comprising increasing the expression level and / or activity of the GmSAL17 gene in the target plant.

[0082] In the above method, increasing the expression level and / or activity of the GmSAL17 gene in the target plant can be achieved by introducing a plasmid containing the GmSAL17 gene, operably linking a strong promoter to the GmSAL17 gene, and introducing an enhancer, etc., which are not specifically limited here.

[0083] In another embodiment of the present invention, the target plant can be any plant at any developmental stage, such as Arabidopsis, soybean, tobacco, corn, rice, wheat, etc., which is not specifically limited here.

[0084] The present invention also provides molecular markers related to salt tolerance in the GmSAL17 gene. The molecular markers are distributed in the promoter region and coding region of the GmSAL17 gene, including SNPs and Indels. The molecular markers are shown in Table 1.

[0085] Table 1

[0086]

[0087]

[0088] In another specific embodiment of the present invention, a soybean salt tolerance-related GmSAL17 gene haplotype is provided, comprising haplotype 1, haplotype 2 and / or haplotype 3;

[0089] The haplotype 1 includes at least one of Hap1-1, Hap2-1, and Hap3-1;

[0090] The haplotype 2 includes at least one of Hap1-1, Hap2-2, and Hap3-2;

[0091] The haplotype 3 includes at least one of Hap1-2, Hap2-1, and Hap3-2;

[0092] The Hap1-1 comprises at least two of SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12;

[0093] The Hap1-2 comprises at least two of the polymorphic forms of SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12;

[0094] The Hap2-1 comprises at least two of SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24;

[0095] The Hap2-2 comprises at least two polymorphic forms of SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24;

[0096] The Hap3-1 comprises at least two of SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38;

[0097] The Hap3-2 comprises at least two of the polymorphic forms of SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38.

[0098] In some embodiments, the genotype of Hap1-1 is TCCATAAAGTGTATATAAGGC, and the molecular markers contained therein are SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12.

[0099] In some embodiments, the genotype of Hap1-2 is CTCCAGTGAGTTGAA, and the molecular markers contained therein are polymorphic forms of SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12.

[0100] In some embodiments, the genotype of Hap2-1 is TCACGGGAACCT, and the molecular markers contained therein are SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24.

[0101] In some embodiments, the genotype of Hap2-2 is CATGCTCCGCAGAC, and the molecular markers contained therein are polymorphic forms of SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24.

[0102] In some embodiments, the genotype of Hap3-1 is GGCAAATTGGTACGG, and the molecular markers contained therein are SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38.

[0103] In some embodiments, the genotype of Hap3-2 is AACATATTATTTTAACATTGGCA, and the SNP sites contained therein are polymorphic forms of SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38.

[0104] In some embodiments, the genotype of haplotype 1 arranged in order of the positions of the above 38 molecular markers in the genome is TCTCATAAAGTGTGATATAAGGGCCACAATTGGTACACAGGCGGGAACCT.

[0105] In some embodiments, the genotype of haplotype 2 arranged in order of the positions of the above 38 molecular markers in the genome is TCCCATAAAGTGTAATATAAGAGCCAATATTATTTTAACATTGCTCGGCTCCGCAGAC.

[0106] In some embodiments, the genotype of haplotype 3 arranged in order of the positions of the above 38 molecular markers in the genome is CTTCACAGTGAGTTAGAACCATATTATTTTAACATTGGACACGGGAACCT.

[0107] In the present invention, SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, SNP12, SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, SNP24, SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38 represent the corresponding genotypes in the GmSAL17 reference genome (Glyma.08G170400), and their polymorphic forms refer to the mutation forms relative to the site.

[0108] In this disclosure, terms such as "serial number" and "number" are used solely for distinction and should not be construed as explicitly or implicitly indicating the relative importance or number of technical features. For example, the terms "Hap1-2" and "Hap2-1" are used solely for distinction and should not be construed as explicitly or implicitly indicating the relative importance, number, or relative position of technical features. Therefore, features specified as "first" or "second" may explicitly or implicitly include at least one such feature.

[0109] In some preferred embodiments, the method for detecting the above-mentioned molecular markers or confirming the above-mentioned haplotypes is selected from fluorescence signal detection or direct sequencing detection.

[0110] In some preferred embodiments, the method comprises primers or probes for amplifying or detecting all or part of the above-mentioned SNP molecular markers related to the soybean salt tolerance trait.

[0111] In the present invention, "primers or probes" can be broadly understood as other molecular markers used to amplify or detect all or part of the SNP molecular markers related to the soybean salt tolerance trait described above, that is, including but not limited to primers or probes.

[0112] In some preferred embodiments, the primers used to amplify the gene fragment containing the SNP molecular marker are as follows:

[0113] GmSAL17promoter-F: 5'-TGCATATGTCAAAGAAGAGAGAAGCCGCGTGTTAGAAG-3';

[0114] GmSAL17promoter-R: 5'-CGGTTGGGTATGAATTGAGAGGGAAAGAGATTGAGATGGC-3';

[0115] GmSAL17gDNA-F: 5'–AAACCCCACCATCCAGCCTTGC-3';

[0116] GmSAL17gDNA-R: 5'-CAATTTCAATCCAATCAACC-3'.

