Compositions and methods for producing heteroglobulins in filamentous fungal cells

Abstract

The present disclosure relates generally to methods and compositions for producing a heterologous globulin of interest in a recombinant filamentous fungal cell. Thus, certain embodiments relate to compositions and methods for the production of globulins, recombinant filamentous fungal strains comprising a globulin productivity enhancing phenotype, polynucleotides (e.g., expression constructs) encoding one or more globulins, industrial scale fermentation, globulin recovery processes, and the like.

Description

TECHNICAL FIELD

[0001] The present disclosure relates generally to the fields of biology, microbiology, molecular biology, filamentous fungi, food proteins, industrial protein production, and the like. Certain embodiments relate to methods and compositions for producing heterologous globular proteins in filamentous fungal strains. As described herein, the recombinant fungal strains of the present disclosure are particularly suited for growth in submerged culture for large-scale production of heterologous globular proteins.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 483,859, filed February 8, 2024, which is incorporated by reference herein in its entirety.

[0004] INCORPORATION BY REFERENCE OF THE SEQUENCE LISTING

[0005] The electronic submission of the sequence listing in the text file named “NB42149-WO-PCT_SequenceListing.xml” was created on January 23, 2024, and is 227 KB in size, which is hereby incorporated by reference in its entirety. BACKGROUND

[0006] As appreciated by those skilled in the relevant art, the industry has continued to shift over the past 10-15 years toward developing and producing plant-based meat alternatives having similar taste and / or aroma characteristics as animal-based meats. In particular, as described in PCT publication WO 2013 / 010042, the animal farming industry has profound negative environmental impacts, with an estimated 30% of the Earth’s land surface dedicated to animal farming, such that livestock comprise over 20% of the total biomass of terrestrial animals. As further described in the WO 2013 / 010042 publication, due to the large scale of animal farming, such practices account for over 18% of the net emissions of greenhouse gases, suggesting that animal farming can be the largest source of water pollution and the greatest threat to the world’s biodiversity. For example, it is estimated that if humans could shift from a meat-containing diet to a diet free of animal products (vegan diet), over 26% of the Earth’s land surface would be freed up for other uses and substantially reduce water and energy consumption.

[0007] In certain aspects, WO 2013 / 010042 discloses speculation about the isolation and purification of one or more plant-based (meat) proteins from genetically modified organisms (e.g., genetically modified bacteria or yeast cells), wherein the one or more plant proteins isolated and purified include hemoglobin, myoglobin, leghemoglobin, non-symbiotic hemoglobin, and the like. For example, leghemoglobin derived from soybeans is a key food additive that imparts meat flavor and color to meat analogs. In particular, the description and experimental examples of WO 2013 / 010042 describe the construction of muscle replicas (compositions), muscle tissue analogs, adipose tissue analogs, and connective tissue analogs, wherein each muscle replica / tissue analog is constructed from one or more plant proteins (hemoglobin, myoglobin, leghemoglobin, and the like) isolated and purified from one or more natural plant sources, i.e., they are not expressed and recovered from genetically modified organisms.

[0008] PCT Publication No. WO 2014 / 110532 describes methods and compositions for modulating the flavor and aroma characteristics of edible food products using so-called "plant-based meat substitutes" having properties similar to animal-based meat compositions, wherein the plant-based meat substitutes contain one or more flavor precursors (e.g., sugars, oils, FFAs, amino acids, nucleotides, vitamins, etc.) and one or more highly conjugated heterocycles (i.e., heme prosthetic groups) complexed with an iron complex. U.S. Patent Publication No. US 2014 / 0161958 describes a meat substitute product comprising plant protein blended with starch, hydrocolloids, and plant-derived oils. U.S. Patent Publication No. US 2021 / 0289813 describes a meat substitute comprising two or more plant protein sources, or a meat substitute comprising one or more plant protein sources and fruit, fruit powder, or chia seed extract, or a hypoallergenic meat substitute that is optionally free of soy and optionally free of other allergenic ingredients.

[0009] In other aspects, attempts have been described to produce certain globular proteins (e.g., leghemoglobin, cyanoglobin) in recombinant microbial host cells (e.g., Escherichia coli, cyanobacteria, yeast). In certain aspects, PCT Publication No. WO 2016 / 183163 generally describes methods for constructing modified methylotrophic yeast cells (Pichia pastoris) for expressing recombinant proteins, wherein the modified yeast (cells) co-express the entire heme biosynthetic pathway using a methanol-inducible promoter. For example, WO 2016 / 183163 discloses the use of a Pichia pastoris strain that overexpresses the transcriptional activator Mxr1 under the control of the alcohol oxidase 1 (AOX1) promoter element to increase expression / co-expression of recombinant proteins and the heme biosynthetic pathway.

[0010] However, as reviewed by Krainer et al. (2015), insufficient heme incorporation is considered a core obstacle to the recombinant production of active heme proteins. In particular, Krainer et al.

[2015] investigated the role of both pathway engineering and culture medium supplementation to optimize the recombinant production of the heme protein horseradish peroxidase (HRP) in Pichia pastoris. In contrast to other studies, as summarized by Krainer et al. (2015), (a) co-overexpression of endogenous heme biosynthesis pathway genes in Pichia pastoris did not improve recombinant production of active heme (HRP) enzyme, (b) supplementation of the culture medium with the commonly used precursor 5-aminolevulinic acid (ALA) did not affect the yield of active heme (HRP) enzyme, whereas (c) supplementation of the culture medium with hemin increased the yield of active heme (HRP) enzyme, and they concluded that the yield of active peroxidase in Pichia pastoris can be easily improved by supplementing the culture medium with hemin.

[0011] PCT Publication No. WO 2019 / 079135 generally describes non-animal-derived meat-like materials / ingredients obtained from genetically modified cyanobacteria, which contain polynucleotides encoding heterologous globulins (e.g., leghemoglobin, cyanoglobin). PCT Publication No. WO 2023 / 278968 describes non-heme iron-binding protein pigment compositions for meat substitutes that provide a pink and / or red color to the meat substitute composition.

[0012] Despite the current knowledge related to globulins, their production and / or uses and applications, there continues to be unmet needs in the art. In particular, due to the growing demand for plant-based meat substitutes, plant-based (meat) proteins, meat-like products of non-animal origin, etc., there continues to be an unmet need in the art for an enhanced globulin (protein) expression system suitable for cost-effective, large-scale production of globulins. Summary of the Invention

[0013] As described below, the present disclosure addresses ongoing unmet needs in the art related to the production of heterologous globulins. More particularly, as illustrated and described herein, one or more embodiments of the present disclosure provide, inter alia, novel methods and compositions for producing globulins, recombinant filamentous fungal strains having an enhanced globulin productivity phenotype, polynucleotides encoding globulins (e.g., expression cassettes), polynucleotide (linker DNA) sequences encoding protein / amino acid cleavage sites, and industrial-scale fermentation processes. Thus, one or more embodiments relate to recombinant filamentous fungal cells capable of producing heterologous globulins, particularly for use in food materials, food ingredients, flavor modifiers, aroma modifiers, and the like.

[0014] In certain embodiments, the present disclosure relates to recombinant filamentous fungal cells that express heterologous globulins. In related embodiments, the present disclosure provides recombinant filamentous fungal cells that express heterologous globulins and secrete the heterologous globulins into the fermentation broth when fermented under suitable conditions. In one or more other embodiments, the recombinant filamentous fungal cells comprise an introduced expression cassette encoding the globulin.

[0015] In certain embodiments, the expression cassette comprises at least one upstream promoter (pro) sequence operably linked to a downstream nucleic acid encoding a protein (signal) secretion sequence (sig-seq), which is operably linked to a downstream (3') nucleic acid encoding the globulin (e.g., 5'-[pro]-[sig-seq]-[globulin CDS]). In other related embodiments, the nucleic acid encoding the globulin (globulin CDS) may comprise an upstream nucleic acid encoding an N-terminal protein fusion (N-fusion) and / or an upstream nucleic acid encoding an N-terminal protein cleavage site (N-linker) and / or a downstream nucleic acid encoding a C-terminal protein fusion (C-fusion) and / or a downstream nucleic acid encoding a C-terminal protein cleavage site (C-linker) and / or an upstream nucleic acid encoding an N-terminal protein fusion (N-fusion) and / or a downstream nucleic acid encoding a C-terminal protein cleavage site (C-linker) and / or an upstream nucleic acid encoding an N-terminal protein fusion (N-fusion) and / or a downstream nucleic acid encoding a C-terminal protein fusion (C-fusion), and combinations thereof.

[0016] In certain other embodiments, one or more expression cassettes are integrated into the genome of the cell. In other embodiments, the recombinant filamentous fungal cells contain one or more introduced expression cassettes encoding one or more protease inhibitor proteins. In other embodiments, the recombinant fungal cells are fermented for at least about 96 hours to about 300 hours to produce globulins. In related embodiments, the recombinant fungal cells are fermented for at least about 96 hours to about 300 hours and produce at least 0.1, 0.2, 0.3, 0.4, or 0.5 grams of globulins per liter of fermentation broth (g / L). In certain other embodiments, the recombinant fungal cells are fermented for about 180-190 hours and produce at least 1.0 grams of globulins per liter of fermentation broth (g / L). In related embodiments, the globulins produced are selected from the group consisting of leghemoglobin, myoglobin, hemoglobin, cyanoglobin, and non-symbiotic hemoglobin.

[0017] In other embodiments, the present disclosure provides methods for producing a heterologous globulin in a filamentous fungal cell. In certain embodiments, these methods include, but are not limited to, introducing an expression cassette encoding a globulin into the filamentous fungal cell, wherein the cassette comprises at least one upstream promoter (pro) sequence operably linked to a downstream nucleic acid (sig-seq) encoding a protein (signal) secretion sequence, which is operably linked to a downstream (3') nucleic acid (globulin CDS) encoding the globulin; and fermenting the modified cell under conditions suitable for producing the globulin. In certain embodiments of these methods, the filamentous fungal cell is selected from the group consisting of Acremonium sp. cells, Aspergillus sp. cells, Emericella sp. cells, Fusarium sp. cells, Humicola sp. cells, Mucor sp. cells, Myceliophthora sp. cells, Neurospora sp. cells, Penicillium sp. cells, Scytalidium sp. cells, Talaromyces sp. cells, Thielavia sp. cells, Tolypocladium sp. cells, and Trichoderma sp. cells. In other embodiments of these methods, one or more expression cassettes encoding a globulin are integrated into the genome of the cell. In other embodiments of these methods, the fungal cell comprises one introduced expression cassette encoding at least two globulins, and / or comprises at least two introduced expression cassettes encoding at least two globulins. In certain preferred embodiments of these methods, the recombinant fungal cell comprises an introduced expression cassette encoding a protease inhibitor. In yet other embodiments of these methods, the recombinant fungal cell is fermented for at least about 96 hours to about 300 hours and produces at least 0.1, 0.2, 0.3, 0.4, or 0.5 grams of globulin per liter of fermentation broth (g / L). In certain other embodiments, the fungal cell is fermented for about 180-190 hours and produces at least 1 gram of globulin per liter of fermentation broth (g / L). In yet other embodiments of these methods, the expressed globulin is secreted and recovered from the fermentation broth, wherein the recovered globulin is optionally purified.Thus, in certain other embodiments of these methods, the secreted globin is selected from the group consisting of leghemoglobin, myoglobin, hemoglobin, cyanoglobin, and non-symbiotic hemoglobin. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 DNA sequences encoding exemplary globins are shown. In particular, Figure 1 Amino acid sequences of native soybean leghemoglobin encoded by the DNA of SEQ ID NO: 2 (SEQ ID NO: 1), native bovine myoglobin encoded by the DNA of SEQ ID NO: 4 (SEQ ID NO: 3), and native French bean leghemoglobin encoded by the DNA of SEQ ID NO: 19 (SEQ ID NO: 18) are presented.

[0019] Figure 2 Amino acid sequences of native BASI protein (SEQ ID NO: 5), codon-optimized DNA sequence encoding native BASI protein (SEQ ID NO: 6), Cbh1 core domain protein containing a seventeen (17) amino acid signal peptide at the N-terminus (SEQ ID NO: 7), and full-length Cbh1 protein containing a 17 amino acid signal peptide at the N-terminus (SEQ ID NO: 9) are presented.

[0020] Figure 3 Centrifuged culture broths harvested at twenty-four (24) hour intervals in a fed-batch fermentation of Trichoderma reesei strain BFZ28 expressing / producing soybean leghemoglobin by secretion are shown. As shown in Figure 3 Fermentation broth samples were collected at 21 hours, 48 hours, 67 hours, 91 hours, 120 hours, 143 hours, 167 hours, and 188 hours after the start of the fermentation run, as shown in

[0021] Figure 4 Total secreted protein titers in a fermentation run of strain BFZ28 are shown (see, e.g., Figure 3 ). Titers represent total soluble protein present in the culture supernatant, including CBH1 core domain protein, soybean leghemoglobin, and other background proteins secreted by the T. reesei host strain.

[0022] Figure 5 SDS-PAGE analysis of a fermentation run of the BFZ28 strain is shown, with molecular weight markers (kDa) shown on the left side of the gel, and band-labeled Cbh1 core protein, leghemoglobin / BASI protease inhibitor shown on the right side of the gel. More particularly, as shown in Figure 5As presented in , CBH1 core protein has an approximate molecular weight (Mw) of about 49 kDa, leghemoglobin has an approximate Mw of about 15.5 kDa, and BASI protease inhibitor has an approximate Mw of about 20 kDa.

[0023] Figure 6 HPLC analysis of a supernatant sample from a 188-hour fermentation run with strain BFZ28 is shown. In particular, the heme group of leghemoglobin (heme prosthetic group) is detected at a wavelength of 410 nm, co-migrating with a protein peak detected at 280 nm with a retention time of 6.4 minutes. Inset ( Figure 6 ) shows a spectrum scan of leghemoglobin, with a peak at a retention time of approximately 6.4 minutes (wavelength 410 nm), confirming the peak absorbance of heme-containing leghemoglobin at 410 nm.

[0024] Figure 7 Shown are the total secreted protein titers from fermentation runs for strains BFZ28 (Pcbh1-CBH1 core-KEX2-LegGm1b), BGJ74 (Pcbh1-LegGm1b, Pcbh2-BASI), BGJ75 (Pcbh1-Pv1b, Pcbh2-BASI), and BGJ76 (Pcbh1-LegGm1b.Pep1ss, Pcbh2-BASI). Titers represent the total soluble protein present in the culture supernatant, including CBH1 core domain proteins (in BFZ28), BASI proteins (in BGJ74, BGJ75, and BGJ76), soy leghemoglobin (in BFZ28, BGJ74, BGJ75, and BGJ76), and other background proteins secreted by the T. reesei host strain.

[0025] Figure 8 SDS-PAGE analysis of fermentation runs of strains BGJ74, BGJ75, and BGJ76 is shown. Figure 8 As shown in FIG, red arrows indicate BASI and leghemoglobin bands that co-migrated at approximately 20 kDa.

[0026] Figure 9 Shown is a chromatogram of an HPLC analysis of a 188 hour supernatant sample at the end of a 188 hour fermentation run from strains BGJ74, BGJ75, and BGJ76. Figure 9 As shown in Figure 2, the protein peak was detected at 280 nm. Figure 9 In the ELISA, the heme prosthetic group of leghemoglobin was detected at 410 nm, co-migrating with the protein peak detected at 280 nm with a retention time of 6.4 minutes.

[0027] Figure 10 SDS-PAGE gel analysis of fermentation runs of strain BHX46 is shown. The first sample lane (labeled "C") contains horse myoglobin. Subsequent lanes contain culture supernatant samples harvested at 43 h, 72 h, 94 h, 114 h, 137 h, 161 h, and 186 h.

[0028] Biological sequence summary

[0029] SEQ ID NO: 1 is the amino acid sequence of native soybean (Glycine max) leghemoglobin (NCBI Accession No. NP_001235248).

[0030] SEQ ID NO: 2 is the nucleic acid (DNA) sequence encoding the native leghemoglobin of SEQ ID NO: 1, wherein SEQ ID NO: 2 has been codon-optimized for expression in Trichoderma reesei fungal cells.

[0031] SEQ ID NO: 3 is the amino acid sequence of native Bos taurus (cattle) myoglobin (NCBI Accession No. NP_776306.1; GI: 27806939).

[0032] SEQ ID NO: 4 is the DNA sequence encoding the native myoglobin of SEQ ID NO: 3, wherein SEQ ID NO: 4 has been codon-optimized for expression in Trichoderma reesei fungal cells.

[0033] SEQ ID NO: 5 is the amino acid sequence of native barley amylase / subtilisin inhibitor (BASI) protein (NCBI Accession No. 1210227A).

[0034] SEQ ID NO: 6 is the DNA sequence encoding the native BASI protein of SEQ ID NO: 5, wherein SEQ ID NO: 6 has been codon-optimized for expression in Trichoderma reesei fungal cells.

[0035] SEQ ID NO: 7 is the amino acid sequence of a Cbh1 core domain protein.

[0036] SEQ ID NO: 8 is the DNA sequence encoding a Cbh1 core domain.

[0037] SEQ ID NO: 9 is the amino acid sequence of native (full-length) Cbh1 protein (NCBI Accession No. A0A024RXP8).

[0038] SEQ ID NO: 10 is a DNA sequence encoding the full-length Cbh1 protein.

[0039] SEQ ID NO: 11 is the cbh1 promoter region (DNA) sequence of the Trichoderma reesei chb1 gene.