[0117] In the present invention, the soybean germplasm resources in haplotype 1 and haplotype 2 show higher root length and aboveground fresh weight than haplotype 3 under salt stress, and the soybean germplasm resources in haplotype 3 show relatively lower root length and aboveground fresh weight under salt stress. Haplotype 1 and haplotype 2 are more salt-tolerant (i.e., salt-tolerant), and haplotype 3 is more sensitive to salt (salt-sensitive or salt-sensitive).

[0118] In some preferred embodiments, the present invention provides a salt-tolerant soybean haplotype comprising haplotype 1 and haplotype 2.

[0119] In the present invention, the term "haplotype" refers to a group of related multiple SNP alleles / molecular markers located in a certain region on the same chromosome.

[0120] The present invention also provides the use of the above-mentioned SNP molecular markers related to the soybean salt tolerance trait and the above-mentioned primers in soybean genotyping, screening, identification or auxiliary identification, breeding or auxiliary breeding.

[0121] In the present invention, breeding or assisted breeding should be understood in a broad sense, such as including molecular assisted breeding, QTL analysis, map-based cloning, seed purity detection, assisted major gene selection, backcross breeding, whole genome selection breeding, transgenic component identification, species evolution analysis, etc.

[0122] In some preferred embodiments, the invention comprises the application of any of the following:

[0123] (1) Identify or assist in identifying the salt tolerance or salt sensitivity of soybeans; (2) Prepare products for identifying or assisting in identifying the salt tolerance or salt sensitivity of soybeans; (3) Compare the salt tolerance or salt sensitivity of the soybeans to be tested; (4) Prepare products for comparing the salt tolerance or salt sensitivity of the soybeans to be tested; (5) Select soybean plants, lines, varieties or varieties with relatively strong salt tolerance or salt sensitivity; (6) Prepare products for selecting soybean plants, lines, varieties or varieties with relatively strong salt tolerance or salt sensitivity; (7) Screen soybean plants, lines, varieties or varieties with relatively weak salt tolerance or salt sensitivity. (8) Preparation of products for screening soybean plants with relatively strong salt tolerance or salt sensitivity; (9) Genotyping of soybean germplasm resources and / or genetic populations; (10) Construction of DNA fingerprint maps or databases of soybean germplasm resources and / or varieties; (11) Genetic diversity analysis of soybean germplasm resources and / or genetic populations; (12) Application in soybean cluster analysis; (13) Application in soybean whole genome association analysis; (14) Application in soybean kinship identification.

[0124] The present invention is described in detail below with reference to the accompanying drawings and specific examples. In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified. The experimental methods described are conventional methods in the art unless otherwise specified.

[0125] Example 1: Cloning of GmSAL17 and Construction of Plant Expression Vector

[0126] 1.1 Extraction of total RNA from Williams 82

[0127] (1) Take the appropriate amount of Williams 82 soybean (from China Agricultural University, Capital Resources Institute) leaf material, liquid nitrogen quick freezing and grinding or using a proofing machine (22 rpm) to make powder, directly applied to RNA extraction experiment or frozen at -80°C ultra-low temperature refrigerator for standby, pre-cooling 4 degrees centrifuge; (2) After the liquid nitrogen volatilizes, immediately transfer 100-200 mg of plant powder into an RNase-free 1.5 mL centrifuge tube, then quickly add 1 mL Trizol extraction solution, vortex to make the sample fully dissolved in the extraction solution, room temperature for 10 min, then add 0.2 mL chloroform and mix well for 15 sec, room temperature for 5-10 min; (4) 4°C, 12,000 rpm, centrifuge for 15 min, transfer 0.4 mL supernatant to a new 1.5 mL centrifuge tube, add 0.4 mL isopropanol, mix the solution by turning up and down for 15 times, room temperature for 10 min; (5) 4°C, 12,000 rpm, centrifuge for 10 min, discard the supernatant, wash the precipitate with 1 mL 75% ethanol (DEPC water diluted anhydrous ethanol) twice, 4°C, 12,000 rpm, centrifuge for 5 min; (6) discard the supernatant, after 2 min, absorb the excess liquid, open the cover in the clean bench, dry the RNA for about 5-7 min, add 40 μL DEPC water, dissolve the RNA at 65°C for 5 min; (7) measure the OD value and concentration of the RNA sample by ultraviolet spectrophotometer, A 260 / A 280 reach 1.7-2.0 is good; agarose gel electrophoresis detects quality.

[0128] 1.2 Reverse transcription of RNA

[0129] (1) Add the following substances to the RNase-free centrifuge tube (40 μL reaction system) in turn:

[0130]

[0131] (2) After mixing gently, denature at 65°C for 5 min, immediately insert into ice, ice bath for at least 1 min;

[0132] (3) Add the following substances to the centrifuge tube in turn

[0133]

[0134] (4) After mixing gently, incubate at 42°C for 1 h, denature at 65°C for 10 min, store at -20°C for standby.

[0135] 1.3 GmSAL17 gene cloning

[0136] GmSAL17 CDS cloning primer:

[0137] GmSAL17CDS-F: 5'-gacttgTTGCGGAAAGGATCCATGACTCCCACGTCGAGAAA-3';

[0138] GmSAL17CDS-R: 5'-atggtctttgtagtcCCCGGGGGACATGTTAACATGGACAC-3';

[0139] GmSAL17 RNAi fragment cloning primers:

[0140] GmSAL17RNAi-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTACAACTTAGCGGAAGCGAACG-3';

[0141] GmSAL17RNAi-R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCACGACTCTTCCTTCCCACA-3'.

[0142] (1) The reaction system for amplifying gene fragments using the high-fidelity enzyme Phanta is as follows (50 μL system):

[0143]

[0144] Amplification conditions are as follows:

[0145]

[0146] After the reaction was completed, the reaction solution was detected by 1% TAE agarose gel electrophoresis.

[0147] (2) Purification and recovery of cloned gene fragments (Novagen Gum Recovery Kit)

[0148] 1) Place the excised gel containing the target fragment into a 1.5 mL centrifuge tube and weigh the gel. Add an equal volume of gelling solution and incubate at 65°C for 5-10 minutes, turning the tube over continuously until it is completely melted. 2) After the gel is completely melted, pipette ≤700 μL of the solution into a recovery column and allow to stand for 1 minute. 3) Centrifuge at room temperature, 12,000 rpm, for 30 seconds and discard the solution. 4) Add 300 μL of gelling solution to the recovery column, allow to stand for 1 minute, then centrifuge at 12,000 rpm for 1 minute and discard the waste solution. ; 5) Add 700 μL of rinse solution to the column, centrifuge at 12000 rpm for 1 min, discard the rinse solution, and repeat the cleaning step once; 6) Empty the column, centrifuge at 12000 rpm for 2 min; 7) Open the recovery column and dry it for 3-5 min, put it into a new clean 1.5 mL centrifuge tube, add 30 μL of sterile water or EB buffer preheated at 65°C, and let it stand for 2 min; 8) Centrifuge at 12000 rpm for 1 min. The resulting solution is the recovered fragment, which can be used after measuring the concentration.

[0149] 1.4 Connection

[0150] (1) Overexpression vector construction—homologous recombination ligation

[0151] 1) Vector linearization. First, perform restriction enzyme digestion on the pTF101 plasmid (purchased from Baosai Plasmid and Strain Company). The pTF101 restriction enzyme digestion reaction system is as follows (20 μL system):

[0152]

[0153] The reaction was carried out at 37°C for 1 hour and 30 minutes, and then terminated by treating at 65°C for 20 minutes. The enzyme digestion results were verified by running a gel.

[0154] 2) Recombination reaction. The optimal amount of cloning vector used in the ClonExpress II recombination reaction system is 0.03 pmol, and the optimal amount of insert used is 0.06 pmol (vector:insert molar ratio of 1:2). The corresponding DNA masses can be roughly calculated using the following formula.

[0155] Optimal cloning vector usage = [0.02 × number of cloning vector base pairs] ng (0.03 pmol)

[0156] Optimal amount of insert fragment used = [0.04 × number of base pairs of insert fragment] ng (0.06 pmol)

[0157] The recombination reaction system is as follows (10 μL system):

[0158]

[0159]

[0160] Using a pipette to gently pipette, short centrifugation to collect the reaction solution to the bottom of the tube. 37°C reaction for 30 min, then reduced to 4°C or immediately placed on ice cooling.

[0161] (2) RNAi vector construction - Gateway connection first step

[0162] BP reaction (Gateway system) system as follows (2.5 μL system):

[0163]

[0164] 25°C reaction overnight.

[0165] 1.5 E. coli plasmid transformation (aseptic operation)

[0166] (1) The above connection product is added to 50 μL of commercial DH5α competent cells, and the centrifuge tube is mixed by flicking, and ice bathed for 30 min; (2) 42°C, warm water bath heat shock 90 sec, immediately ice bath 2-3 min; (3) Add 0.8 mL of antibiotic-free LB medium, 37°C shaking bed 200 rpm shaking culture 45-60 min; (4) Room temperature, 5000 rpm, centrifugation for 3 min, collect bacteria; (5) The bacteria are coated on the culture plate containing the plasmid carrying resistance, and incubated at 37°C overnight.

[0167] 1.6 E. coli PCR verification

[0168] Single clone shaking bacteria are picked from the culture dish, and PCR verification is performed using polymerase 2xM5 Hiper plus Taq HiFi PCR mix, and the reaction system is as follows (20 μL system):

[0169]

[0170] The amplification conditions are as follows:

[0171]

[0172] After the reaction is completed, the reaction solution is detected by 1% TAE agarose gel electrophoresis to determine whether there is a correct target band.

[0173] 1.7 Recombinant plasmid sequencing

[0174] The positive single colony of the colony PCR band was inoculated into 0.8 mL of LB liquid medium containing the corresponding antibiotic (pDONR221 plasmid was kanamycin resistant (50 mg / mL), pTF101 plasmid was spectinomycin resistant (60 mg / mL)) and cultured at 37°C for 4-6 h in a 200 rpm shaker, and then sent to Ribobio Company for sequencing. Universal primers corresponding to the vector were used for bidirectional sequencing, and the sequencing results were obtained.