[0040] SEQ ID NO: 12 is the cbh2 promoter region (DNA) sequence of the Trichoderma reesei chb2 gene.

[0041] SEQ ID NO: 13 is a DNA sequence encoding the Cbh1 signal peptide sequence.

[0042] SEQ ID NO: 14 is a DNA sequence encoding the signal peptide sequence of the Pep1 protein.

[0043] SEQ ID NO: 15 is the terminator (DNA) sequence of the cbh1 gene.

[0044] SEQ ID NO: 16 is the Trichoderma reesei pyr2 gene encoding orotate phosphoribosyltransferase (marker).

[0045] SEQ ID NO: 17 is a DNA sequence encoding Aspergillus nidulans acetamidase.

[0046] SEQ ID NO: 18 is a DNA sequence encoding a Kex2 protease cleavage site.

[0047] SEQ ID NO: 19 is the amino acid sequence of native French bean ( Phaseolus vulgaris ) leghemoglobin (NCBI Accession No.: AAA33767.1).

[0048] SEQ ID NO: 20 is a DNA sequence encoding the native leghemoglobin of SEQ ID NO: 19, wherein SEQ ID NO: 20 has been codon-optimized for expression in Trichoderma reesei fungal cells.

[0049] SEQ ID NO: 21 is the sequence of a synthetic DNA primer designated OT4268.

[0050] SEQ ID NO: 22 is the sequence of a synthetic DNA primer designated OT4269.

[0051] SEQ ID NO: 23 is the sequence of a synthetic DNA primer designated OT4337.

[0052] SEQ ID NO: 24 is the sequence of a synthetic DNA primer designated OT4338.

[0053] SEQ ID NO: 25 is the sequence of a synthetic DNA primer designated OT4333.

[0054] SEQ ID NO: 26 is the sequence of a synthetic DNA primer designated OT4334.

[0055] SEQ ID NO: 27 is an integration cassette designated HG1.

[0056] SEQ ID NO: 28 is an integration cassette designated HG2.

[0057] SEQ ID NO: 29 is an integration cassette designated HG3.

[0058] SEQ ID NO: 30 is an integration cassette designated HG4.

[0059] SEQ ID NO: 31 is an integration cassette designated HG5.

[0060] SEQ ID NO: 32 is the integration cassette designated HG6.

[0061] SEQ ID NO: 33 is the integration cassette designated HG7.

[0062] SEQ ID NO: 34 is an integration cassette designated HG8.

[0063] SEQ ID NO: 35 is the integration cassette designated HG9.

[0064] SEQ ID NO: 36 is a synthetic cassette designated pCHL853.

[0065] SEQ ID NO: 37 is a synthetic cassette designated pCHL856.

[0066] SEQ ID NO: 38 is a synthetic cassette designated pLH1088.

[0067] SEQ ID NO: 39 is a synthetic cassette designated pLH1104.

[0068] SEQ ID NO: 40 is a synthetic cassette designated pLH1105.

[0069] SEQ ID NO: 41 is a synthetic cassette designated pLH1106.

[0070] SEQ ID NO: 42 is a synthetic cassette designated pLH1107.

[0071] SEQ ID NO: 43 is a synthetic cassette designated pLH1108.

[0072] SEQ ID NO: 44 is a synthetic cassette entitled pLH1109.

[0073] SEQ ID NO: 45 is a synthetic single guide RNA entitled "sgRNA-TrC144F".

[0074] SEQ ID NO: 46 is a synthetic DNA sequence comprising a TrpC transcriptional terminator sequence.

[0075] SEQ ID NO: 47 is a synthetic cassette entitled pCHL852.

[0076] SEQ ID NO: 48 is an integration cassette entitled HG10.

[0077] SEQ ID NO: 49 is a second codon-optimized bovine myoglobin gene (Mblc) encoding the same bovine myoglobin of SEQ ID NO: 3.

[0078] SEQ ID NO: 50 is a synthetic DNA comprising a Trichoderma reesei Egl1 terminator (Tegl1).

[0079] SEQ ID NO: 51 is a tandem copy expression vector entitled "pLHX143". DETAILED DESCRIPTION

[0080] As described herein, certain embodiments of the present disclosure provide, inter alia, compositions and methods for producing globulins, recombinant filamentous fungal strains comprising a globulin productivity enhancing phenotype, polynucleotides (e.g., expression constructs) encoding one or more globulins, industrial scale fermentation and globulin recovery processes, and the like. Thus, in one or more embodiments or aspects, the present disclosure relates to recombinant (modified) filamentous fungal cells capable of producing a heterologous globulin. In certain embodiments or aspects, the recombinant filamentous fungal cell comprises an introduced expression cassette encoding one or more heterologous globulin of interest. In certain embodiments, the cassette(s) comprises an upstream (5') promoter (pro) region sequence operably linked to a downstream nucleic acid (sig-seq) encoding a protein secretion (signal) sequence operably linked to a downstream (3') nucleic acid (globulin CDS) encoding a globulin. In other one or more embodiments or aspects, the recombinant filamentous fungal cell comprising the introduced cassette(s) is fermented under conditions suitable for production of the globulin. In certain other embodiments, the secreted globulin is recovered from the end of fermentation (EOF) broth. More particularly, as set forth and described herein below, the recombinant fungal strains of the present disclosure are particularly suitable for growth in a deep culture for large scale production of a heterologous globulin.

[0081] I. DEFINITIONS

[0082] Before the strains and methods of the present application are described in detail, the following terminology is defined for the sake of clarity. Undefined terms shall have their ordinary meaning as used within the relevant art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the compositions and methods of the present application apply.

[0083] All publications and patents cited in this specification are herein incorporated by reference.

[0084] Where a series of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower magnitude, between the upper and lower limit, and any other stated or intervening value in that stated range is encompassed within the scope of the compositions and methods of the present application. These smaller ranges are also encompassed within the application, as are sub-ranges falling between any of the minimum's and maximum's stated ranges and sub-ranges falling between any stated values. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the application.

[0085] Certain ranges are presented herein with numerical values having a term "about" preceding the numerical value. The term "about" is used herein to provide literal support for the exact number that it precedes, as well as a number that is close to the number that it precedes when used in connection with a numerical value. When used with a numerical value, the term "about" is understood to mean that the value of the followable numerical parameter is within 10% of the recited value. For example, if a parameter is "about 10," it can mean that the parameter is from 9 to 11. - 10% to + 10%, unless the term is otherwise expressly defined herein. In another example, the phrase "a pH of about 6" means a pH from 5.4 to 6.6, unless the pH is otherwise expressly defined.

[0086] The headings provided herein are not limitations of the aspects and embodiments of the invention, which can be had by reference to the specification as a whole. Accordingly, the terms defined herein are to be construed in light of this entire description.

[0087] The following abbreviations and definitions apply according to this DETAILED DESCRIPTION. It should be noted that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" includes a single enzyme or multiple enzymes, and reference to "a dose" includes reference to one or more doses and equivalents thereof and the like.

[0088] It should be further noted that the claims can be drafted to exclude any optional element. Thus, this statement is intended to serve as antecedent basis for the use of exclusive terminology to

[0089] It should be further noted that, as used herein, the term "comprising" means "including but not limited to" one or more components so that when a composition is referred to as comprising a component, the composition can also include other components in addition to the component.

[0090] It should also be noted that, as used herein, the term "consisting of means "including and limited to" one or more components so that when a composition is referred to as consisting of a component, the composition cannot include other components.

[0091] As will be apparent to those of ordinary skill in the art in the context of the present disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated from those of another without departing from the scope or spirit of the compositions and methods of the present disclosure described herein. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0092] As used herein, the terms "wild type" and "native" are used interchangeably and refer to a gene, protein, fungal cell, or strain that is naturally found.

[0093] As used herein, the term "recombinant" or "non-native" refers to an organism, microorganism, cell, nucleic acid molecule, or vector that has at least one engineered genetic alteration or has been modified by the introduction of a heterologous nucleic acid molecule, or to a cell (e.g., a microbial cell) that has been altered such that expression of a heterologous or endogenous nucleic acid molecule or gene can be controlled. Recombinant also refers to a cell that is descended from a non-native cell, or is a non-native cell that has one or more such modifications. Genetic alterations include, for example, modifications that introduce expressible nucleic acid molecules that encode proteins, or other nucleic acid molecule additions, deletions, substitutions, or other functional alterations of a cell's genetic material. For example, a recombinant cell can express a gene or other nucleic acid molecule of the same or homologous form that is not found within a native (wild type) cell, or can provide an altered expression pattern of an endogenous gene, such as overexpression, underexpression, minimal expression, or no expression at all.

[0094] "Recombination" or generating a "recombined" nucleic acid is generally the assembly of two or more nucleic acid fragments, wherein the assembly results in a chimeric gene.

[0095] As used herein, the term "gene" is synonymous with the term "allele" and refers to a nucleic acid that encodes and directs expression of a protein or RNA. The vegetative form of filamentous fungi is generally haploid, so a single copy of a specified gene (i.e., a single allele) is sufficient to confer a specified phenotype.

[0096] As used herein, the term "gene" means a segment of DNA involved in the production of a polypeptide (protein) chain, which can or can not include regions before and after the coding region (e.g., 5' untranslated regions (5' UTRs) or "leader" sequences, 3' UTRs or "trailer" sequences, promoter sequences, terminator sequences, etc.), as well as intervening sequences (introns) between individual coding segments (exons). For example, a gene of interest (DNA) sequence (GOI) can encode a globin protein, a structural protein, a commercially important industrial protein or peptide, such as an enzyme (e.g., a protease, a mannanase, a xylanase, an amylase, a glucoamylase, a cellulase, an oxidase, a phytase, a lipase), etc. The gene of interest can be a naturally occurring gene, a mutated (modified) gene, or a synthetic gene.

[0097] As used herein, the term "promoter" refers to a nucleic acid sequence that serves to direct transcription of a downstream gene or open reading frame (ORF). The promoter will generally be appropriate for the host cell (e.g., a filamentous fungal cell) in which the target gene is being expressed. Promoters are necessary for expression of a given gene along with other transcriptional and translational modulating nucleic acid sequences (also termed "control sequences"). Generally speaking, transcriptional and translational modulating sequences include, but are not limited to, promoter and terminator sequences, including core promoters and enhancer or activator or repressor sequences, transcriptional and translational start and stop sequences. In certain embodiments, the promoter is an inducible promoter or a constitutive promoter. In certain embodiments, the inducible promoter is an inducible cellulase gene promoter.

[0098] As used herein, the term "promoter activity" is the ability of a nucleic acid to direct transcription of a downstream (3') polynucleotide in a host cell. To test promoter activity, the (promoter) nucleic acid can be operably linked to a downstream polynucleotide to produce a recombinant nucleic acid. The recombinant nucleic acid can be introduced into a cell, and transcription of the polynucleotide can be assessed. In certain cases, the polynucleotide can encode a protein, and transcription of the polynucleotide can be assessed by evaluating production of the protein in the cell.

[0099] As used herein, the term "operably linked" refers to functional linkage between two or more nucleic acid sequences. Thus, a nucleic acid sequence is "operably linked" when it is in a functional relationship with another nucleic acid sequence. For instance, a promoter sequence or a terminator sequence is operably linked to a coding sequence if it affects the transcription of the coding sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned to facilitate translation; a nucleic acid sequence encoding a secretory leader sequence (i.e., signal peptide) is operably linked to a nucleic acid sequence encoding a polypeptide (e.g., ORF) if it is expressed as a preprotein involved in the secretion of the polypeptide. Generally, "operably linked" means that the DNA (nucleic acid) sequences being linked are contiguous and, in the case of a secretory leader, contiguous and in reading phase. Enhancers need not be contiguous. Linking two or more nucleic acid sequences (i.e., operably linking) is accomplished using any method of those skilled in the art.

[0100] As used herein, a "functional gene" is a gene that is capable of being used by cellular components to produce an active gene product (typically a protein). In contrast, a "non-functional gene" is either incapable of being used by cellular components to produce an active gene product (i.e., a functional protein), or has a reduced ability to be used by cellular components to produce an active gene product (i.e., a functional protein).

[0101] As used herein, a "functional protein" is a protein that has a function or activity (such as an enzymatic function / activity, a binding function / activity (e.g., DNA binding), surface active properties, etc.), and which has not been mutagenized, truncated, or otherwise modified to eliminate or reduce the function / activity.

[0102] As used herein, the phrases "one or more modified filamentous fungal cell," "one or more mutant or variant filamentous fungal cell," "one or more recombinant fungal cell," "one or more modified filamentous fungal strain," and the like are used interchangeably and refer to a filamentous fungal cell that is derived from (obtained from) a control or parental filamentous fungal cell that belongs to the Pezizomycotina subphylum. For example, a "modified" filamentous fungal cell can be derived from (obtained from) a control or parental filamentous fungal cell, wherein the modified cell comprises at least one genetic modification that is not found in the control or parental cell.

[0103] As used herein, the term "Ascomycete fungal cell" refers to any organism in the phylum Ascomycota in the kingdom Fungi. Examples of Ascomycete fungal cells include, but are not limited to, filamentous fungi of the Pezizomycotina subphylum, such as Trichoderma species, Aspergillus species, Myceliopthora species, and Penicillium species.

[0104] As used herein, the term "filamentous fungus" refers to all filamentous forms of the subphylum Eumycotina and Oomycotina. For example, filamentous fungi include, but are not limited to, an Acremonium, Aspergillus, Emericella, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Scytalidium, Talaromyces, Thielavia, Tolypocladium, or Trichoderma species. In some embodiments, the filamentous fungus can be Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae.

[0105] In some embodiments, the filamentous fungus is a Fusarium species, such as Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, and the like. In other embodiments, the filamentous fungus is Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Scytalidium thermophilum, Thielavia terrestris, and the like. In certain other embodiments, the filamentous fungus is Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, Trichoderma viride, and the like.

[0106] As used herein, exemplary parent Trichoderma reesei strains include, but are not limited to, Trichoderma reesei strain QM6a (ATCC Accession No. 13631), Trichoderma reesei strain RL-P37 (NRRL Accession No. 15709), and Trichoderma reesei strain RUT-C30 (ATCC Accession No. 56765); exemplary parent Aspergillus niger strains include, but are not limited to, the Aspergillus niger strain designated as ATCC Accession No. 1015; exemplary parent Aspergillus oryzae strains include, but are not limited to, Aspergillus oryzae strain RIB40 (ATCC Accession No. 42149); and exemplary parent Myceliophthora thermophila strains include, but are not limited to, the Myceliophthora thermophila strain designated as ATCC Accession No. 42464. For example, Trichoderma strains RUT-C30 and RL-P37 are mutagenized (cellulase-producing) derivatives of the natural Trichoderma isolate QM6a (Sheir-Neiss and Montenecourt, 1984), with strain NG14 being the final common parent strain. In certain aspects, suitable Trichoderma strains can be derived from / obtained from a Trichoderma reesei strain comprising a deletion of the Trichoderma reesei pyr2 gene (Δpyr2), as generally described in Sheir-Neiss and Montenecourt (1984) and PCT Publication No. WO2011 / 153449 (specifically incorporated herein by reference in its entirety). In certain embodiments, the Trichoderma reesei cells / strains disclosed herein are obtained from / derived from Trichoderma reesei strain RL-P37. Thus, in certain embodiments, Trichoderma reesei cells derived from strain RL-P37 are abbreviated herein as "Tr1 cells," "Tr1 strains," "Tr1 parent" cells, "Tr1 control" cells, etc.

[0107] As used herein, the phrases "lignocellulose degrading enzyme," "cellulase," and / or "cellulase" are used interchangeably and include glycoside hydrolases (GHs), such as cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases, which hydrolyze the β-(1,4)-linked glycosidic bonds of cellulose (hemicellulose) to produce glucose.

[0108] In certain embodiments, cellobiohydrolases include enzymes classified under Enzyme Commission Number (EC 3.2.1.91), endoglucanases include enzymes classified under EC 3.2.1.4, endo-β-1,4-xylanases include enzymes classified under EC 3.2.1.8, β-xylosidases include enzymes classified under EC 3.2.1.37, and β-glucosidases include enzymes classified under EC 3.2.1.21.

[0109] As used herein, “endoglucanase” proteins can be abbreviated as “EG”, “cellobiohydrolase” proteins can be abbreviated as “CBH”, “beta-glucosidase” proteins can be abbreviated as “BG”, and “xylanase” proteins can be abbreviated as “XYL”. Thus, as used herein, a gene (gene CDS or ORF) encoding an EG protein can be abbreviated as “eg”, a gene (or ORF) encoding a CBH protein can be abbreviated as “cbh”, a gene (or ORF) encoding a BG protein can be abbreviated as “bg”, and a gene (or ORF) encoding an XYL protein can be abbreviated as “xyl”.

[0110] As used herein, “globin” or “globin protein” is a metalloprotein that comprises a “porphyrin prosthetic group”. In particular, globins incorporate a series of alpha-helical segments called globin folds that house / bind the porphyrin prosthetic group. Globins include, but are not limited to, “leghemoglobin”, “myoglobin”, and “hemoglobin”. In certain aspects, the porphyrin prosthetic group imparts functionality to the globin that can include carrying or transporting oxygen, oxygen reduction, electron transfer, and other processes.