[0175] The sequencing results were compared with the standard sequence, and the coincidence degree was 100%. It indicated that the vector was successfully constructed. The nucleotide sequence of the cDNA of the gene GmSAL17 is shown as SEQ ID NO. 1, and the target sequence of the RNAi of the gene GmSAL17 is shown as SEQ ID NO. 2. The constructed pDONR221-GmSAL17 RNAi intermediate vector can be used for the subsequent Gateway connection second step-LR reaction.

[0176] 1.8 Extraction of E. coli plasmid DNA

[0177] (1) Inoculate a single positive colony that has been successfully sequenced into 10 mL of LB liquid culture medium containing plasmid-carrying resistance, and culture it in a shaker at 37°C and 200 rpm overnight; (2) Centrifuge at 12,000 rpm for 1 min at room temperature to collect the bacteria, and use the Novezan FastPure Plasmid Mini Kit to extract the plasmid; (3) Discard the supernatant, add 250 μL of pre-cooled solution I, and vortex to completely resuspend the bacteria; (4) Add 250 μL of solution II and quickly invert and mix 6-8 times; (5) Add 350 μL of solution III and invert and mix 6-8 times; (6) Centrifuge at 12,000 rpm for 10 min; (7) Place the FastPure DNA Mini Columns adsorption column in the Collection Tube 2mL collection tube. Carefully transfer the supernatant from step 6 to the adsorption column using a pipette, taking care not to absorb the precipitate. Centrifuge at 12,000 rpm for 30-60 seconds, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube. (8) Add 600 μL of Buffer PW2 (please check whether it has been diluted with anhydrous ethanol) to the adsorption column. Centrifuge at 12,000 rpm for 30-60 seconds. Discard the waste liquid and return the adsorption column to the collection tube. (9) Repeat step (8). (10) Return the adsorption column to the collection tube and centrifuge at 12,000 rpm for 1 minute to dry the adsorption column to completely remove the remaining rinse solution in the adsorption column. (11) Place the adsorption column in a new sterilized 1.5 mL centrifuge tube, add 30-100 μL of sterile water or EB buffer preheated at 65°C to the center of the adsorption column membrane, let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 1 minute to elute the DNA, and store at -20°C for later use.

[0178] 1.9 RNAi vector construction - Gateway connection step 2

[0179] The LR reaction (Gateway system) system is as follows:

[0180]

[0181] The reaction was allowed to proceed at 25°C overnight.

[0182] 1.10 E. coli plasmid transformation (same as 1.5)

[0183] 1.11 E. coli PCR verification (same as 1.6)

[0184] 1.12 Recombinant plasmid sequencing (same as 1.7)

[0185] 1.13 Extraction of E. coli plasmid DNA (same as 1.8)

[0186] 1.14 Plasmid transformation of Agrobacterium (sterile procedure)

[0187] (1) Add 1 μL of plasmid DNA to 50 μL of commercial GV3101 Agrobacterium competent cells, flick the tube to mix, and incubate on ice for 5 min;

[0188] (2) Quickly freeze in liquid nitrogen for 5 minutes; then bathe in water at 37°C for 5 minutes; then immediately bathe in ice for 3-5 minutes;

[0189] (3) Add 0.8 mL of antibiotic-free LB medium and incubate at 28°C for 2-4 h;

[0190] (4) Centrifuge at 5,000 rpm for 3 min at room temperature to collect the cells;

[0191] (5) The bacteria were spread on a YEP culture plate containing a plasmid carrying resistance and 50 μg / mL rifampicin, and cultured in an inverted manner at 28°C for 48 h.

[0192] 1.15 PCR verification of Agrobacterium

[0193] The reaction system is as follows (20 μL system):

[0194]

[0195] Amplification conditions are as follows:

[0196]

[0197] After the reaction was completed, the reaction solution was detected by 1% TAE agarose gel electrophoresis.

[0198] Example 2: Verification of the salt tolerance function of the protein gene GmSAL17 expressed in Arabidopsis

[0199] 2.1 Arabidopsis transformation using the inflorescence infection method

[0200] (1) When Arabidopsis thaliana (Col-0 wild type) grew to 1 cm in height, the top was cut off to induce the formation of lateral inflorescences;

[0201] (2) One day before transformation, 1 mL of activated Agrobacterium GV3101 containing the expression vector plasmid was added to 40 mL of YEP medium containing the corresponding antibiotics and 50 μg / mL rifampicin, and cultured at 28°C with shaking until the OD 600 About 0.8-1.2;

[0202] (3) Centrifuge at room temperature, 5000 rpm for 10 min, collect the cells, and resuspend them in infection solution (5% sucrose, 0.02% Silwet L-77) to an OD of 600 About 0.8;

[0203] (4) Before infection, cut off the fruit pods and flowers that have grown in Col-0, and use a pipette to drop Agrobacterium onto the inflorescence for infection. Make sure that the Agrobacterium infection droplets completely cover the inflorescence. After all inflorescences are infected, let it stand for about 10 minutes to ensure complete infection and prevent the droplets from sliding off.

[0204] (5) Cover the inflorescence with a black fresh-keeping bag and place it in a dark place at 20-22℃ for overnight cultivation. After one day of cultivation, remove the fresh-keeping bag and cultivate until the seeds mature.

[0205] 2.2 Surface disinfection of Arabidopsis seeds

[0206] Place an appropriate amount of Arabidopsis seeds to be sterilized in a 1.5 mL centrifuge tube, add 1 mL of 75% ethanol (containing 0.05% Triton X-100 by volume) and shake for 3 minutes (1-3 times, depending on the quality of the seeds), then shake and sterilize with anhydrous ethanol for 1 minute (twice), finally use a pipette to suck the seeds onto sterile filter paper and blow dry, then use a sterile toothpick to point them into the culture medium or evenly sprinkle the sterilized seeds on the culture medium.

[0207] 2.3 Screening of homozygous transgenic plants

[0208] After infection, harvested T1 seeds were surface-sterilized and then evenly plated on 1 / 2 MS medium (containing Basta). Three days after vernalization, the plants were grown in a light incubator. Positive plants were screened approximately 10 days after exposure to light. Plants with dark green cotyledons and normal root growth were considered transgenic plants, while plants with light green or even yellow cotyledons and suppressed root growth were considered non-transgenic plants. Transgenic positive plants were transplanted to nutrient soil for cultivation, individual plants were numbered, and cultured until harvesting to obtain T2 generation seeds (individual plant harvesting). Part of the T2 generation seeds collected from individual plants were further screened on 1 / 2 MS medium containing Basta. Positive plants with single copy insertions with a progeny segregation ratio of 3:1 (positive:negative) were transplanted. About 10 individual plants were transplanted for each line and cultured until T3 generation seeds were harvested (individual plant harvesting). Part of the T3 generation seeds collected from individual plants were then evenly spread on 1 / 2 MS medium (containing Basta). If all the progeny were positive, pure line T3 generation seeds were obtained, and the pure line T3 generation seeds were transplanted for seed propagation.

[0209] 2.4 DNA extraction from homozygous transgenic plants

[0210] (1) Take an appropriate amount of Arabidopsis leaf material in a 1.5 mL centrifuge tube, quickly freeze it in liquid nitrogen, grind it or use a sampler (22 rpm) to make it into powder, and directly use it for DNA extraction experiments or freeze it in a -80 °C ultra-low temperature refrigerator for future use. Pre-cool the centrifuge at 4 degrees in advance;

[0211] (2) Add 600 μL of CTAB extract to the centrifuge tube, vortex to fully dissolve the sample in the extract, and place at 65°C for 15-30 min;

[0212] (3) Add 600 μL of chloroform and shake vigorously to mix, then centrifuge at 12,000 rpm at 4°C for 15 min;

[0213] (4) Transfer 0.4 mL of the supernatant to a new 1.5 mL centrifuge tube, add 0.4 mL of isopropanol, invert thoroughly to mix the solution, and place at -20°C for 15 min.

[0214] (5) Centrifuge at 4°C, 12,000 rpm for 10 min, discard the supernatant, wash the precipitate twice with 600 μL of 70% ethanol, and centrifuge at 4°C, 12,000 rpm for 5 min;

[0215] (6) Discard the supernatant, leave the tube in the air for 2 minutes, then remove excess liquid. Open the lid and dry the DNA on a clean bench for about 5-7 minutes. Add 100 μL of water and fully dissolve the DNA at 65°C for 5 minutes.

[0216] (7) Use UV spectrophotometer to measure the OD value and concentration of DNA sample. 260 / A 280 It is best to reach 1.7-2.0.

[0217] 2.5 PCR detection of transgenic plants

[0218] PCR method for screening transgenic positive plants: DNA of resistant plants was detected by PCR using GmSAL17 gene identification primers.

[0219] GmSAL17 gene identification PCR primer sequences:

[0220] TF101-F: 5'-GAGAACACGGGGGACTCTAGA-3';

[0221] GmSAL17CDS-R: 5'-atggtctttgtagtcCCCGGGGGACATGTTAACATGGACAC-3'.

[0222] PCR amplification was performed using 2×M5 HiPer plus Taq HiFi PCR mix. The reaction system (20 μL system) was as follows:

[0223]

[0224] Amplification conditions are as follows:

[0225]

[0226] After the reaction was completed, the reaction solution was detected by 1% TAE agarose gel electrophoresis.

[0227] 2.6 Extraction of RNA from homozygous transgenic plants (same method as 1.1)

[0228] 2.7 RNA Reverse Transcription

[0229] (1) Add the following substances to an RNase-free centrifuge tube in sequence (40 μl reaction system):

[0230]

[0231] (2) After gently mixing, perform the following procedure

[0232]

[0233] 2.8 RT-PCR detection of transgenic plants

[0234] Screening of transgenic positive plants by PCR: cDNA of transgenic Arabidopsis plants was detected by PCR using GmSAL17 gene RT-PCR primers.

[0235] GmSAL17 gene RT-PCR primer sequences:

[0236] GmSAL17-qPCR-F: 5'-TCTCGTTTCTCGGCCAAGAC-3'; GmSAL17-qPCR-R: 5'-AGCTTCTTCATCACTCCAAC-3';

[0237] Actin gene was used as an internal standard, and its primer sequences were:

[0238] AtACT8-F: 5'-TGGAGACCTCGAAAACCAGC-3'; AtACT8-R: 5'-ATCCCTGCAGCTTCCATTCC-3'.