[0111] As used herein, the term “porphyrin” has the same meaning as understood in the art, wherein porphyrins are a group of heterocyclic macrocyclic organic compounds composed of four modified pyrrole subunits interconnected at their alpha carbon atoms by methine bridges. In particular, porphyrins (ring structures) are often described as highly conjugated aromatic compounds that strongly absorb electromagnetic radiation in the visible region of the spectrum. For example, with the displacement of two (2) N-H protons, porphyrins bind a metal ion in an N4pocket, wherein the metal ion typically has a charge of 2 + or 3 + . In particular, when the nitrogen in the center of the ring (structure) is not bonded to a metal ion (or atom), these compounds are referred to as “free porphyrins”, whereas if the nitrogen in the center of the ring (structure) is bonded to a metal ion (or atom), they are referred to as “bound porphyrins”. Examples of porphyrins bound to iron atoms include, but are not limited to, myoglobin and hemoglobin. In particular, one of the most famous families of porphyrin complexes is hematin.

[0112] As used herein, the term “hemin” refers to a porphyrin (protoporphyrin IX) that comprises a trivalent iron (Fe 3+ ) ion with coordinating chloride ligands.

[0113] As used herein, phrases such as "retains globin function or activity," "comprises globin function or activity," and the like mean that the heme (porphyrin) is bound to the heme (porphyrin) binding pocket of the globin, which is in a penta-coordinated state for some globins (e.g., leghemoglobin) or a hexa-coordinated state for other globins (e.g., cyanoglobin). Thus, in certain embodiment(s) or aspect(s) of the disclosure, functional globin can be determined and detected based on the bound heme (porphyrin) prosthetic group, which can be measured / detected based on the UV-Vis absorbance of the porphyrin molecule. For example, the bound heme set forth in the present example has a characteristic UV-Vis absorption peak at 410 nm.

[0114] As used herein, "native soybean leghemoglobin" has at least about 90% to 100% identity to the native soybean leghemoglobin of SEQ ID NO: 1. In certain embodiments, the native soybean leghemoglobin has at least about 90% to 100% identity to the native soybean leghemoglobin of SEQ ID NO: 1 and retains (comprises) native leghemoglobin function or activity.

[0115] As used herein, a "gene coding sequence (CDS)" encoding native soybean leghemoglobin encodes a leghemoglobin having at least about 40% to 100% identity to the native protein of SEQ ID NO: 1. In certain embodiment(s), the gene CDS encoding native soybean leghemoglobin has at least about 90% to 100% identity to SEQ ID NO: 1 and retains native leghemoglobin function or activity. In certain embodiments, the wild type (WT) soybean leghemoglobin C2 gene CDS of the disclosure is abbreviated as "LegGmlb," wherein the WT LegGmlb gene CDS has been codon-optimized for expression in Trichoderma reesei cells, as set forth in SEQ ID NO: 2.

[0116] As used herein, “native French bean leghemoglobin” has at least about 90-100% identity to the native leghemoglobin of Phaseolus vulgaris (French bean) of SEQ ID NO: 19. In certain embodiments, the native French bean leghemoglobin has at least about 90-100% identity to the native French bean leghemoglobin of SEQ ID NO: 19 and comprises a native leghemoglobin function or activity. In certain embodiments, the WT French bean leghemoglobin gene CDS of the present disclosure is abbreviated as “LegPv,” wherein the WT LegPv gene CDS has been codon-optimized for expression in Trichoderma reesei cells, as set forth in SEQ ID NO: 20. In other embodiments, the gene CDS encoding native French bean leghemoglobin encodes a leghemoglobin having at least about 40-100% identity to the native protein of SEQ ID NO: 19.

[0117] As used herein, “native bovine (Bos taurus) myoglobin” has at least about 80-100% identity to the native myoglobin of SEQ ID NO: 3. In certain embodiments, the native myoglobin has at least about 80-100% identity to the native myoglobin of SEQ ID NO: 3 and retains (comprises) a native myoglobin function or activity. In certain one or more embodiments, the gene CDS encoding native myoglobin encodes a myoglobin having at least about 80-100% identity to the wild-type protein of SEQ ID NO: 3. In certain one or more embodiments, the gene CDS encoding native myoglobin has at least about 80-100% identity to the native myoglobin of SEQ ID NO: 3 and retains (comprises) a native myoglobin function or activity. In certain aspects, the WT myoglobin gene CDS is abbreviated as “Mb1b,” wherein the WT Mb1b gene CDS has been codon-optimized for expression in Trichoderma reesei cells, as set forth in SEQ ID NO: 4. In certain other embodiments, the gene CDS encoding native bovine myoglobin encodes a myoglobin having at least about 40-100% identity to the native protein of SEQ ID NO: 3. In certain other embodiments, the gene CDS encoding native bovine myoglobin encodes a myoglobin having at least about 40-100% identity to the native protein of SEQ ID NO: 3.

[0118] As used herein, phrases such as "protease inhibitor protein," "protein protease inhibitor," or "proteinase inhibitor" can be used interchangeably, where a protease inhibitor protein can be any peptide or protein that reversibly inhibits the protease in question. According to the MEROPS database (www.ebi.ac.uk / merops / ) which is a repository of proteases / peptidases and proteins that inhibit these proteolytic / peptidolytic enzymes, protease inhibitors can be classified into 38 clans and subdivided into 78 families. In certain embodiments, protease inhibitors include, but are not limited to, trypsin inhibitor proteins and subtilisin inhibitor proteins. Examples are trypsin inhibitors and subtilisin inhibitors known in the art, such as generally described in Laskowski and Kato (1980), Strickler et al., (1992), PCT Publication No. WO 1992 / 03529, and the like. In certain embodiments, exemplary protease inhibitors are trypsin inhibitors of family IV and subtilisin inhibitors of families III, VI, and VII. Examples include, but are not limited to, native Streptomyces subtilisin inhibitor (SSI) and functional variants thereof, native Streptomyces antiplasminostreptin inhibitor and functional variants thereof, native barley subtilisin inhibitor (BASI) and functional variants thereof, native potato subtilisin inhibitor and functional variants thereof, native tomato subtilisin inhibitor and functional variants thereof, native eglin C inhibitor and functional variants thereof, native Vicia faba subtilisin inhibitor and functional variants thereof, native leupeptin inhibitor and functional variants thereof, native soybean trypsin inhibitor and functional variants thereof, native pea aspartic protease inhibitor and functional variants thereof, serine protease inhibitors such as Bowman-Birk inhibitor (BBI) and functional variants thereof, native serpin inhibitor and functional variants thereof, native phytocystatin inhibitor and functional variants thereof, native Kunitz-type inhibitor (KTI) and functional variants thereof, bifunctional alpha-amylase-trypsin inhibitor and functional variants thereof, mustard-type inhibitor, potato metallo-carboxypeptidase inhibitor and functional variants thereof, native squash-type inhibitor and functional variants thereof, native cyclic peptide inhibitor and functional variants thereof, and the like.

[0119] As used herein, a "gene encoding a native barley amylase subtilisin (protease) inhibitor protein" has at least about 90% to 100% identity to the wild-type BASI gene set forth in SEQ ID NO: 6. In certain aspects, the wild-type barley amylase subtilisin (protease) inhibitor gene is abbreviated as "BASI" (italics). In certain one or more embodiments or aspects of the present disclosure, the wild-type BASI gene has been codon-optimized for expression in a Trichoderma strain.

[0120] As used herein, a "native barley amylase subtilisin (protease) inhibitor" protein (abbreviated herein as a "BASI" protein) comprises protease inhibitor activity and has at least about 90% to 100% identity to the native BASI protein of SEQ ID NO: 6. For example, one or more variant BASI proteins can be derived from the native BASI protein (SEQ ID NO: 6), wherein the native or variant BASI protein is particularly suitable for reducing / mitigating certain undesirable protease activities as described herein.

[0121] As used herein, the modified Trichoderma reesei strain designated "BFZ28" is derived from the Tr1 parent strain and comprises an introduced expression cassette (Pcbh1-CBH1 Core-KEX2-LegGm1b) encoding a heterologous (soybean) leghemoglobin.

[0122] As used herein, the modified Trichoderma reesei strain designated "BGJ74" is derived from the Tr1 parent strain and comprises an introduced cassette encoding a heterologous (soy) leghemoglobin (Pcbh1-LegGm1b) and an introduced cassette encoding a protease inhibitor (Pcbh2-BASI).

[0123] As used herein, the modified T. reesei strain designated "BGJ75" is derived from the Tr1 parent strain and comprises an introduced cassette encoding a heterologous (French bean) leghemoglobin (Pcbh1-Pv1b) and an introduced cassette encoding a protease inhibitor (Pcbh2-BASI).

[0124] As used herein, the modified Trichoderma reesei strain designated "BGJ76" is derived from the Tr1 parent strain and comprises an introduced cassette encoding a heterologous (soy) leghemoglobin (Pcbh1-LegGm1b.Pep1ss) and an introduced cassette encoding a protease inhibitor (Pcbh2-BASI).

[0125] As set forth in Table 1 of the Examples section below, various plasmids (vectors) have been designed, constructed, and screened for secretion-based expression of globin proteins in filamentous fungal strains. In particular, Table 1 presents the names (column 1) and descriptions (column 2) of each vector constructed, including relevant genetic elements such as heterologous promoter regions (column 3), signal (secretion) sequences (column 4), N-terminal fusion (protein) sequences (column 5), gene CDS descriptions (column 6), and C-terminal fusion (protein) sequences (column 7) as described and exemplified herein. Table 1 also includes the names of 5' PCR primers (column 9) and 3' PCR primers (column 10) used herein, the DNA sequences of which are set forth in the Sequence Listing.

[0126] As used herein, chromosomal integration cassettes for expression of leghemoglobin include cassette "HG1" (SEQ ID NO: 27; pi 1-Pcbhl-LegGmlb), cassette "HG2" (SEQ ID NO: 28; pi 1-Pcbhl-LegGmlb-Pep1ss), cassette "HG3" (SEQ ID NO: 29; pi 1-Pcbhl-Cbh1core-LegGmlb), cassette "HG4" (SEQ ID NO: 30; pi 1-Pcbhl-Cbh1FL-LegGmlb), cassette "HG5" (SEQ ID NO: 31; pi 1-Pcbhl-Cbh1-LegGmlb-His6), and cassette "HG9" (SEQ ID NO: 35; pi 1c-Pcbhl-BASI-LegGmlb).

[0127] As used herein, chromosomal integration cassettes for expression of myoglobin include cassette "HG6" (SEQ ID NO: 32; pi 1-Pcbhl-Cbh1FL-Mblb) and cassette "HG7" (SEQ ID NO: 33; pi 1-Pcbhl-Cbh1FL-Mblb-His6).

[0128] As used herein, chromosomal integration cassettes for expression of protease inhibitor (BASI) are designated cassette "HG8" (SEQ ID NO: 34; pKS923-Pcbh2-BASI).

[0129] As used herein, the plasmid named "pCHL852" and "pCHL853" comprise codon-optimized genes encoding French bean leghemoglobin and soybean leghemoglobin, respectively. More particularly, plasmid pCHL852 (SEQ ID NO: 47) comprises an upstream (5') cbhl promoter sequence operably linked to a downstream DNA sequence encoding a Cbh1 signal sequence, which is operably linked to a downstream gene CDS (LegPvlb) encoding leghemoglobin; and plasmid pCHL853 (SEQ ID NO: 36) comprises an upstream (5') cbhl promoter sequence operably linked to a downstream DNA sequence encoding a Cbh1 (protein) signal sequence, which is operably linked to a downstream gene CDS (LegGmlb) encoding leghemoglobin.

[0130] As used herein, the plasmid named "pCHL856" comprises a codon-optimized gene encoding soybean leghemoglobin. More particularly, plasmid pCHL856 (SEQ ID NO: 37) comprises an upstream (5') cbhl promoter sequence (SEQ ID NO: 11) operably linked to a downstream DNA sequence (SEQ ID NO: 14) encoding a Pep1 (protein) signal sequence, which is operably linked to a downstream gene CDS (LegGmlb) encoding leghemoglobin (SEQ ID NO: 1).

[0131] As used herein, the plasmid named "pLH1088" comprises a codon-optimized gene encoding soybean leghemoglobin. More particularly, plasmid pLH1088 (SEQ ID NO: 38) comprises an upstream (5') cbhl promoter sequence (SEQ ID NO: 11) operably linked to a downstream DNA sequence (SEQ ID NO: 13) encoding a Cbh1 signal sequence, which is operably linked to a downstream DNA sequence encoding a Cbh1 protein core domain (abbreviated as "Cbhl core"; SEQ ID NO: 7), which is operably linked to a downstream gene CDS (LegGmlb) encoding leghemoglobin (SEQ ID NO: 1).

[0132] As used herein, the plasmid designated "pLH1104" comprises a codon-optimized gene encoding soybean leghemoglobin. More specifically, plasmid pLH1104 (SEQ ID NO: 39) comprises an upstream (5') cbh1 promoter sequence (SEQ ID NO: 11) operably linked to a downstream DNA sequence encoding a Cbh1 signal sequence (SEQ ID NO: 13), which is operably linked to a downstream DNA sequence encoding a full-length Cbh1 protein (abbreviated as "Cbh1 FL"; SEQ ID NO: 9), which is operably linked to a downstream gene CDS (LegGm1b) encoding leghemoglobin (SEQ ID NO: 1).

[0133] As used herein, the plasmid designated "pLH1105" comprises a codon-optimized gene encoding soybean leghemoglobin. More specifically, plasmid pLH1105 (SEQ ID NO: 40) comprises an upstream (5') cbh1 promoter sequence (SEQ ID NO: 11) operably linked to a downstream DNA sequence encoding a Cbh1 signal sequence (SEQ ID NO: 13), which is operably linked to a downstream DNA sequence encoding a Cbh1 FL protein (SEQ ID NO: 9), which is operably linked to a downstream gene CDS (LegGm1b) encoding leghemoglobin (SEQ ID NO: 1), which is operably linked to a downstream hexahistidine (6-His) tag.

[0134] As used herein, the plasmid designated "pLH1106" comprises a codon-optimized gene encoding bovine myoglobin. More specifically, plasmid pLH1106 (SEQ ID NO: 41) comprises an upstream (5') cbh1 promoter sequence (SEQ ID NO: 11) operably linked to a downstream DNA sequence encoding a Cbh1 signal sequence (SEQ ID NO: 13), which is operably linked to a downstream DNA sequence encoding a Cbh1 FL protein (SEQ ID NO: 9), which is operably linked to a downstream gene CDS (Mb1b) encoding myoglobin (SEQ ID NO: 3).

[0135] As used herein, the plasmid designated "pLH1107" comprises a codon-optimized gene encoding bovine myoglobin. More specifically, plasmid pLH1107 (SEQ ID NO: 42) comprises an upstream (5') cbh1 promoter sequence (SEQ ID NO: 11) operably linked to a downstream DNA sequence encoding a Cbh1 signal sequence (SEQ ID NO: 13), which is operably linked to a downstream DNA sequence encoding a Cbh1 FL protein (SEQ ID NO: 9), which is operably linked to a downstream gene CDS (Mb1b) encoding myoglobin (SEQ ID NO: 3), which is operably linked to a downstream hexahistidine tag.

[0136] As used herein, the plasmid designated "pLH1108" comprises a gene encoding the barley amylase subtilisin inhibitor (BASI) protein. More specifically, plasmid pLH1108 (SEQ ID NO: 43) comprises an upstream (5') cbh2 promoter sequence (SEQ ID NO: 12) operably linked to a downstream DNA sequence encoding a Pep1 signal sequence (SEQ ID NO: 14), which is operably linked to a downstream DNA sequence encoding a BASI protein (SEQ ID NO: 5).

[0137] As used herein, the plasmid designated "pLH1109" comprises a codon-optimized gene encoding a BASI protein. More specifically, plasmid pLH1109 (SEQ ID NO: 44) comprises an upstream (5') cbh1 promoter sequence (SEQ ID NO: 11) operably linked to a downstream DNA sequence encoding a Pep1 signal sequence (SEQ ID NO: 14), which is operably linked to a downstream DNA sequence encoding a BASI protein (SEQ ID NO: 5), which is operably linked to a downstream gene CDS (LegGm1b) encoding leghemoglobin (SEQ ID NO: 1).

[0138] As used herein, the terms "polypeptide" and "protein" (and / or their respective plural forms) are used interchangeably to refer to polymers of any length composed of amino acid residues linked by peptide bonds. The conventional one-letter or three-letter codes for amino acid residues are used herein. The polymers can be linear or branched, they can contain modified amino acids, and they can be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified by natural processes, such as post-translational processes or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid residue (including, for example, unnatural amino acids and the like) and other modifications known in the art.

[0139] As further described below in Sections II-III and in the Examples, in certain embodiments, one or more globin proteins of interest can be designed and constructed as fusion proteins. For example, in certain non-limiting aspects, a globin fusion protein can comprise an N-terminal fusion ("N-fusion") having one or more amino acid residues and / or a C-terminal fusion ("C-fusion") having one or more amino acid residues. For example, certain globin fusion proteins having N-terminal and / or C-terminal fusions have been designed, constructed, and described herein, as generally set forth in Tables 1-2 of the Examples.

[0140] As used herein, the term "derivative polypeptide / protein" refers to a protein that has been or can be derived by adding one or more amino acids to one or both of the N- and C-termini, substituting one or more amino acids at one or more different sites in the amino acid sequence, deleting one or more amino acids at one or both ends of the protein or at one or more sites in the amino acid sequence, and / or inserting one or more amino acids at one or more sites in the amino acid sequence. Preparation of a protein derivative can be achieved by modifying the DNA sequence encoding the native protein, transforming the DNA sequence into a suitable host, and expressing the modified DNA sequence to form the derivative protein.