[0239] The reaction for RT-PCR amplification using ordinary Taq enzyme is as follows (20 μl system):

[0240]

[0241] Amplification conditions are as follows:

[0242]

[0243] After the reaction was completed, the reaction solution was detected by 2% TAE agarose gel electrophoresis.

[0244] 2.9 Salt tolerance testing of transgenic Arabidopsis

[0245] (1) Surface disinfection of Arabidopsis seeds (same as 2.2).

[0246] (2) NaCl treatment

[0247] Sterile Col-0, OE-L1, and OE-L2 pure line seeds were evenly spread on 0, 150, and 200 mM NaCl culture medium plates, respectively. After 3 days of vernalization, they were moved into a light incubator for light growth. The germination rate of each transgenic plant at each concentration was counted every 24 hours for a total of 7 days.

[0248] Results: On normal 1 / 2MS medium, the germination rates of Col-0, OE-L1, OE-L2 and Col-0 seeds cultured under the same growth conditions after 24 hours of exposure to light were almost 100%, indicating that the transgenic seeds were of higher quality than the wild-type seeds; in 1 / 2MS medium containing 150mM NaCl, the germination rates of OE-L1 and OE-L2 were higher than those of Col-0, proving that GmSAL17 plays a certain role in the process of plant response to salt stress. Figure 1 , statistical data see Figure 2 (Data are expressed as mean ± SD of three biological replicates).

[0249] Example 3: Verification of the salt tolerance function of overexpressed protein gene GmSAL17 in hairy roots

[0250] 3.1 Soybean hairy root transformation method

[0251] (1) Select about 300 soybean seeds with relatively complete seed coats and no color spots, spread the soybean seeds evenly on the vermiculite with the hilum facing downward, and cover the spread seeds with about 1 cm of vermiculite. Place it in a 25℃ light for 16h and 22℃ dark for 8h culture until the bean seedlings emerge from the soil and the petals are not fully opened (about 5 days), and observe the state of the bean seedlings during this period; (2) Culture root-inducing Agrobacterium during the 5d of seed germination. The specific method is as follows: add 1μL of plasmid DNA to 50μL of commercial GV3101 Agrobacterium competent cells, flick the centrifuge tube to mix, and ice bath for 5min; quick freeze with liquid nitrogen for 5min; then water bath at 37℃ for 5min; immediately ice bath for 3-5min; add 0.8mL of LB medium without resistance, shake in a 28℃ shaker for 2-4h; centrifuge at room temperature, 5,000rpm, for 3min, collect the bacteria; spread the bacteria on TY solid medium containing plasmid-carrying resistance and 100μg / mL streptomycin, and culture at 28℃ for 48h. After PCR identification of single colonies, select multiple positive colonies and inoculate them into 5mL of LB medium to which plasmid-carrying resistance and 100μg / mL streptomycin have been added. TY liquid culture medium, placed on a shaker at 28℃, 200rpm, and cultured overnight until turbid; (3) 400μL of the bacterial solution was aspirated and spread on TY solid culture medium containing plasmid-carrying resistance and streptomycin, and cultured in an inverted incubator at 28℃ for 12-24h. During this period, pay attention to the growth of the bacteria until a biofilm is formed; (4) Select healthy soybean seedlings that have successfully emerged from the soil, have uniform growth, and have not fully opened bean petals. Use tweezers to remove the soybean seed coat. Use a blade to cut off the root of the bean seedling at the hypocotyl 2-4cm away from the cotyledon, and keep the incision flat. Keep the upper half containing the cotyledon, and scrape an appropriate amount of root-inducing Agrobacterium K599 bacteria from the seedling incision to ensure that the incision is completely contaminated with Agrobacterium; (5) Arrange the seedlings infected with Agrobacterium neatly in a square dish filled with moist filter paper to ensure that the cotyledon part does not leak out or is not crowded. After infection, place the square dish in a dark environment at 25℃ overnight; (6) The next day, place the infected seedlings in a hole tray filled with vermiculite (one hole tray can hold 50 seedlings), cover it, and culture it in a 25℃ light for 16 hours and 22℃ dark for 8 hours; (7) After the soybean seedlings grow for about a week, remove the adventitious roots of each seedling at the non-incision part, place them in the hole tray as they are, cover it, and continue to grow under the original growth conditions until the first three-leaf compound leaf is fully expanded; (8) Without causing damage to the hairy roots, gently remove the soybean seedlings from the soil and wash them, place them in a hydroponic box and culture them for 1-2 days to adapt them to the hydroponic environment. Select 15 plants with consistent and well-grown hairy roots above ground and transplant them into a 15-hole hydroponic box. Water them with Hoagland nutrient solution. The preparation of Hoagland nutrient solution (1L) is shown in the table below:

[0252]

[0253] *Trace elements: H3BO3, MnSO4, ZnSO4·7H2O, CuSO4·5H2O, Na2MoO4·2H2O, with final concentrations of 25μmol / L, 2μmol / L, 2μmol / L, 0.5μmol / L, and 0.5μmol / L, respectively.

[0254] (9) Hairy root transformation was performed according to the above method, and the hairy roots of 35S::GmSAL17 overexpressing plants (OE) and their empty vector control (EV(OE)) and pB7GWIWGII::GmSAL17 RNAi plants and their empty vector control (EV(RNAi)) were transformed respectively.