[0141] Related (and derivative) proteins include "variant proteins." Variant proteins differ from a reference / paternal protein (e.g., a wild-type protein) by substitutions, deletions, and / or insertions at a small number of amino acid residues. The number of different amino acid residues between a variant and a parental protein can be one or more, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues. A variant protein can share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more amino acid sequence identity with a reference protein. A variant protein can also differ from a reference protein in selected motifs, domains, epitopes, conserved regions, and the like.

[0142] As used herein, the term "analogous sequence" refers to a sequence within a protein that provides similar function, tertiary structure, and / or conserved residues to a protein of interest (i.e., typically the original protein of interest). For example, in an epitope region containing an alpha-helix or beta-sheet structure, the substituted amino acids in the analogous sequence preferably maintain the same particular structure. The term also refers to nucleotide sequences as well as amino acid sequences. In some embodiments, an analogous sequence is developed such that substitution of amino acids results in a variant enzyme that displays similar or improved function. In some embodiments, the tertiary structure and / or conserved residues of the amino acids in the protein of interest are located at or near a segment or fragment of interest. Thus, when the segment or fragment of interest contains, for example, an alpha-helix or beta-sheet structure, the substituted amino acids preferably maintain the particular structure.

[0143] As used herein, the term "homologous protein" refers to a protein that has similar activity and / or structure to a reference protein. This is not intended to mean that the homolog must be evolutionarily related. Thus, it is intended that the term encompasses one or more proteins that are the same, analogous, or corresponding (i.e., in structure and function) obtained from different organisms. In some embodiments, it is desirable to identify a homolog that has similar quaternary, tertiary, and / or primary structure to the reference protein.

[0144] The degree of homology between sequences can be determined using any suitable method known in the art (e.g., the programs in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI), such as GAP, BESTFIT, FASTA, and TFASTA). As presented and described in Section II below, other globin gene / protein homologs can be identified by reference to one or more exemplary globins that are well suited for production in one or more of the modified filamentous fungal strains of the present disclosure.

[0145] For example, PILEUP is a useful program for determining levels of sequence homology. PILEUP creates a multiple sequence alignment from a cluster of related sequences using progressive, pairwise alignments. It also can plot a tree showing the clustering relationships for the sequences used in creating the alignment. PILEUP uses a simplified version of the progressive alignment method of Feng and Doolittle (1987). Useful PILEUP parameters include a default gap weight of 3.00, a default gap length weight of 0.10, and a weighted-end gaps. Another example of a useful algorithm is the BLAST algorithm. An especially useful BLAST program is the WU-BLAST-2 program. The parameters "W," "T," and "X" determine the sensitivity and speed of the alignment. The BLAST program uses word length (W) 11, BLOSUM62 scoring matrix (B) 50, a penalty for a single residue mismatch (E) 10, a cutoff for cut off gaps (M) 5, a penalty for cut off gap extension (N) -4, and comparison of both strands as default values.

[0146] As used herein, the phrases "substantially similar" and "substantially identical" in the context of at least two nucleic acids or polypeptides typically mean that the polynucleotides or polypeptides comprise sequences having at least about 40% to 100% sequence identity. Thus, in one or more embodiments, the substantially similar or substantially identical nucleic acids or polypeptides of the present disclosure have at least about 40%, 50%, 60%, 70%, 80%, 90% or 100% identity to one or more sequences set forth herein. In some related embodiments, one or more nucleotide sequences and / or one or more protein sequences of the present disclosure have at least about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 50%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity to one or more sequences set forth herein. Sequence identity can be determined using known programs (such as BLAST, ALIGN and CLUSTAL) using standard parameters. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. Additionally, databases can be searched using FASTA. One indication that two polypeptides are substantially identical is that the first polypeptide is immunologically cross-reactive with the second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (e.g., within a range of moderate to high stringency).

[0147] As used herein, "nucleic acid" refers to nucleotide or polynucleotide sequences and fragments or portions thereof, as well as DNA, cDNA and RNA of genomic or synthetic origin, which may be double-stranded or single-stranded, whether representing the sense or antisense strand.

[0148] As used herein, the term "expression" refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from a nucleic acid molecule of the present disclosure. Expression can also refer to the translation of mRNA into a polypeptide. Thus, the term "expression" includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, secretion, and the like.

[0149] As used herein, the terms "modification" and "genetic modification" are used interchangeably and include, but are not limited to: (a) introduction, substitution or removal of one or more nucleotides in a gene, or introduction, substitution or removal of one or more nucleotides in a regulatory element required for gene transcription or translation, (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) down-regulation of a gene (e.g., antisense RNA, siRNA, miRNA, etc.), (f) specific mutagenesis (including but not limited to CRISPR / Cas9-based mutagenesis) and / or (g) random mutagenesis of any one or more genes disclosed herein.

[0150] As used herein, "introduction, substitution or removal of one or more nucleotides in a gene encoding a protein," such genetic modification includes both gene coding sequences (ie, exons) and non-coding intervening (intron) sequences.

[0151] As used herein, "disruption of a gene," "gene disruption," "inactivation of a gene," and "gene inactivation" are used interchangeably and broadly refer to any genetic modification that substantially disrupts / inactivates a target gene. Exemplary methods of gene disruption include, but are not limited to, complete or partial deletion of any portion of a gene (including a polypeptide coding sequence (CDS), a promoter, an enhancer, or another regulatory element), or mutagenesis thereof, wherein mutagenesis encompasses substitutions, insertions, deletions, inversions, and any combinations and variations thereof, which disrupt / inactivate one or more target genes and substantially reduce or prevent expression / production of a functional gene product. In certain embodiments of the present disclosure, such gene disruption prevents the host cell from expressing / producing the encoded lov gene product.

[0152] In other embodiments, the target protein (e.g., globin POI) expressed / produced by the fungal cells of the present disclosure can be detected, identified, measured, determined, etc. by the following methods: protein quantification methods, gene transcription methods, mRNA translation methods, etc., including but not limited to protein migration / mobility (SDS-PAGE), mass spectrometry, HPLC, size exclusion, ultracentrifugation sedimentation velocity analysis, transcriptomics, proteomics, fluorescent tags, epitope tags, fluorescent protein (GFP, RFP, etc.) chimeras / hybrids, etc.

[0153] As used herein, functionally and / or structurally similar proteins are considered to be "related proteins." Such related proteins can be derived from organisms of different genera and / or species, or even organisms of different classes (e.g., bacteria and fungi). Related proteins also encompass homologs and / or orthologs determined by primary sequence analysis, by secondary or tertiary structure analysis, or by immunological cross-reactivity.

[0154] As used herein, the term "promoter" refers to a nucleic acid sequence capable of controlling the expression of a coding sequence (CDS) or a functional RNA. Typically, the coding sequence (CDS) is located downstream (3') of the promoter (pro) sequence. The promoter can be derived entirely from a natural gene, or be composed of different elements derived from different promoters found in nature, or even contain synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different cell types, or at different stages of development, or in response to different environmental or physiological conditions. A promoter that causes a gene to be expressed in most cell types most of the time is often referred to as a "constitutive promoter." It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been defined, DNA fragments of different lengths can have the same promoter activity.

[0155] As defined herein, the term "introducing" as used in phrases such as "introducing" at least one polynucleotide open reading frame (ORF) or a gene or a vector thereof into a fungal cell, includes methods known in the art for introducing polynucleotides into cells, including but not limited to, protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection, and the like.

[0156] As used herein, "transformed" or "transformation" means the transformation of a cell by the use of recombinant DNA techniques. Transformation typically occurs by the insertion of one or more nucleotide sequences (e.g., a polynucleotide, ORF, or gene) into a cell. The inserted nucleotide sequence can be a heterologous nucleotide sequence (i.e., a sequence that is not naturally occurring in the cell being transformed).

[0157] As used herein, "conversion" refers to the introduction of exogenous DNA into a host cell so that the DNA remains as a chromosomal integrant or a self-replicating extrachromosomal vector. As used herein, "transforming DNA," "conversion sequence," and "DNA construct" refer to the DNA for introducing a sequence into a host cell. DNA can be generated in vitro by PCR or any other suitable technology. In certain embodiments, the transforming DNA comprises an input sequence, and in other embodiments, it further comprises an input sequence flanked by a homology box. In further embodiments, the transforming DNA comprises other non-homologous sequences (that is, stuffing sequence or flank) that are added to the terminal. The terminal can be closed so that the transforming DNA forms a closed loop, such as by inserting into a vector.

[0158] As used herein, "input sequence" refers to a DNA sequence introduced into the fungal cell chromosome. In certain embodiments, the input sequence is a part of a DNA construct. In other embodiments, the input sequence encodes one or more target proteins. In certain embodiments, the input sequence comprises a sequence that may or may not be present in the genome of the cell to be transformed (that is, it may be a homologous or heterologous sequence). In certain embodiments, the input sequence encodes one or more target proteins, genes and / or mutations or modified genes. In alternative embodiments, the input sequence encodes functional wild-type genes or operons, functional mutant genes or operons or non-functional genes or operons. In certain embodiments, the input sequence is a non-functional sequence inserted into a gene to destroy gene function. In another embodiment, the input sequence includes a selective marker. In a further embodiment, the input sequence includes two homology boxes.

[0159] As used herein, "homology box" refers to a nucleic acid sequence that is homologous to a sequence in a fungal cell chromosome. More particularly, in accordance with the present application, a homology box is an upstream or downstream region having between about 80% and 100% sequence identity, between about 90% and 100% sequence identity, or between about 95% and 100% sequence identity to the immediate flanking coding region of a gene or portion of a gene to be deleted, disrupted, inactivated, down-regulated, etc. These sequences guide the location of integration of the DNA construct in the fungal cell chromosome and which portion of the fungal cell chromosome is replaced by the input sequence. While not intending to limit the disclosure, a homology box can include between about 1 base pair (bp) to 200 kilobases (kb). Preferably, a homology box includes between about 1 bp and 10.0 kb; 1 bp and 5.0 kb; 1 bp and 2.5 kb; 1 bp and 1.0 kb; and 0.25 kb and 2.5 kb. A homology box can also include about 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb, and 0.1 kb. In some embodiments, the 5' and 3' ends of a selectable marker are flanked by homology boxes, wherein the homology boxes comprise nucleic acid sequences that immediately flank the coding region of a gene.

[0160] As used herein, the term "nucleotide sequence encoding a selectable marker" refers to a nucleotide sequence capable of being expressed in a host cell and wherein expression of the selectable marker confers the ability to the cell containing the expressed gene to grow in the presence of the corresponding selective agent or lack of an essential nutrient.

[0161] As used herein, the terms "selectable marker" and "selective marker" refer to a nucleic acid (e.g., a gene) that is capable of being expressed in a host cell that allows for easy selection of those hosts containing the vector. Examples of such selectable markers include, but are not limited to, an antimicrobial agent. Thus, the term "selectable marker" refers to a gene that provides an indication that a host cell has taken up an inputted DNA of interest or that some other reaction has occurred. Typically, a selectable marker is a gene that confers antimicrobial resistance or a metabolic advantage to the host cell to allow for the differentiation of cells containing exogenous DNA from cells that have not received any exogenous sequence during transformation.

[0162] As defined herein, a host cell "genome", a fungal cell "genome", or a filamentous fungal cell "genome" includes chromosomal genes and extrachromosomal genes.

[0163] As used herein, the terms "plasmid," "vector," and "cassette" refer to an extra chromosomal element often carrying genes that are not part of the central metabolism of the cell, and usually conferring selectable traits on the cell on which they are maintained. Such elements can be autonomously replicating sequences, genome integrating sequences, phasmids, or nucleotide sequences, derived from viruses or bacteria, which are linear or circular and can be double-stranded or single-stranded DNA or RNA. The various forms of these elements can be derived from different sources, including bacterium, yeast, animal, and virus.

[0164] As used herein, the term "vector" refers to any nucleic acid that can replicate (propagate) in a cell and can carry a new gene or DNA segment (e.g., an "input sequence") into a cell. Thus, the term refers to nucleic acid constructs designed for transfer between different host cells. Vectors include viruses, bacteriophages, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), PLACs (plant artificial chromosomes), and the like, which are "episomes" (i.e., replicate autonomously) or can integrate into the chromosome of a host cell.

[0165] As used herein, a "transformation cassette" refers to a particular vector that contains a gene and has elements other than those that facilitate transformation of a particular host cell.

[0166] As used herein, an "expression vector" refers to a vector that has the ability to incorporate and express heterologous DNA in a cell. Numerous prokaryotic and eukaryotic expression vectors are commercially available and known to those skilled in the art. Selection of an appropriate expression vector is within the knowledge of those skilled in the art.

[0167] As used herein, the term "expression cassette" refers to a recombinantly or synthetically generated nucleic acid construct having a series of specified nucleic acid elements (e.g., a vector or vector elements described above) that allow for the transcription of a particular nucleic acid in a target cell. A recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In some embodiments, the DNA construct further includes a series of specified nucleic acid elements that allow for the transcription of a particular nucleic acid in a target cell. In certain embodiments, the DNA construct of the present disclosure comprises a selectable marker and an inactivated chromosome, or gene, or DNA segment, as defined herein.

[0168] As used herein, a "targeting vector" is a vector that includes a polynucleotide sequence that is homologous to a region in the chromosome of a host cell into which the targeting vector is transformed and that can drive homologous recombination at that region. For example, a targeting vector can be used to introduce a genetic modification into the chromosome of a host cell by homologous recombination. In some embodiments, the targeting vector comprises other non-homologous sequences, such as other non-homologous sequences added to the ends (i.e., stuffer sequences or flanking sequences). The ends can be closed so that the targeting vector forms a closed loop, such as for example, for insertion into a vector.

[0169] As used herein, the terms "purified," "isolated," or "enriched" mean that a biomolecule (e.g., a polypeptide or polynucleotide) is altered from its native state by separating it from some or all of the naturally occurring components with which it is associated in nature. Such isolation or purification can be accomplished by art-recognized separation techniques, such as ion exchange chromatography, affinity chromatography, hydrophobic separation, dialysis, protease treatment, heat treatment, ammonium sulfate precipitation or other protein salt precipitation, crystallization, centrifugation, size exclusion chromatography, filtration, microfiltration, gel electrophoresis, or gradient separation to remove undesirable whole cells, cell debris, impurities, extraneous proteins, or enzymes in the final composition. Components that provide additional benefits, such as activators, anti-inhibitors, desired ions, pH-controlling compounds, or other enzymes or chemicals, can then be further added to the purified or isolated biomolecule composition.

[0170] As used herein, a "protein preparation" is any material, typically a solution, usually aqueous, containing one or more proteins.

[0171] As used herein, the terms "broth," "culture broth," "fermentation broth," and / or "whole fermentation broth" are used interchangeably and refer to a preparation produced by fermentation of cells that does not undergo processing steps after fermentation is complete. For example, whole fermentation broth is typically produced when a microbial culture is grown to saturation and incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of protein by the host cells; and optionally, secretion of protein into the cell culture medium). Typically, whole fermentation broth is unfractionated and contains spent cell culture medium, metabolites, extracellular polypeptides, and microbial cells.

[0172] As used herein, the phrase "treated broth" refers to broth that has been conditioned by altering the chemical composition and / or physical properties of the broth. Broth "conditioning" can include one or more treatments such as cell lysis, pH modification, heating, cooling, addition of chemicals (e.g., calcium, one or more salts, one or more flocculants, one or more reducing agents, one or more enzyme activators, one or more enzyme inhibitors, and / or one or more surfactants), mixing, and / or timed holding of the broth (e.g., 0.5 to 200 hours) without further treatment.

[0173] As used herein, "cell lysis" processes include any cell lysis technique known in the art, including but not limited to, enzymatic treatment (e.g., lysozyme, proteinase K treatment), chemical means (e.g., ionic liquids), physical means (e.g., French press, sonication), simply holding the culture without feed, etc.

[0174] As used herein, the terms "recovery," "recovered," and "recovering" refer to at least partial separation of the protein from one or more components of the microbial broth, and / or at least partial separation of the protein from one or more solvents (e.g., water or ethanol) of the broth.

[0175] In certain aspects, the broth in which the host cells have been fermented for production of a globulin is clarified, with or without broth treatment. As used herein, "clarified" broth means broth that has been subjected to at least one clarification process to remove cell debris and / or other insoluble components. As understood in the art, clarification processes include but are not limited to centrifugation techniques, cross-flow membrane filtration techniques, solid / liquid filtration techniques, etc.

[0176] "Cell debris" refers to cell walls and other insoluble components released or formed after the cell membrane is ruptured (e.g., after a cell lysis process is performed).

[0177] In certain aspects, separation of the solvent includes but is not limited to ultrafiltration, evaporation, spray drying, freeze drying, as understood in the art. The resulting solution is referred to as a "clarified broth concentrate," "UF concentrate," or "ultrafiltration concentrate."

[0178] As used herein, the term "cell mass" refers to the cellular components (including intact and lysed cells) present in a liquid (submerged) culture. Cell mass can be expressed in dry cell weight (DCW) or wet cell weight (WCW).

[0179] II. Recombinant filamentous fungal cells producing heterologous globulin

[0180] As briefly discussed above, despite the current knowledge regarding globulins (e.g., leghemoglobin, cyanoglobin, hemoglobin, myoglobin, leghemoglobin, etc.), the isolation and / or production of globulins, and their various uses and applications, there remains a continuing unmet need in the art. For example, due to the growing demand for so-called "non-animal" derived meat substitutes, the use of certain leguminous (plant) derived globulins (i.e., leghemoglobin) has been considered. In certain instances, the isolation of leghemoglobin for use as a meat substitute has been described, wherein the leghemoglobin is isolated and purified from a plant (legume) source (PCT Publication No. WO 2013 / 010042). In other cases, attempts have been made to express leghemoglobin in yeast cells (e.g., S. cerevisiae; Pichia pastoris), which generally requires extensive genetic modification of the host cells to co-express the complete heme biosynthesis pathway and leghemoglobin (PCT Publication No. WO 2016 / 183163).

[0181] As described by Krainer et al. (2015), insufficient heme incorporation is considered a central obstacle in the recombinant production of active heme proteins. In particular, Krainer et al.

[2015] investigated the role of pathway engineering and media supplementation in optimizing the recombinant production of the heme protein horseradish peroxidase (HRP) in the methylotrophic yeast Pichia pastoris. As summarized by Krainer et al. (2015), in contrast to studies in other host organisms, (a) co-overexpression of endogenous heme biosynthesis pathway genes in Pichia pastoris did not improve recombinant production of active HRP enzyme, (b) supplementation of the culture medium with the commonly used precursor 5-aminolevulinic acid (ALA) did not affect the yield of active HRP enzyme, whereas (c) supplementation of the culture medium with hemin increased the yield of active HRP enzyme, concluding that the yield of active peroxidase from Pichia pastoris can be easily improved by supplementing the culture medium with hemin.

[0182] Recently, Shao et al. (2022) described a Pichia pastoris strain capable of secreting functional leghemoglobin at high yields, developed through gene dosage optimization and heme pathway integration. Specifically, the heme biosynthesis pathway was engineered by increasing the copy number of heterologous leghemoglobin and integrating the native heme biosynthesis pathway to address challenges with heme depletion and leghemoglobin secretion. This Pichia pastoris engineering strategy increased leghemoglobin secretion without the need to supplement the culture medium with expensive precursors (e.g., hemin; Shao et al., 2022).

[0183] In other instances, non-animal derived meat-like materials / components obtained from genetically modified cyanobacteria (blue-green algae) comprising polynucleotides encoding heterologous heme-containing proteins (e.g., leghemoglobin, cyanoglobin) have been described (PCT Publication WO 2019 / 079135). As generally set forth in the WO 2019 / 079135 publication, certain genetic modifications to the cyanobacterial host strain are required to improve the levels of globin, such as genetic modifications to reduce (decrease) levels of heme oxygenase in the host strain, genetic modifications to knock down genes encoding magnesium chelatase (MgCh) in the host strain, genetic modifications to overexpress iron chelatase (FeCh) in the host strain, genetic modifications to knock down levels of gun4 (MgCh activator) in the host strain, and the like.

[0184] In certain other instances, the heme biosynthetic pathway of Aspergillus niger strains was evaluated in the context of producing lignin-degrading peroxidases (i.e., heme containing class II peroxidases; Franken et al., 2011). As summarized by Franken et al. (2011), the availability and incorporation of the cofactor has proven to be a limiting factor for the production of fungal peroxidases in A. niger that require heme as a cofactor. In particular, Franken et al. (2011) state that the production of peroxidases can be increased by supplementing the fermentation medium with hemoglobin or hemin, but little is known about the mechanisms behind the uptake of heme and that this approach is too costly to be suitable for industrial purposes.

[0185] Thus, as generally described above, it is apparent that there remains a continuing uncertainty and inconsistency in the art as to, for example, identifying the optimal host cell genetic modifications required to improve globin production, the need or requirement for medium (broth) supplements (e.g., hemin, ALA) to improve globin production, or the like. For example, as demonstrated in certain yeast strains (e.g., S. cerevisiae; P. pastoris), the need or requirement for upregulation (e.g., overexpression) and / or downregulation of one or more heme pathway biosynthetic genes varies depending on the yeast strain being screened and the particular globin it expresses. Likewise, in other aspects, the need or requirement for medium supplements can vary significantly depending on the yeast strain being fermented and the globin it expresses. As reviewed by Franken et al. (2011), the production of lignin-degrading peroxidases using Aspergillus species fungal strains requires medium supplements (e.g., hemin), which indicates that further improvements to the strains require a more thorough understanding of the heme biosynthetic pathway in A. niger and its regulation, most desirably, a requirement for no medium supplements.

[0186] Therefore, it is still generally unknown whether filamentous fungal strains such as Aspergillus can produce (heme-containing) globulins at sufficiently high levels as desired in the art. In particular, the design, construction, identification, cultivation / fermentation, etc. of genetically modified (recombinant) host organisms that contain enhanced globulin production phenotypes (e.g., protein titer, specific productivity, protein yield, volumetric productivity, carbon conversion efficiency, etc.) and methods thereof are important economic factors in the cost of globulin production, especially under large-scale (industrial) fermentation conditions.

[0187] Based on the foregoing, the applicants unexpectedly observed that recombinant filamentous fungal cells are particularly well-suited for the large-scale production of heterologous globulin proteins. More specifically, as described in the Examples section below, the applicants have conducted work on the design, construction, and evaluation of recombinant polynucleotides (e.g., expression cassettes) encoding heterologous globulin proteins, wherein these cassettes are introduced into filamentous fungal cells for expression and secretion of the globulin proteins. In particular, as described in Example 1, the applicants constructed vectors for expressing soy leghemoglobin (SEQ ID NO: 1) as a secreted protein (Example 1A), French bean leghemoglobin (SEQ ID NO: 19) as a secreted protein (Example 1B), and soy leghemoglobin (SEQ ID NO: 1) as a secreted fusion protein (Example 1C). As presented and described in Example 2, the applicants further constructed vectors for expressing heterologous bovine myoglobin (SEQ ID NO: 3) in filamentous fungal cells. For example, the various nucleic acid (DNA) sequences and genetic elements used to construct one or more modified (recombinant) filamentous fungal strains of the present disclosure are described in Table 1 of the Examples section below. Similarly, certain chromosomal integration vectors for expressing leghemoglobin, myoglobin, and a proteinase inhibitor protein (BASI; SEQ ID NO: 5) are described in Table 2 of the Examples section.

[0188] As described in Example 3, Applicants further designed and constructed recombinant filamentous fungal cells by targeted integration of one or more expression cassettes. In particular, filamentous fungal strains expressing leghemoglobin and myoglobin were generated by targeted genomic integration directed by Cas9 (Example 3). In addition, to assess the potential proteolytic degradation of secreted globin proteins (e.g., by native proteases secreted by the host strain), expression cassettes encoding an exemplary secreted protease inhibitor protein (BASI) were integrated into certain strains for co-expression of globin proteins (e.g., leghemoglobin) and protease inhibitors (e.g., BASI).

[0189] As generally set forth and described in Example 4, strain BFZ28 (Pcbhl-CBHl core-KEX2-LegGmlb) was subjected to fed-batch fermentation in a two liter (2 L) bioreactor, wherein ten milliliter (10 mL) whole broth samples were taken every twenty-four (24) hours and frozen at -20 °C. More particularly, as shown in Figure 3 As shown in FIG. 4, the formation of red (dark red) color in the supernatant indicates globin secretion into the culture supernatant. In particular, Figure 4 Total protein secretion by BFZ28 is shown in FIG. 5, wherein the total protein concentration after approximately 188 hours of fermentation was approximately 50 grams per liter (50 g / L). As shown in Figure 5 Supernatant from strain BFZ28 was analyzed by SDS-PAGE as shown in FIG. 6, wherein the protein band above approximately (~) 50 kDa is the Cbhl core protein, the leghemoglobin band (~16 KDa) co-migrates with the ~20 kDa BASI protease inhibitor, or is present as a minor band at ~17 KDa. In addition, to verify / confirm expression of leghemoglobin, fermentation supernatant was analyzed by HPLC analysis of a 188 hour supernatant sample from a fermentation run of BFZ28. As shown in Figure 6 As shown in FIG. 7, the porphyrin of leghemoglobin (heme) was detected at a wavelength of 410 nm, which co-migrates with the protein peak at a retention time of 6.4 minutes detected at 280 nm. Figure 6 The insert of FIG. 8 shows a spectral scan of the leghemoglobin peak at a retention time of 6.4 minutes, confirming the peak absorbance of leghemoglobin at 410 nm.

[0190] As briefly set forth above, to assess the effect of proteolytic degradation on secreted globin, an expression cassette encoding an exemplary secreted protease inhibitor (BASI) was integrated into certain strains for co-expression of globin with (BASI) protease inhibitor. More particularly, as generally described in Example 5, modified strains "BGJ74" (Pcbhl-LegGmlb, Pcbh2-BASI), "BGJ75" (Pcbhl-Pvlb, Pcbh2-BASI), and "BGJ76" (Pcbhl-LegGmlb.Pep1ss, Pcbh2-BASI) were constructed and fermented. For example, as presented in Figure 7 As presented in FIG. 10, along with data from the fermentation run of BFZ28 (Example 4), the total soluble protein secreted in the fermentation run was plotted against the effective fermentation time (EFT, hours). As shown in Figure 8 As shown in FIG. 11, fermentation supernatant was analyzed by SDS-PAGE, wherein the presence of (heme)-containing leghemoglobin was confirmed by HPLC, as shown in Figure 9Table 4. Total protein secretion titers at the end of 188 hour fermentation runs. Soybean leghemoglobin titers (g / L) were calculated based on protein peak area at 280 nm. For example, recombinant filamentous fungal strains expressing soybean leghemoglobin (BFZ28, BGJ74, BGJ76) and French bean leghemoglobin (BGJ75) were able to secrete leghemoglobin at high titers (g / L) during fermentation, as shown in Table 4.

[0191] Accordingly, certain one or more embodiments of the present disclosure relate to recombinant (modified) filamentous fungal cells capable of producing heterologous globin proteins for use in food materials, food ingredients, flavor modulators, aroma improvers, and the like. In certain embodiments, the globin is selected from the group consisting of leghemoglobin, myoglobin, hemoglobin, cyanoglobin, and non-symbiotic hemoglobin. In other certain one or more embodiments, the globin includes the group consisting of leghemoglobin, hemoglobin, non-symbiotic hemoglobin, myoglobin, neuroglobin, cytoglobin, protoglobin, truncated 2 / 2 globin, HbN, cyanoglobin, HbO, Glb3, and Hell's gate globin, bacterial hemoglobin, and ciliate myoglobin. For example, as generally known in the art, members of the globin-like superfamily include a variety of all-helical proteins that bind porphyrins and play various roles in the three domains of life, including as oxygen sensors or transporters. The globin-like superfamily includes the M / myoglobin-like, S / sensor globin, and T / truncated globin (TrHb) families, as well as phycobiliproteins (PBPs).

[0192] Thus, in one or more other embodiments, the present disclosure provides methods for identifying and obtaining globin (DNA / protein) sequences suitable for expression in one or more modified filamentous fungal cells described herein. In certain aspects, one or more suitable leghemoglobin sequences can be identified and obtained from a variety of plant sources, such as various legume species and varieties thereof, including but not limited to soybeans, faba beans, lima beans, cowpeas, English peas, yellow peas, lupins, kidney beans, chickpeas, peanuts, alfalfa, vetch hay, clover, lespedeza, pinto beans, and the like. In certain embodiments, the leghemoglobin is at least about 90% identical to a leghemoglobin derived from a plant selected from the group consisting of soybeans, faba beans, lima beans, cowpeas, peas, French beans, yellow peas, lupins, kidney beans, chickpeas, peanuts, alfalfa, vetch hay, clover, lespedeza, and pinto beans. In certain other embodiments, the leghemoglobin is at least about 90% identical to soybean leghemoglobin SEQ ID NO: 1. In certain other embodiments, the leghemoglobin is at least about 90% identical to French bean leghemoglobin SEQ ID NO: 19. In certain other embodiments, the myoglobin is at least about 90% identical to SEQ ID NO: 3. In certain other embodiments, the recombinant filamentous fungal cell of the present disclosure comprises an introduced polynucleotide encoding a protease inhibitor protein (expression cassette).

[0193] For example, natural soybean leghemoglobin (SEQ ID NO: 1; Figure 1 ) contains 145 amino acid residues, of which amino acid positions 8-111 contain the globin-like superfamily domain. In addition, natural soybean leghemoglobin ( Figure 1 ) contains a class 1-2 non-symbiotic hemoglobin domain at residue positions 4-144 of SEQ ID NO: 1. The leghemoglobin heme binding site includes amino acid positions L44, F45, S46, F47, K58, H62, K65, L66, F67, L69, V70, A88, L89, I92, H93, K96, I98, Q102, F103, Y134, L137, A138, and I141 ( Figure 1 ; SEQ ID NO: 1, residues shown in bold).

[0194] Thus, in certain embodiments, one or more leghemoglobin sequences can be derived from organisms including, but not limited to, Abrus precatorius (Accession No. XP_027365674.1), Astragalus canadensis (Accession No. QAX32739.1), Astragalus sinicus (Accession No. ABB13622.1), Cajanus cajan (Accession No. XP_020222796.1), Canavalia lineata (Accession No. P42511.1), Cicer arietinum (Accession No. XP_004490880.1), Galega orientalis (Accession No. QAX32752.1), Glycine soja (Accession No. KAG4983849.1), Glycyrrhiza uralensis (Accession No. QAX32708.1), Lotus japonicus (Accession No. AFK42883.1), Medicago sativa (Accession No. AAA32657.1), Medicago truncatula (Accession No. XP_003616494.1), Mucuna pruriens (Accession No. RDX62803.1), Onobrychis viciifolia (Accession No. QAX32720.1), Ononis spinosa (Accession No. QAX32757.1), Phaseolus vulgaris (Accession No. XP_007144265.1), Pisum sativum (Accession No. XP_050917485.1), Psophocarpus tetragonolobus (Accession No. P27199.1), Sesbania rostrata (Accession No. P14848.2), Trifolium pratense (Accession No. XP_045786945.1), Trifolium subterraneum (Accession No. GAU42435.1), Vicia faba (Accession No. P93849.3), Vigna angularis (Accession No. XP_017409386.1), Vigna radiata var. radiata (Accession No. XP_014513332.1) Vigna umbellate (Accession No. XP_047166207.1) and Vigna unguiculata (Accession No. NP_001363034.1). In certain aspects, the leghemoglobin will have an absorbance spectrum and visual appearance nearly identical to animal muscle-derived myoglobin.

[0195] As Figure 1As presented in , native bovine myoglobin (SEQ ID NO: 3) comprises 154 amino acid residues, of which amino acid positions 7-112 comprise a globin-like superfamily domain. Thus, in certain embodiments, one or more myoglobin sequences can be derived from organisms including, but not limited to, giant panda (Ailuropoda melanoleuca) (Accession No. XP_002925619.1), bowhead whale (Balaena mysticetus) (Accession No. R9RZK8.1), minke whale (Balaenoptera acutorostrata scammony) (Accession No. XP_007165766.1), blue whale (Balaenoptera musculus) (Accession No. XP_036722853.1), wild yak (Bos mutus) (Accession No. MXQ80090.1), domestic cattle (Bostaurus) (Accession No. NP_776306.1), water buffalo (Bubalus bubalis) (Accession No. XP_006074486.1), wild camel (Camelus ferus) (Accession No. XP_006183931.1), goat (Capra hircus) (accession number XP_005680660.1), southern white rhino (Ceratotherium simum simum) (accession number XP_004418145.1), red deer (Cervus elaphus) (accession number P02191.2), spotted hyena (Crocuta) (accession number KAF0881531.1), beluga whale (Delphinapterus leucas) (accession number XP_022455612.1), long-beaked dolphin (Delphinus capensis) (accession number AMN15044.1), sea otter (Enhydra lutris kenyoni) (accession number XP_022374654.1), African wild ass (Equus asinus) (accession number XP_014688187.1), wild horse (Equus caballus) (accession number NP_001157488.1), long-finned pilot whale (Globicephala melas) (accession number XP_030711253.1), West African gorilla (Gorilla gorilla) (accession number XP_018874109.1), mink (Gulo gulo) (accession number VCW91177.1), pygmy hippopotamus (Hexaprotodon liberiensis) (accession number AGM75766.1), striped hyena (Hyaena hyaena) (accession number XP_039086409.1).1), Northern Bottlenose Whale (Hyperoodon ampullatus) (Accession No. AGM75769.1), Long's Beaked Whale (Indopacetus pacificus) (Accession No. Q0KIY9.3), Amazon River Dolphin (Inia geoffrensis) (Accession No. P02181.2), Pacific Shoalbeaked Dolphin (Lagenorhynchus obliquidens) (Accession No. XP_026964057.1), Ring-tailed Lemur (Lemur catta) (Accession No. XP_045408951.1), Mustelus Lemur (Lepilemur mustelinush) (Accession No. P02169.2), Baiji Dolphin (Lipotes vexillifer) (Accession No. XP_007456317.1), North American River Otter (Lontracanadensis) (Accession No. XP_032692617.1), River Otter (Lutra lutra) (accession number P11343.3), Chinese pangolin (Manis pentadactyla) (accession number XP_036747296.1), humpback whale (Megaptera novaeangliae) (accession number P02178.2), badger (Meles meles) (accession number XP_045868724.1), Hughes' beaked whale (Mesoplodon carlhubbsi) (accession number P02183.2), gray mouse lemur (Microcebus murinus) (accession number XP_012642551.1), narwhal (Monodon monoceros) (accession number XP_029061405.1), Yangtze finless porpoise (Neophocaena asiaeorientalis) (accession number XP_024599230.1), killer whale (Orcinus orca) (accession number XP_004286254.1), burrowing rabbit (Oryctolagus cuniculus) (accession number XP_008255312.3), sheep (Ovisaries) (accession number NP_001072126.1), bonobo (Pan paniscus) (accession number XP_008973239.1), African warthog (Phacochoerus africanus) (accession number XP_047642382.1), harbor seal (Phoca vitulina) (accession number XP_032272566.1), sperm whale (Physeter catodon) (accession number 5YCG_A), raccoon (Procyonlotor) (accession number AGM75763.1).1) Propithecus coquereli (Accession No. XP_012500179.1), Stenella attenuate (Accession No. Q0KIY6.3), Suricata suricatta (Accession No. XP_029811662.1), Sus scrofa (Accession No. NP_999401.1), Tupaia chinensis (Accession No. XP_006170382.1), Tursiops truncatus (Accession No. AMN15042.1), Ursus maritimus (Accession No. NP_001288305.1), and Ziphius cavirostris (Accession No. P02182.2).