[0255] 3.2 Salt tolerance phenotype experiment of soybean hairy roots

[0256] 3.2.1 Overexpression of hairy root salt tolerance phenotype

[0257] When the soybean seedlings in the hydroponic box grow the second trifoliate leaf, they can be treated with saline solution and irrigated with 100 mM NaCl solution to examine the hairy root phenotype of the overexpressing plants (OE) and their empty control (EV(OE)).

[0258] Results: After 5 days of treatment with 100 mM NaCl, the wilting degree of 35S::GmSAL17 overexpressing soybean hairy root plants (OE) was lower than that of their empty-loaded controls (EV), showing a salt-insensitive phenotype (see Figure 3 ), fresh weight of single plant (see Figure 4 ) also supports this conclusion (* represents Student's t-test, p < 0.05, n = 15), proving that this gene plays a certain role in the plant salt stress response process and may play a positive role in regulating salt tolerance.

[0259] 3.2.2 Interference with hairy root salt tolerance phenotype experiment

[0260] When the soybean seedlings in the hydroponic box grow the second trifoliate leaf, they can be treated with saline solution and 100 mM NaCl solution to observe the phenotype of the hairy roots of the interfered plants (RNAi) and their empty control (EV).

[0261] Results: After 5 days of treatment with 100 mM NaCl, the wilting degree of soybean hairy root plants (RNAi) with pB7GWIWGII::GmSAL17 was higher than that of the empty control (EV), showing a salt-sensitive phenotype (see Figure 5 ), data on average fresh weight of above-ground parts (see Figure 6) also supports this conclusion (* represents Student's t-test, p < 0.05, n = 15), proving that this gene plays a certain role in the plant salt stress response process and may play a positive role in regulating salt tolerance.

[0262] Example 4. Haplotype Analysis and Phenotype Its Salt Tolerance Phenotype

[0263] 4.1 Haplotype analysis

[0264] Primers were designed to amplify gene fragments with high polymorphism abundance of GmSAL17, and the gene fragments were sent to the company for sequencing. By comparing with the reference genome sequence (Glyma.08G170400, the reference genome annotation version is Glycine max Wm82.a2.v1 (G.max Wm82.a2.v1:Phytozome)), the correlation between the corresponding molecular markers and phenotypes was analyzed.

[0265] The primers for cloning the GmSAL17 promoter region are as follows:

[0266] GmSAL17promoter-F: 5'-TGCATATGTCAAAGAAGAGAGAAGCCGCGTGTTAGAAG-3';

[0267] GmSAL17promoter-R: 5'-CGGTTGGGTATGAATTGAGAGGGAAAGAGATTGAGATGGC-3';

[0268] The primers for GmSAL17 genomic cloning are as follows:

[0269] GmSAL17gDNA-F: 5'–AAACCCCACCATCCAGCCTTGC-3';

[0270] GmSAL17gDNA-R: 5'-CAATTTCAATCCAATCAACC-3'.

[0271] GmSAL17 was divided into three major haplotypes based on SNPs (single nucleotide polymorphism) and Indel (insertion deletion mutation) in the soybean cultivar population (360 soybean varieties purchased from the market) (see Table 2, Figure 7 The difference sites among the three haplotypes are mostly concentrated in the non-coding regions, with a small number of difference sites in the coding regions, but all of them are synonymous mutations, so their expression regulation may be the main factor.

[0272] Table 2

[0273]

[0274]

[0275]

[0276]

[0277]

[0278] 4.2 Obtaining salt tolerance phenotypic data of soybean varieties using the WinRoots system

[0279] Phenotyping experiments were conducted on plants of 360 soybean varieties listed in Table 2.

[0280] (1) Plant material processing.

[0281] Seeds were surface sterilized in 75% ethanol for 3 minutes, rinsed three times with sterile water, and then placed in a humid seed germination chamber at 25°C in the dark for germination. After 48 hours, seedlings with visible radicle elongation of approximately 1 cm were selected, transferred to an incubator, and planted at a depth of 2 cm. The incubator medium consisted of nutrient soil and vermiculite in a 3:1 ratio, mixed with a fixed volume of water or 175 mM NaCl solution. The WinRoots system was placed in a climate chamber. Environmental parameters were set as follows: light / dark = 16 h / 8 h, temperature 25°C, and humidity 75%. Although this system can support the normal growth of soybean seedlings to the V2 stage, in this experiment, seedlings were grown to the V1 stage (~10 days after planting).

[0282] (2) Phenotypic measurements. Primary root length (PRL) and leaf area were measured from RGB images (tiff format) using ImageJ version 1.53a1 software. After imaging the entire seedling on day 9, the shoot and cotyledon of each seedling were harvested and their fresh weights were determined.

[0283] 4.3 Haplotype salt tolerance phenotype analysis

[0284] Haplotype 1, haplotype 2 and haplotype 3 showed significant differences in multiple salt tolerance indicators (Student's t-test) (see Figure 8 NRL, taproot length under salt; NFW, fresh weight under salt. Analysis revealed significant differences in salt tolerance phenotypes among the three haplotypes, demonstrating that the gene GmSAL17 plays a key role in regulating plant salt tolerance. The numbers in parentheses on the horizontal axis represent the number of varieties within each haplotype.