[0196] As described in Section III below, in other one or more embodiments, the recombinant filamentous fungal cell of the present disclosure comprises an introduced polynucleotide encoding a protease inhibitor protein (expression cassette). In other certain one or more embodiments, the expression cassette includes or comprises one or more nucleic acid (DNA) sequences encoding a fusion protein, such as an upstream (5') DNA fusion sequence (N-terminal fusion) and / or a downstream (3') DNA fusion sequence (C-terminal fusion), and the like. In other embodiments, the one or more cassettes are integrated into the genome of the cell. In certain other embodiments, the recombinant filamentous fungal cell comprises at least two introduced expression cassettes encoding the same or different globulin.

[0197] In certain other embodiments, the recombinant filamentous fungal cell comprises a deletion or disruption of one or more endogenous genes encoding one or more secreted proteases. In certain embodiments, the deletion or disruption of the endogenous gene encoding one or more secreted proteases includes, but is not limited to, a subtilisin-like serine protease, an aspartic protease, a trypsin-like serine protease, a glutamic protease, and an aminopeptidase.

[0198] In yet other embodiments, the recombinant filamentous fungal cells of the present disclosure comprise one or more deletions of highly expressed endogenous genes. For example, in the case of Trichoderma reesei cells, highly expressed endogenous genes include, but are not limited to, one or more secreted lignocellulose degrading enzymes (e.g., cellobiohydrolases, xylanases, endoglucanases, beta-glucosidases). Therefore, in certain embodiments, the filamentous fungal cells of the present disclosure are genetically modified to be defective in the production of one or more highly expressed lignocellulose degrading enzymes. For example, in Trichoderma reesei cells, suitable genetic modifications include making the cell defective in the production of one or more endogenous genes selected from the group consisting of a cellobiohydrolase 1 (cbh1) gene, a cellobiohydrolase 2 (cbh2) gene, an endoglucanase 1 (egl1) gene, and an endoglucanase 2 (egl2) gene.

[0199] III. Polynucleotide Constructs and Molecular Biology

[0200] As described above, certain embodiments of the present disclosure relate to modified filamentous fungi strains comprising globulin productivity-enhancing phenotypes (e.g., protein titer, specific productivity, protein yield, volumetric productivity, carbon conversion efficiency, etc.). Therefore, certain embodiments of the present disclosure relate particularly to molecular biology, genetic modification, polynucleotides, genes, gene coding sequences (CDS), ORFs, vectors, expression cassettes, fusion proteins, protein linker sequences, cleavable protein linker sequences, etc. In certain embodiments, the present disclosure provides recombinant nucleic acids (polynucleotides) comprising genes or gene CDS encoding globulins. In particular, certain embodiments provide polynucleotide constructs (e.g., expression cassettes) encoding globulins for expressing and secreting globulins into culture medium / fermentation broth. In some aspects, one or more expression cassettes for secreting globulins can typically be presented by one or more schematic diagrams.

[0201] For example, an expression cassette encoding a secreted globulin can be schematically presented as: 5'-[pro]-[sig-seq]-[globulin CDS]-3'; wherein the expression cassette comprises (in the 5' to 3' direction) a promoter (pro) region sequence, the promoter (pro) region sequence is operably linked to a nucleic acid encoding a protein (signal) secretion sequence (sig-seq), and the nucleic acid encoding a protein (signal) secretion sequence (sig-seq) is operably linked to a nucleic acid encoding a globulin (globulin CDS).

[0202] In certain embodiments, the promoter (pro) region sequence is a strong promoter that functions in a host filamentous fungal strain. As examples, such strong promoter (pro) region sequences that function in Trichoderma sp. filamentous fungal cells include, but are not limited to, Trichoderma reesei CBH1 promoter, CBH2 promoter, Xyn3 promoter, Gla1 promoter, Egl2 promoter, and the like. In certain embodiments, the strong promoter can be referred to as a promoter that overexpresses the globulin.

[0203] While certain protein (signal) secretion sequences are exemplified herein (e.g., Cbh1 secretion sequence (SEQ ID NO: 13), Pep1 secretion sequence (SEQ ID NO: 14)), one of skill in the art can also screen, identify, and select other suitable protein signal / secretion sequences that function in filamentous fungal cells. For example, in certain aspects, globulin secretion in one or more filamentous fungal cells of the present disclosure can be identified using one or more signal (secretion) peptide sequences from high- secreting filamentous fungal proteins known in the art. In certain other embodiments, globulin secretion in one or more filamentous fungal cells can be screened and identified by reference to one or more native protein secretion / signal sequences including, but not limited to, the following and functional variants thereof: Talaromyces sp. beta-mannanase secretion sequence, Talaromyces sp. glucoamylase secretion sequence, Trichoderma sp. Cbh2 secretion sequence, Trichoderma sp. glucoamylase secretion sequence, Humicola sp. Cel45 secretion sequence, Neurospora sp. chitin synthase secretion sequence, Aspergillus sp. alpha-galactosidase (GlaA) secretion sequence, Aspergillus sp. PepN secretion sequence, Harzianum aspartyl protease (PapA) secretion sequence, Myceliopthora sp. IMI 387099 xylanase secretion sequence, and the like.

[0204] As further presented in the examples, one or more expression cassettes encoding a secreted globulin can include or comprise one or more nucleic acid (DNA) sequences encoding a fusion protein, a protein linker sequence, a cleavable (protein) linker sequence, and the like. For example, an expression cassette encoding a secreted globulin having an N-terminal fusion (N-fusion) can be schematically presented as: 5'-[pro]-[sig-seq]-[N-fusion]-[globulin CDS]-3'; wherein the cassette comprises (in the 5' to 3' direction) a promoter (pro) region operably linked to a nucleic acid encoding a protein (signal) secretion sequence (sig-seq), the nucleic acid encoding a protein (signal) secretion sequence (sig-seq) operably linked to a nucleic acid encoding an N-terminal fusion protein (N-fusion), the nucleic acid encoding an N-terminal fusion protein (N-fusion) operably linked to a nucleic acid encoding a globulin (globulin CDS). Likewise, an expression cassette encoding a secreted globulin having a C-terminal fusion (C-fusion) can be schematically presented as: 5'-[pro]-[sig-seq]-[globulin CDS]-[C-fusion]-3'; wherein the expression cassette comprises (in the 5' to 3' direction) a promoter (pro) region sequence operably linked to a nucleic acid encoding a protein (signal) secretion sequence (sig-seq), the nucleic acid encoding a protein (signal) secretion sequence (sig-seq) operably linked to a nucleic acid encoding a globulin (globulin CDS), the nucleic acid encoding a globulin (globulin CDS) operably linked to a nucleic acid encoding a C-terminal fusion protein (C-fusion).

[0205] Thus, in certain other embodiments, an expression cassette encoding a secreted globulin having an N-terminal fusion (N-fusion) and a C-terminal fusion (C-fusion) can be schematically presented as: 5'-[pro]-[sig-seq]-[N-fusion]-[globulin CDS]-[C-fusion]-3'; wherein the expression cassette comprises (in the 5' to 3' direction) a promoter (pro) region sequence operably linked to a nucleic acid encoding a protein (signal) secretion sequence (sig-seq), the nucleic acid encoding a protein (signal) secretion sequence (sig-seq) operably linked to a nucleic acid encoding an N-terminal fusion protein (N-fusion), the nucleic acid encoding an N-terminal fusion protein (N-fusion) operably linked to a nucleic acid encoding a globulin (globulin CDS), the nucleic acid encoding a globulin (globulin CDS) operably linked to a nucleic acid encoding a C-terminal fusion protein (C-fusion).

[0206] For example, as shown in Table 1-2 (Example 2), the T. reesei Cbh1 protein is an exemplary N-terminal fusion protein in which the nucleic acid encoding leghemoglobin (leghemoglobin CDS) comprises nucleic acid encoding the Cbh1 protein (Cbh1) located upstream (5') and operably linked to the nucleic acid encoding leghemoglobin (e.g., 5'-[pro]-[sig-seq]-[Cbh1]-[leghemoglobin CDS]-3'). In other embodiments, a hexahistidine amino acid (6-His) tag is an exemplary C-terminal fusion protein (peptide) in which the nucleic acid encoding leghemoglobin (leghemoglobin CDS) comprises nucleic acid encoding the 6-His peptide (6-His) located downstream (3') and operably linked to the nucleic acid encoding leghemoglobin (e.g., 5'-[pro]-[sig-seq]-[leghemoglobin CDS]-[6-His]-3'). In certain other embodiments, the Cbh1 protein and the 6-His peptide are exemplary N-terminal and C-terminal proteins fused to leghemoglobin (e.g., 5'-[pro]-[sig-seq]-[Cbh1]-[leghemoglobin CDS]-[6-His]-3').

[0207] In certain other embodiments, one or more cassettes comprise one or more upstream (N-linker) and / or downstream (C-linker) nucleic acids encoding one or more (protein / peptide / amino acid) linker amino acid sequences. In certain embodiments, the protein / peptide / amino acid linker sequence is a cleavable sequence (e.g., a KEX2 cleavage site). As described in Example 4, strain BFZ28 comprises an introduced cassette encoding a Cbh1-lectin fusion protein (Pcbh1-CBH1 Core-KEX2-LegGm1b), wherein a nucleic acid encoding a cleavable KEX2 linker (KEX2) is positioned between a nucleic acid encoding a Cbh1 protein (Cbh1) and a nucleic acid encoding a leghemoglobin (leghemoglobin CDS) (e.g., 5'-[pro]-[sig-seq]-[Cbh1]-[KEX2]-[leghemoglobin CDS]-3'). For example, during protein secretion in fungal cells, certain proteins are cleaved by KEX2, a member of the KEX2 or "kexin" family of serine peptidases (EC 3.4.21.61). As described in U.S. Patent Publication Nos. 2014 / 0024067 and 8,936,917 (each of which is incorporated herein by reference in its entirety), KEX2 is a highly specific, calcium-dependent endopeptidase that cleaves the peptide bond immediately C-terminal to a basic amino acid pair in protein substrates (e.g., globulins) during protein secretion (the "KEX2 site"). For example, a KEX2 site, as generally described in U.S. Patent Publication No. 2014 / 0024067, can be included in the construction of an expression cassette encoding one or more globulins. Similarly, U.S. Patent No. 8,936,917 describes a modified KEX2 cleavage site having a presequence (VAVE) that improves cleavage efficiency at the KEX2 site following the presequence. Although a KEX2 cleavage site has been exemplified, other protease cleavage sites that function in filamentous fungal cells can also be used to cleave the peptide linker between the protein fusion partner and the globin. Examples of additional protease-cleavable linkers include, but are not limited to, STE13 described in La Maquer et al. (2019) and the self-cleaving 2A peptide described in Subramanian et al. (2017).

[0208] In other embodiments, one or more of the globin encoding cassettes comprises a terminator region sequence operably linked and located at the 3' end.

[0209] In certain embodiments, the polynucleotides of the present disclosure can comprise one or more selectable markers. Selectable markers for use in filamentous fungi include, but are not limited to, als1, amdS, hygR, pyr2, pyr4, pyrG, sucA, a bleomycin resistance marker, a blasticidin resistance marker, a pyrithiamine resistance marker, a chlorimuron-ethyl resistance marker, a neomycin resistance marker, an adenine pathway gene, a tryptophan pathway gene, a thymidine kinase marker, and the like. In a particular embodiment, the selectable marker is pyr2, compositions and methods of use of which are generally set forth in PCT Publication No. WO 2011 / 153449.

[0210] Standard techniques for transforming filamentous fungi and culturing fungi, which are well known to those skilled in the art, are used to transform the fungal host cells of the present disclosure. Thus, introduction of a DNA construct or vector into a fungal host cell includes techniques such as: transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., liposome- and DEAE-dextrin-mediated transfection), incubation with a calcium phosphate DNA precipitate, high velocity bombardment with DNA-coated microprojectiles, biolistic or biolistic transformation, protoplast fusion, and the like. General transformation techniques are known in the art.

[0211] Generally, Trichoderma sp. fungal cells are transformed using protoplasts or cells that have been subjected to permeabilization, typically at a density of 10 5 to 10 7 mL, in particular about 2 x 10 6 mL. Volumes of 100 μL of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) are mixed with the desired DNA. Generally, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride, and the like can also be added to the uptake solution to facilitate transformation. Similar procedures can be used for other fungal host cells (see, e.g., US 6,022,725 and US 6,268,328, both of which are incorporated by reference).

[0212] Thus, the methods and compositions of the present disclosure generally rely on routine techniques in the field of recombinant genetics. For example, in certain embodiments, a gene encoding a heterologous protein of interest is introduced into a filamentous fungal (host) cell. In certain embodiments, the gene (or gene CDS) is cloned into an intermediate vector, which is then transformed into the filamentous fungal (host) cell for replication and / or expression. These intermediate vectors can be prokaryotic vectors, such as, for example, plasmids or shuttle vectors. In certain embodiments, expression of the gene or gene CDS encoding the protein is under the control of a heterologous promoter, which can be a heterologous constitutive promoter or a heterologous inducible promoter, in particular a strong promoter capable of overexpressing the protein.

[0213] Expression vectors typically contain a transcriptional unit or expression cassette containing all the additional elements required for expression of a heterologous sequence. For example, a typical expression cassette contains an upstream (5') promoter operably linked to a nucleic acid sequence encoding a protein of interest, and can further comprise nucleic acid sequences encoding protein (signal) secretion sequences, nucleic acid sequences required for efficient polyadenylation of the transcript, ribosome binding sites, and translation termination sequences. Additional elements of the cassette can include enhancers, and, if genomic DNA is used as the structural gene, introns with functional splice donor and acceptor sites.

[0214] In addition to the promoter sequence, the expression cassette can contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region can be obtained from the same gene as the promoter sequence or can be obtained from different genes. Although any fungal terminator can work in the present application, preferred terminators include the terminator from the cbhl gene of Trichoderma, the terminator from the trpC gene of Aspergillus nidulans, and the glucoamylase gene of A. awamori or A. niger.

[0215] The particular expression vector used to transport the genetic information into the cell is not of particular significance. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells can be used. Standard bacterial expression vectors include bacteriophages lambda and M13, as well as plasmids such as pBR322-based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags such as c-myc can also be added to the recombinant protein to provide a convenient method of isolation.

[0216] Elements that can be included in the expression vector can also be a replicon, a gene encoding antibiotic resistance that allows selection of bacteria carrying the recombinant plasmid, or unique restriction sites in non-essential regions of the plasmid that allow insertion of heterologous sequences. The particular antibiotic resistance gene selected is also not determinative, as any of a number of resistance genes known in the art can be suitable. The prokaryotic sequences are preferably selected so that they do not interfere with replication or integration of the DNA in the filamentous fungal host.

[0217] The transformation methods of the present disclosure can result in the stable integration of all or a portion of the transformation vector into the genome of the filamentous fungus. However, transformation resulting in maintenance of an extrachromosomally replicating transformation vector is also contemplated. A variety of standard transfection methods can be used to generate filamentous fungal cell lines that express large quantities of heterologous proteins, and thus, any known procedure for introducing foreign nucleotide sequences into a fungal host cell can be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistics, liposomes, microinjection, spheroplasts, viral vectors, and any other known method for introducing cloned genomic DNA, cDNA, synthetic DNA, or other foreign genetic material into a host cell. Agrobacterium-mediated transfection methods are also used, such as the transfection methods described in U.S. Patent No. 6,255,115.

[0218] Following introduction of the expression vector into the cell, the transformed cell is cultured under conditions favorable to expression of the gene. Large quantities of transformed cells can be cultured as described herein. Finally, the protein product is recovered from the culture using standard techniques. Thus, the present disclosure provides for the expression and improved production of a protein of interest, as described herein.

[0219] In one or more embodiments or aspects of the present disclosure, a filamentous fungal cell (strain) can comprise one or more genetic modifications, including but not limited to (a) introduction, substitution, or removal of one or more nucleotides in a gene (gene CDS or ORF thereof), or in a regulatory element required for transcription or translation of a gene (gene CDS or ORF), (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) gene down-regulation, (f) specific mutagenesis of a gene (gene CDS or ORF thereof), and / or (g) random mutagenesis.