[0285] 4.4 Protein amino acid sequence alignment

[0286] The GmSAL17 protein sequence (SEQ ID NO. 3) was searched and downloaded from Phytozome v13 (https: / / phytozome-next.jgi.doe.gov / ), and the proteins with the highest homology in Arabidopsis and rice were found. Sequence alignment was performed using DNAMAN software.

[0287] Result analysis: The soybean Williams 82 GmSAL17 of the present invention contains a conserved RING domain, which meets the criteria of an E3 ubiquitin ligase. Its highest homology protein in Arabidopsis is At3g12920, and there is also a homologous protein Os03g46570 in rice. However, the comparison results of the homologous proteins showed that the protein has low similarity with the homologous proteins in Arabidopsis and rice (see Figure 9 ).

[0288] It should be noted that the above examples are only intended to illustrate the technical solutions of the present invention and are not intended to limit the same. Although the present invention has been described in detail with reference to the examples given, those skilled in the art may modify or replace the technical solutions of the present invention as needed without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. Use of the GmSAL17 gene or a biological material comprising the GmSAL17 gene in at least one of the following: (a1) Regulation of plant salt tolerance; (a2) improving and breeding plants; The nucleotide sequence of the GmSAL17 gene is selected from: (b1) the nucleotide sequence shown in SEQ ID NO. 1; (b2) a nucleotide sequence that encodes a protein having the same amino acid sequence as the nucleotide sequence of (b1) but differs in sequence due to the degeneracy of the genetic code; (b3) a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (b1) or (b2) and encodes a protein with the same or similar functional properties; (b4) A nucleotide sequence complementary to any one of (b1) to (b3).

2. The use according to claim 1, characterized in that The biological material includes a recombinant expression vector, a transgenic cell line, a host bacterium or a transgenic plant.

3. The use according to claim 2, characterized in that The expression vector is any one or more of a viral vector, a plasmid, a phagemid, a cosmid, or an artificial chromosome; The transgenic cell line is an isolated, in vitro, cultured plant cell or a part of a plant; wherein the plant cell is a cell of any plant selected from Arabidopsis thaliana, soybean, tobacco, corn, rice, and wheat; The host bacteria are eukaryotic or prokaryotic fungi, including bacteria, fungi, and actinomycetes; The transgenic plant is any one of Arabidopsis, soybean, tobacco, corn, rice and wheat.

4. The use according to claim 1, wherein In the above-mentioned (a1), the regulation of plant salt tolerance is specifically manifested as: expressing the soybean E3 ubiquitin ligase gene in Arabidopsis and soybean hairy roots promotes / improves plant salt tolerance, and performing RNAi interference to reduce expression in soybean hairy roots inhibits / reduces plant salt tolerance.

5. The use according to claim 1, characterized in that In the above (a2), improving and cultivating plants specifically refers to improving and cultivating plant varieties with salt tolerance.

6. The use according to claim 1, wherein The plant is Arabidopsis, soybean, tobacco, corn, rice and wheat. Preferably, the plant is soybean.

7. A preparation for improving plant alkaloid tolerance, comprising at least one of the following (c1) to (c4): (c1), an expression vector containing the GmSAL17 gene; (c2), a recombinant host containing (c1); (c3), a promoter or enhancer that enhances the expression of the GmSAL17 gene; (c4), inducers that promote GmSAL17 gene expression; The nucleotide sequence of the GmSAL17 gene is shown in SEQ ID NO.

1.

8. A method for improving plant salt tolerance, characterized in that: The preparation according to claim 7 is used to increase the expression level and / or activity of the plant GmSAL17 gene, or to cause a plant that does not contain the GmSAL17 gene or has an inactivated GmSAL17 gene to express the GmSAL17 protein; the preparation comprises a nucleic acid molecule encoding the GmSAL17 protein; the amino acid sequence of the GmSAL17 protein is shown in SEQ ID NO. 3; and the plant is soybean.

9. A method for improving and cultivating salt-tolerant plants, characterized in that: The method comprises increasing the expression level and / or activity of the GmSAL17 gene in the target plant.

10. A soybean salt tolerance-related GmSAL17 gene haplotype, characterized in that: Contains haplotype 1, haplotype 2, and / or haplotype 3; The haplotype 1 includes at least one of Hap1-1, Hap2-1, and Hap3-1; The haplotype 2 includes at least one of Hap1-1, Hap2-2, and Hap3-2; The haplotype 3 includes at least one of Hap1-2, Hap2-1, and Hap3-2; The Hap1-1 comprises at least two of SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12; The Hap1-2 comprises at least two of the polymorphic forms of SNP1, SNP2, Indel3, SNP4, SNP5, SNP6, Indel7, SNP8, SNP9, SNP10, Indel11, and SNP12; The Hap2-1 comprises at least two of SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24; The Hap2-2 comprises at least two polymorphic forms of SNP13, SNP14, SNP15, SNP16, SNP17, SNP18, SNP19, SNP20, SNP21, Indel22, SNP23, and SNP24; The Hap3-1 comprises at least two of SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38; The Hap3-2 comprises at least two of the polymorphic forms of SNP25, SNP26, Indel27, Indel28, Indel29, SNP30, SNP31, SNP32, SNP33, SNP34, SNP35, SNP36, SNP37, and SNP38.