[0220] As generally set forth above and generally described below, one of skill in the art can readily make one or more genetic modifications and construct a recombinant / modified / variant filamentous fungal strain thereof by reference to one or more nucleic acid sequences and / or protein sequences disclosed herein. For example, gene deletion techniques can enable partial or complete removal of a gene, thereby eliminating or reducing expression / production of a protein, and / or thereby eliminating or reducing expression / production of an encoded protein. In such methods, deletion of a gene can be accomplished by homologous recombination using an integration plasmid / vector that has been constructed to contain contiguous 5' and 3' regions flanking the gene. The contiguous 5' and 3' regions can be introduced into a filamentous fungal cell, e.g., on an integration plasmid / vector, in conjunction with a selectable marker to allow for integration of the plasmid in the cell.

[0221] In other embodiments, the modified strain of a filamentous fungus comprises a genetic modification that disrupts or inactivates a gene of interest. Exemplary methods of gene disruption / inactivation include disruption of any portion of a gene, including the polypeptide coding sequence (CDS), a promoter, an enhancer, or another regulatory element, including substitution, insertion, deletion, inversion, and combinations and variants thereof. Non-limiting examples of gene disruption techniques include insertion (integration) of an integration plasmid containing a nucleic acid fragment homologous to the gene of interest into one or more genes of the present disclosure, which will result in duplication of the homologous region and incorporation (insertion) of the vector DNA between the duplicated regions. In certain other non-limiting examples, gene disruption techniques include insertion of an integration plasmid containing a nucleic acid fragment homologous to the gene of interest into the gene of interest, which will result in duplication of the homologous region and incorporation (insertion) of the vector DNA between the duplicated regions, wherein the inserted vector DNA will, for example, separate the promoter from the protein coding region of the gene, or disrupt (break) the coding or non-coding sequences of the gene, resulting in a phenotype of increased protein production. The disruptive construct can be a selectable marker gene (e.g., pyr2) flanked by 5' and 3' regions homologous to the gene of interest. The selectable marker enables the identification of transformants containing the disrupted gene. Thus, in certain embodiments, gene disruption includes modification of gene control elements such as promoters, ribosomal binding sites (RBS), untranslated regions (UTRs), codon alterations, and the like.

[0222] In other embodiments, the modified strain of a filamentous fungus is constructed (i.e., genetically modified) by introducing, substituting, or removing one or more nucleotides in a gene or regulatory element required for the transcription or translation thereof. For example, nucleotides can be inserted or removed in order to introduce a premature stop codon, remove a start codon, or shift the open reading frame (ORF). Such modifications can be accomplished by site-directed mutagenesis or PCR-generated mutagenesis according to methods known in the art.

[0223] In other embodiments, the modified strain of a filamentous fungus is constructed by methods of gene conversion. For example, in a method of gene conversion, a nucleic acid sequence corresponding to a target gene is mutagenized in vitro to produce a defective nucleic acid sequence, which is then transformed into a parent cell to produce a variant cell comprising a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous gene. It can be desirable that the defective gene or gene fragment also encodes a marker that can be used to select for transformants containing the defective gene. For example, the defective gene can be introduced in association with a selectable marker on a non-replicating or temperature-sensitive plasmid. Selection for integration of the plasmid by selection for the marker under conditions that do not allow replication of the plasmid. Selection for a second recombination event that results in replacement of the gene is effected by examining colonies for loss of the selectable marker and acquisition of the mutated gene.

[0224] In other embodiments, modified strains of filamentous fungi are constructed using nucleotide sequences complementary to the nucleic acid sequence of the gene of interest through established antisense (gene silencing) techniques. More particularly, the expression of a gene of a filamentous fungal strain can be reduced (down-regulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the gene that is transcribed in the cell and is capable of hybridizing with mRNA produced in the cell. Under conditions that allow hybridization of the complementary antisense nucleotide sequence to the mRNA, the amount of protein translated is thus reduced or eliminated. Such antisense methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, and the like, all of which are well known to the skilled artisan.

[0225] In other embodiments, modified strains of filamentous fungi are constructed through random or specific mutagenesis using methods well known in the art, including but not limited to chemical mutagenesis and transposition. The modification of a gene can be performed by subjecting a parental cell to mutagenesis and screening for mutant cells in which expression of the gene has been reduced or eliminated. The mutagenesis can be specific or random, for example, by using a suitable physical or chemical mutagen, using a suitable oligonucleotide, or subjecting the DNA sequence to mutagenesis generated by PCR. Furthermore, the mutagenesis can be performed by using any combination of these mutagenic methods. Examples of physical or chemical mutagens suitable for the purposes of the present application include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), o-methylhydroxylamine, nitrous acid, ethylmethanesulfonate (EMS), sodium bisulfite, formic acid, and nucleotide analogs. When such reagents are used, the mutagenesis is typically performed by incubating the parental cell to be mutagenized in the presence of the selected mutagen under suitable conditions, and selecting for mutant cells that exhibit reduced or no expression of the gene.

[0226] In certain other embodiments, modified strains of filamentous fungi are constructed by means of site-specific gene editing techniques. For example, in certain embodiments, variant strains of filamentous fungi are constructed (i.e., genetically modified) by using transcriptional activator-like endonucleases (TALENs), zinc-finger nucleases (ZFNs), homing (large) endonucleases, and the like. More particularly, the portion of the gene to be modified (e.g., a coding region, a non-coding region, a leader sequence, a propeptide sequence, a signal sequence, a transcriptional terminator, a transcriptional activator, or other regulatory element required for expression of the coding region) is genetically modified by means of ZFN gene editing, TALEN gene editing, homing (large) endonuclease, and the like, which are well known to and can be used by those skilled in the art.

[0227] In certain other embodiments, a modified strain of filamentous fungus is constructed by way of CRISPR / Cas9 editing. More particularly, compositions and methods for fungal genome modification with the CRISPR / Cas9 system are described and well known in the art (e.g., see, PCT Publication Nos: WO 2016 / 100571, WO 2016 / 100568, WO 2016 / 100272, WO 2016 / 100562, etc.). Thus, a gene of interest can be disrupted, deleted, mutated, or otherwise genetically modified by way of a nucleic acid guided endonuclease that finds its target DNA by binding a guide RNA (e.g., Cas9) or guide DNA (e.g., NgAgo), which recruits the endonuclease to a target sequence on the DNA, where the endonuclease can generate a single or double strand break in the DNA. This targeted DNA break becomes a substrate for DNA repair and can recombine with a provided editing template to effect gene disruption or deletion. For example, a gene encoding a nucleic acid guided endonuclease (e.g., Cas9 from S. pyogenes or a codon optimized gene encoding a Cas9 nuclease) is operably linked to an active promoter in a filamentous fungal cell and an active terminator in a filamentous fungal cell, thereby producing a filamentous fungal Cas9 expression cassette. Likewise, one or more target sites specific to a gene of interest are readily identified by one of skill in the art. For example, to construct a DNA construct encoding a gRNA directed to a target site within a gene of interest, the variable targeting domain (VT) will comprise the nucleotides of the target site that are 5' of the (PAM) protospacer adjacent motif (TGG) fused to DNA encoding the Cas9 endonuclease recognition domain (CER) of S. pyogenes Cas9. The DNA encoding the VT domain and the DNA encoding the CER domain are combined, thereby generating DNA encoding a gRNA. Thus, a filamentous fungal expression cassette for a gRNA is produced by operably linking the DNA encoding the gRNA to an active promoter in a filamentous fungal cell and an active terminator in a filamentous fungal cell.

[0228] In certain embodiments, the DNA break induced by the endonuclease is repaired / replaced with an input sequence. For example, to effect precise repair of the DNA break generated by the Cas9 expression cassette and gRNA expression cassette described above, a nucleotide editing template is provided so that the DNA repair machinery of the cell can utilize the editing template. For example, about 500 bp 5' of the targeted gene can be fused to about 500 bp 3' of the targeted gene to generate an editing template that is utilized by the machinery of the filamentous fungal host to repair the DNA break generated by the RGEN (RNA guided endonuclease).

[0229] The Cas9 expression cassette, gRNA expression cassette, and editing template can be co-delivered to filamentous fungal cells using many different methods (e.g., protoplast fusion, electroporation, natural competence, or induced competence). Transformed cells are screened by PCR by amplifying the target locus with forward and reverse primers. These primers can amplify wild-type loci or modified loci that have been edited by RGEN. These fragments are then sequenced using sequencing primers to identify edited colonies.

[0230] Another way to genetically modify a gene of interest is by altering its expression level. For example, nuclease-deficient variants of such nucleotide-guided endonucleases (e.g., Cas9 D10A, N863A or Cas9 D10A, H840A) can be used to modulate gene expression levels by enhancing or antagonizing transcription of the target gene. These Cas9 variants are inactive against all nuclease domains present in the protein sequence but retain RNA-guided DNA binding activity (i.e., these Cas9 variants are unable to cleave either strand of DNA when bound to the cognate target site). Thus, nuclease-deficient proteins (i.e., Cas9 variants) can be expressed as filamentous fungal expression cassettes when combined with a filamentous fungal gRNA expression cassette, directing the Cas9 variant protein to a specific target sequence within the cell. Binding of the Cas9 (variant) protein to a specific gene target site can block the binding or movement of the transcriptional machinery on the cellular DNA, thereby reducing the amount of gene product produced. Thus, using this approach, any gene disclosed herein can be targeted for reduced gene expression. By using methods such as RNAseq, gene silencing can be monitored in cells containing a nuclease-deficient Cas9 expression cassette and one or more gRNA expression cassettes.

[0231] IV. Fermentation and Recovery of Globulins

[0232] As briefly stated in the aforementioned part, the bacterial strain and method of the present invention can be used for producing commercially important globulins in submerged cultures of filamentous fungi. For example, in certain embodiments, when fermented under conditions suitable for producing globulins, the recombinant (modified) filamentous fungal cells comprising the expression cassette introduced produce at least about 30 grams of total protein per liter of broth (g / L). In one or more other embodiments, when fermented under conditions suitable for producing globulins, the modified filamentous fungal cells comprising the expression cassette introduced produce at least about 0.5 grams of globulins per liter of broth (g / L). Therefore, in certain embodiments, total protein titer and globulin titer can be defined as the total protein amount (g / L) per volume and the globulin amount (g / L) per volume, respectively. For example, protein titer can be measured by methods known in the art (for example, ELISA, HPLC, Bradford assay, LC / MS, etc.).

[0233] In certain other embodiments, the modified filamentous fungal cells comprising the introduced cassette can be described by volumetric productivity, which is defined as the amount of protein (g) produced per nominal volume (L) of the bioreactor per total fermentation time (h) during fermentation. For example, volumetric productivity can be determined by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS, etc.).

[0234] In certain other embodiments, the modified filamentous fungal cells comprising the introduced cassette can be described in terms of total protein yield, where total protein yield is defined as the amount of protein (g) produced per gram of carbohydrate supplied relative to the (unmodified) parent strain. Thus, as used herein, total protein yield (g / g) can be calculated using the following equation:

[0235] Yf = Tp / Tc

[0236] where "Yf" is the total protein yield (g / g), "Tp" is the total protein produced during fermentation (g), and "Tc" is the total carbohydrates fed during fermentation (bioreactor) operation (g).

[0237] Total protein yield can also be described as carbon conversion efficiency / carbon yield, for example, as a percentage (%) of supplied carbon incorporated into total protein. Thus, in certain embodiments, a modified filamentous fungal cell comprising an introduced cassette can be described based on an increase in carbon conversion efficiency (e.g., an increase in the percentage (%) of supplied carbon incorporated into total protein).

[0238] In certain other embodiments, the modified filamentous fungal cells comprising the introduced cassette can be described in terms of the specific productivity (Qp) of the globulin. For example, determination of the specific productivity (Qp) is a suitable method for evaluating the rate of globulin production, where Qp can be determined using the following equation:

[0239] “Qp = gP / gDCW•hr”

[0240] Wherein "gP" is the grams of protein produced in the tank; "gDCW" is the grams of dry cell weight (DCW) in the tank; and "hr" is the fermentation time in hours from the time of inoculation, which includes production time as well as growth time.

[0241] In certain embodiments, the present disclosure provides, inter alia, compositions and methods for producing globulins, comprising fermenting filamentous fungal cells comprising one or more introduced globulin cassettes, wherein the fungal cells express and secrete (i.e., produce) the globulin. Generally, the fungal cells are fermented using fermentation methods well known in the art. In some embodiments, the fungal cells are grown under batch or continuous fermentation conditions.

[0242] Classic batch fermentation is a closed system in which the composition of the culture medium is set at the beginning of the fermentation and does not change during the fermentation. At the beginning of the fermentation, the culture medium is inoculated with the desired organism. In this method, fermentation is allowed to occur without adding any components to the system. Typically, batch fermentation qualifies as "batch" with respect to the addition of a carbon source, and attempts are often made to control factors such as pH and oxygen concentration. The metabolite and biomass composition of a batch system changes continuously until the fermentation is stopped. In batch cultures, cells progress through a static lag phase to a high growth log phase, and finally enter a stationary phase in which the growth rate decreases or stops. If left untreated, cells in the lag phase eventually die. Typically, cells in the log phase are responsible for the bulk production of the product.

[0243] A suitable variation of the standard batch system is the "fed-batch fermentation" system. In this variation of a typical batch system, substrate is added in increments as the fermentation progresses. Fed-batch systems are useful when catabolite repression may inhibit the metabolism of the cell and when it is desired to have a limited amount of substrate in the culture medium. The measurement of actual substrate concentration in a fed-batch system is difficult and is therefore estimated based on the variation of measurable factors such as pH, dissolved oxygen, and the partial pressure of waste gases (such as CO 2 ). Batch and fed-batch fermentation are commonly used and well known in the art.

[0244] Continuous fermentation is an open system in which a defined fermentation medium is continuously added to a bioreactor and an equal amount of conditioned medium is removed for processing. Continuous fermentation typically maintains a culture at a constant high density, with cells primarily in logarithmic phase growth. Continuous fermentation allows one or more factors affecting cell growth and / or product concentration to be regulated. For example, in one embodiment, a limiting nutrient (such as a carbon source or nitrogen source) is maintained at a fixed rate, and all other parameters are allowed to be regulated. In other systems, many factors affecting growth can constantly change, while the cell concentration measured by culture medium turbidity remains unchanged. Continuous systems strive to maintain steady-state growth conditions. Therefore, the cell loss caused by extracting culture medium should be balanced with the cell growth rate in the fermentation. The method for regulating the nutrients and growth factors used in continuous fermentation processes and the technology for maximizing product formation rate are well known in the field of industrial microbiology.

[0245] In addition to the carbon source and energy source, oxygen, assimilable nitrogen, and inoculum of microorganism, it is necessary to supply suitable amounts of mineral nutrients in appropriate proportions to ensure proper microbial growth, to maximize the assimilation of carbon source and energy source by the cells during the microbial conversion process, and to obtain maximum cell yield and maximum cell density in the fermentation medium.

[0246] The composition of the aqueous mineral medium can vary within a wide range, depending in part on the microorganism and substrate used, as is known in the art. In addition to nitrogen, these mineral media should include suitable amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium, in appropriate soluble assimilable ionic forms and combinations, and also preferably should be present certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, among others, also in suitable soluble assimilable forms, all as known in the art.

[0247] The fermentation reaction is an aerobic process in which the required molecular oxygen is supplied by a molecular oxygen-containing gas such as air, oxygen-enriched air, or even substantially pure molecular oxygen, provided that the contents of the fermentation vessel are maintained with a suitable partial pressure of oxygen that is effective to assist the microbial species to grow in a vigorous manner.

[0248] The microorganism also requires an assimilable nitrogen source. The assimilable nitrogen source can be any nitrogen-containing compound or capable of releasing nitrogen in a form suitable for metabolic utilization by the microorganism. While a variety of organic nitrogen source compounds such as protein hydrolysates can be employed, it is often convenient to utilize inexpensive nitrogen-containing compounds such as ammonia, ammonium hydroxide, urea, and a variety of ammonium salts (such as ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride, or a variety of other ammonia compounds). Ammonia gas itself is convenient for large-scale operations and can be used in suitable amounts by bubbling through the aqueous fermentation (fermentation medium). At the same time, ammonia can also be employed to assist in pH control.

[0249] The pH range in the aqueous microbial fermentation (fermentation mixture) should be in the exemplary range of about 2.0 to 8.0. In the case of filamentous fungi, the pH is typically in the range of about 2.5 to 8.0; in the case of Trichoderma reesei, the pH is typically in the range of about 3.0 to 7.0. The preferred pH range for the microorganism depends somewhat on the medium employed and the particular microorganism, and thus varies somewhat with the medium, as can be readily determined by one skilled in the art. In certain aspects, the fermentation is conducted in a manner such that the carbon-containing substrate can be controlled as the limiting factor, thus providing the cells with good conversion of the carbon-containing substrate and avoiding contamination of the cells with substantial amounts of unconverted substrate. The latter situation is not a problem with water-soluble substrates, since any residual trace amounts can be readily washed away. However, this can be a problem in the case of non-water-soluble substrates, and requires additional product handling steps such as suitable washing steps.

[0250] As mentioned above, the time to reach this level is not critical and may vary with the specific microorganism and fermentation process being performed. However, it is well known in the art how to determine the carbon source concentration in the fermentation medium and whether the desired carbon source level has been reached.

[0251] Fermentation can be performed as a batch or continuous operation, although fed-batch operation may be preferred for ease of control, production of uniform amounts of product, and most economical use of all equipment.

[0252] If desired, part or all of the carbon source and energy material and / or part of the assimilable nitrogen source (such as ammonia) may be added to the aqueous mineral culture medium before feeding the aqueous mineral culture medium to the fermentor.

[0253] Each stream introduced into the reactor is preferably controlled at a predetermined rate, or in response to demand that can be determined by monitoring, for example, the concentration of carbon and energy substrates, pH, dissolved oxygen, oxygen or carbon dioxide in the off-gas from the fermentor, cell density measurable by dry cell weight, light transmittance, etc. The feed rates of the various materials can be varied to achieve the fastest possible cell growth rate consistent with efficient utilization of the carbon source and energy source, and to achieve the highest possible microbial cell productivity relative to substrate changes.

[0254] In batch operation or preferably fed-batch operation, all equipment, reactors or fermentation apparatus, vessels or containers, piping, associated circulation or cooling equipment, etc. are initially sterilized, typically by applying steam, such as at about 121° C. for at least about 15 minutes. The sterilized reactor is then inoculated with a culture of the selected microorganism in the presence of all required nutrients, including oxygen and a carbon-containing substrate. The type of fermentor used is not critical.

[0255] The collection and purification of globulins from the fermentation broth can be performed by procedures known in the art. For example, as described above, the recombinant fungal strains of the present disclosure can be constructed to secrete one or more globulins into the fermentation broth, thereby simplifying the globulin recovery process (e.g., eliminating the need for cell lysis) and thereby reducing the cost of globulin production. The fermentation broth will typically contain cellular debris, including cells, various suspended solids and other biomass contaminants (which are removed from the fermentation broth by means known in the art), as well as the desired globulin.

[0256] In certain other embodiments or aspects, a purified globulin (protein) preparation can be derived or recovered from the collected and harvested fermentation broth.

[0257] As used herein, the terms "purified," "isolated," or "enriched" with respect to a globin protein means that the globin is transformed from a less pure state by separating it from some or all of the contaminants with which it is associated. Contaminants include, but are not limited to, microbial cells, metabolites, solvents, chemicals, color, aggregates, processing aids, inhibitors, fermentation media, cell debris, nucleic acids, proteins other than the target leghemoglobin, host cell proteins, cross-contaminants from production equipment, and the like.

[0258] Thus, in the context of "purified globin" as used herein, purification can be accomplished by art-recognized separation techniques including, but not limited to, ion exchange chromatography, affinity chromatography, hydrophobic separation, dialysis, protease treatment, heat treatment, ammonium sulfate precipitation or other protein salt precipitation, crystallization, centrifugation, size exclusion chromatography, filtration, microfiltration, gel electrophoresis, or gradient separation, to remove whole cells, cell debris, impurities, extraneous proteins, or enzymes that are not desired in the final composition.

[0259] Further ingredients that provide additional benefits can then be added to the purified or isolated globin composition, such as activators, anti-inhibitors, desired ions, compounds to control pH, or other enzymes or chemicals.

[0260] As used herein, globin "purity" is a relative term and is not intended to be limiting when used in phrases such as "the recovered globin has a higher purity than, the same purity as, or a lower purity than prior to the recovery process." For example, the relative "purity" of a globin protein before and after a recovery process can be determined using methods known in the art, including but not limited to general quantitative methods (e.g., Bradford, UV-Vis, activity assays), electrophoretic analysis (SDS-PAGE), analytical HPLC, mass spectrometry, hydrophobic interaction chromatography, and the like.

[0261] Non-limiting examples for assessing the relative purity of a globin include, but are not limited to, SDS-PAGE analysis and / or the A 280 Ratio of non-globin (impurities) to globin. For example, the relative globin purity determined via SDS-PAGE can be determined by the visual abundance of the globin (protein) band compared to the non-globin (unwanted contaminants; impurities) bands present in the preparation. Alternatively, the relative purity of a globin can be determined by the A 280 ) Ratio of non-globin to globin.

[0262] For example, the A 280The ratio is a measure of the amount of absorbance at 280 nm contributed by nonglobulin impurities for 1 unit of absorbance at 280 nm contributed by globulins in a protein preparation (e.g., nonglobulin A 280 / Globulin A 280 ), where smaller numbers mean higher purity. More specifically, for determining globulin (A 280 ) concentration can be measured by HPLC using purified globulin as a standard, where the concentration determined by HPLC is converted to globulin A using 1 mg / mL globulin at 280 nm absorbance = 1.00. 280 Used to determine the nonglobulin (A 280 ) concentration method can be measured using a 1 cm path cuvette zeroed with MilliQ water, and diluted to A with MilliQ water as needed. 280 < 1, where globulin A is subtracted from the preparation measurement 280 To calculate nonglobulin A 280 concentration.

[0263] Thus, in one or more embodiments or aspects of the present disclosure, globulins are recovered from a fermentation broth of filamentous fungal cells fermented under conditions suitable for the production of globulins. In certain embodiments, the filamentous fungal host cells are constructed to secrete the globulins into the fermentation broth, wherein the globulins are recovered in the end-of-fermentation (EOF) broth. In certain other embodiments, such as when the filamentous fungal host cells have been constructed for intracellular globulin expression, the EOF fermentation broth is subjected to a cell lysis process, wherein the globulins are recovered from the lysed cell broth.

[0264] Therefore, in one or more embodiments or aspects, after performing one or more recovery processes described herein, the recovered globulin has a higher purity. For example, the fermentation broth (e.g., the whole broth at the end of fermentation) can be subjected to one or more protein recovery processes, including but not limited to broth conditioning, broth clarification, protein enrichment and / or protein purification (e.g., protein concentration, filtration, precipitation, crystallization, crystal separation, crystal sludge dissolution, etc.), buffer exchange, sterile filtration, etc. In some aspects, the fermentation broth is subjected to a broth treatment (broth conditioning) process to improve subsequent broth processing characteristics. In certain other embodiments, such as when filamentous fungal host cells have been constructed for intracellular globulin expression, the fermentation broth is subjected to a cell lysis process before the globulin is recovered. Cell lysis processes include but are not limited to enzyme treatment (e.g., lysozyme, proteinase K treatment), chemical means (e.g., ionic liquids), physical means (e.g., French press, ultrasound), simply maintaining the culture without feed, etc.

[0265] Thus, as described herein, the methods / processes disclosed herein are not intended to be limiting, as a skilled artisan can readily adapt or modify one or more of the compositions and / or methods disclosed herein for the recovery of specific globulins and / or combinations thereof. In certain aspects, the fermentation broth obtained by fermenting filamentous fungal cells that express and secrete globulins can be processed by harvesting, clarifying, and concentrating the broth, as generally described herein.

[0266] V. Exemplary Embodiments

[0267] Non-limiting embodiments of the present disclosure include, but are not limited to:

[0268] 1. A recombinant filamentous fungal cell expressing a heterologous globulin.

[0269] 2. A recombinant filamentous fungal cell which, when fermented under suitable conditions, expresses and secretes a heterologous globulin.

[0270] 3. The recombinant cell of embodiment 1 or embodiment 2, wherein the recombinant cell is selected from the group consisting of: an Acremonium species cell, an Aspergillus species cell, a Cephalosporium species cell, a Fusarium species cell, a Humicola species cell, a Mucor species cell, a Myceliophthora species cell, a Neurospora species cell, a Penicillium species cell, a Cylindrotheca species cell, a Talaromyces species cell, a Thielavia species cell, a Tolypocladium species cell, and a Trichoderma species cell.

[0271] 4. The recombinant cell of any one of embodiments 1-3, comprising an introduced expression cassette encoding the globulin, wherein the cassette comprises an upstream (5') promoter (pro) sequence, the upstream (5') promoter (pro) sequence operably linked to a downstream nucleic acid (sig-seq) encoding a protein (signal) secretion sequence, the downstream nucleic acid (sig-seq) encoding a protein (signal) secretion sequence operably linked to a downstream (3') nucleic acid (globulin CDS) encoding the globulin.

[0272] 5. The recombinant cell of embodiment 4, wherein the nucleic acid encoding the globin protein (globin CDS) comprises an upstream (5') nucleic acid encoding an N-terminal protein fusion (N-fusion).

[0273] 6. The recombinant cell of embodiment 4, wherein the nucleic acid encoding the globin protein (globin CDS) comprises an upstream (5') nucleic acid encoding an N-terminal protein cleavage site (N-linker).

[0274] 7. The recombinant cell of embodiment 4, wherein the nucleic acid encoding the globin protein (globin CDS) comprises a downstream (3') nucleic acid encoding a C-terminal protein fusion (C-fusion).

[0275] 8. The recombinant cell of embodiment 4, wherein the nucleic acid encoding the globin protein (globin CDS) comprises a downstream (3') nucleic acid encoding a C-terminal protein cleavage site (C-linker).

[0276] 9. The recombinant cell of embodiment 4, wherein the nucleic acid encoding the globin protein (globin CDS) comprises an upstream (5') nucleic acid encoding an N-terminal protein fusion (N-fusion) and a downstream (3') nucleic acid encoding a C-terminal protein fusion (C-fusion).

[0277] 10. The recombinant cell of embodiment 4, wherein the nucleic acid encoding the globin protein (globin CDS) comprises an upstream (5') nucleic acid encoding an N-terminal protein cleavage site (N-linker) and a downstream (3') nucleic acid encoding a C-terminal protein cleavage site (C-linker).

[0278] 11. The recombinant cell of any one of claims 4 to 10, wherein the nucleic acid encoding the globin (globin CDS) comprises a combination of any sequence of upstream nucleic acids encoding an N-terminal protein fusion and an N-terminal protein cleavage site, and / or a combination of any sequence of downstream nucleic acids encoding a C-terminal protein fusion and a C-terminal protein cleavage site.

[0279] 12. The recombinant cell of any one of embodiments 4-11, wherein the cassette further comprises a terminator sequence operably linked to and located at the 3' end of the cassette.

[0280] 13. The recombinant cell of any one of embodiments 4-12, wherein the cassette is integrated into the genome of the cell.

[0281] 14. The recombinant cell of any one of embodiments 4-13, comprising at least two introduced polynucleotides encoding the same or different globulins and / or at least two introduced expression cassettes encoding the same or different globulins.

[0282] 15. The recombinant cell of any one of embodiments 1-14, further comprising an introduced expression cassette encoding a protease inhibitor.

[0283] 16. The recombinant cell of embodiment 15, wherein the protease inhibitor is selected from the group consisting of: native barley amylase / subtilisin inhibitor (BASI) protein and functional variants thereof, native soybean trypsin inhibitor (STI) protein and functional variants thereof, native Bowman-Birk inhibitor (BBI) protein and functional variants thereof, native Kunitz-type inhibitor (KTI) protein and functional variants thereof, native potato metallo-carboxypeptidase inhibitor protein and functional variants thereof.

[0284] 17. The recombinant cell of any one of embodiments 1-16, further comprising a deletion of one or more endogenous genes encoding one or more secreted proteases.

[0285] 18. The recombinant cell of embodiment 17, wherein the one or more proteases are selected from the group consisting of: subtilisin-like serine proteases, aspartic proteases, trypsin-like serine proteases, glutamic proteases, and aminopeptidases.

[0286] 19. The recombinant cell of any one of embodiments 1-18, fermented for at least about 96 hours to about 300 hours.

[0287] 20. The recombinant cell of embodiment 19, wherein the cell produces at least 0.1 grams of globin per liter of fermentation broth (g / L).

[0288] 21. The recombinant cell of embodiment 19, wherein the cell produces at least 0.2 to 0.5 grams of globin per liter of fermentation broth (g / L).

[0289] 22. The recombinant cell of embodiment 19, fermented for about 180-190 hours.

[0290] 23. The recombinant cell of embodiment 22, wherein the cell produces at least 1 gram of globin per liter of fermentation broth (g / L).

[0291] 24. The recombinant cell of embodiment 1 or embodiment 2, wherein the globin is selected from the group consisting of: leghemoglobin, myoglobin, hemoglobin, cyanoglobin, and non-symbiotic hemoglobin.

[0292] 25. The recombinant cell of embodiment 24, wherein the leghemoglobin has at least about 60% to 100% sequence identity to the native soybean leghemoglobin (SEQ ID NO: 1), or at least 60% to 100% sequence identity to the native French bean leghemoglobin (SEQ ID NO: 19).

[0293] 26. The recombinant cell of embodiment 24, wherein the myoglobin has at least about 60% to 100% sequence identity to native bovine myoglobin (SEQ ID NO: 3).

[0294] 27. The recombinant cell of embodiment 24, wherein the globin comprises a globin superfamily domain and a functional porphyrin (heme) binding site.

[0295] 28. A method for producing a heterologous globin in a filamentous fungal cell, the method comprising: introducing an expression cassette encoding a globin into the filamentous fungal cell, wherein the cassette comprises an upstream (5') promoter (pro) sequence operably linked to a downstream nucleic acid (sig-seq) encoding a protein (signal) secretion sequence operably linked to a downstream (3') nucleic acid (globin CDS) encoding the globin; and fermenting the modified cell under conditions suitable for producing the globin.

[0296] 29. The method of embodiment 28, wherein the filamentous fungal cell is selected from the group consisting of Acremonium sp. cells, Aspergillus sp. cells, Chrysosporium sp. cells, Fusarium sp. cells, Humicola sp. cells, Mucor sp. cells, Myceliopthora sp. cells, Neurospora sp. cells, Penicillium sp. cells, Phanerochaete sp. cells, Piptoporus sp. cells, Talamys sp. cells, Trichoderma sp. cells, and Trichophaea sp. cells.

[0297] 30. The method of embodiment 28, wherein the nucleic acid (globin CDS) encoding the globin comprises an upstream (5') nucleic acid (N-fusion) encoding an N-terminal protein fusion.

[0298] 31. The method of embodiment 28, wherein the nucleic acid (globin CDS) encoding the globin comprises an upstream (5') nucleic acid (N-linker) encoding an N-terminal protein cleavage site.

[0299] 32. The method of embodiment 28, wherein the nucleic acid (globin CDS) encoding the globin comprises a downstream (3') nucleic acid (C-fusion) encoding a C-terminal protein fusion.

[0300] 33. The method of embodiment 28, wherein the nucleic acid (globin CDS) encoding the globin comprises a downstream (3') nucleic acid (C-linker) encoding a C-terminal protein cleavage site.

[0301] 34. The method of embodiment 28, wherein the nucleic acid encoding the globin protein (globin CDS) comprises an upstream (5') nucleic acid encoding an N-terminal protein fusion (N-fusion) and a downstream (3') nucleic acid encoding a C-terminal protein fusion (C-fusion).

[0302] 35. The method of embodiment 28, wherein the nucleic acid encoding the globin protein (globin CDS) comprises an upstream (5') nucleic acid encoding an N-terminal protein cleavage site (N-linker) and a downstream (3') nucleic acid encoding a C-terminal protein cleavage site (C-linker).

[0303] 36. The method of any one of embodiments 28-35, wherein the nucleic acid encoding the globulin (globulin CDS) comprises a combination of any order of upstream nucleic acids encoding an N-terminal protein fusion and an N-terminal protein cleavage site, and / or a combination of any order of downstream nucleic acids encoding a C-terminal protein fusion and a C-terminal protein cleavage site.

[0304] 37. The method of any one of embodiments 28-36, wherein the cassette further comprises a terminator sequence operably linked to and located at the 3' end of the cassette.

[0305] 38. The method of any one of embodiments 28-37, wherein the cassette is integrated into the genome of the cell.

[0306] 39. The method of any one of embodiments 28-38, comprising at least two introduced polynucleotides encoding the same or different globulins, and / or comprising at least two introduced expression cassettes encoding the same or different globulins.

[0307] 40. The method of any one of embodiments 28-39, further comprising introducing an expression cassette encoding a protease inhibitor.

[0308] 41. The method of embodiment 40, wherein the protease inhibitor is selected from the group consisting of: natural barley amylase subtilisin inhibitor (BASI) protein and functional variants thereof, natural soybean trypsin inhibitor (STI) protein and functional variants thereof, natural Bowman-Birk inhibitor (BBI) protein and functional variants thereof, natural Kunitz-type inhibitor (KTI) protein and functional variants thereof, natural potato metallocarboxypeptidase inhibitor protein and functional variants thereof.

[0309] 42. The method of any one of embodiments 28-41, further comprising deletion of one or more endogenous genes encoding one or more secreted proteases.

[0310] 43. The method of embodiment 42, wherein the one or more proteases are selected from the group consisting of subtilisin-like serine proteases, aspartic proteases, trypsin-like serine proteases, glutamic proteases, and aminopeptidases.

[0311] 44. The method of any one of embodiments 28-43, wherein the cells are fermented for at least about 96 hours to about 300 hours.

[0312] 45. The method of embodiment 44, wherein the cells produce at least 0.1 grams of globulin per liter of fermentation broth (g / L).

[0313] 46. ​​The method of embodiment 44, wherein the cells produce at least 0.2 to 0.5 grams of globulin per liter of fermentation broth (g / L).

[0314] 47. The method of embodiment 44, wherein the fermentation is carried out for about 180-190 hours.

[0315] 48. The method of embodiment 47, wherein the cell produces at least 1 gram of globulin per liter of fermentation broth (g / L).

[0316] 49. The method of embodiment 28, wherein fermenting the modified cells under conditions suitable for production of the globulin does not require or include a hemin medium supplement and / or does not require a 5-aminolevulinic acid (ALA) medium supplement.

[0317] 50. The method of embodiment 28, wherein engineering of a heme biosynthetic pathway is not required or included in the modified cell in order to produce the globin.

[0318] 51. The method of any one of embodiments 28-50, wherein the expressed globulin is secreted and recovered from the fermentation broth.

[0319] 52. The method of embodiment 51, wherein the recovered globulin is purified.

[0320] 53. The method of embodiment 28, wherein the globulin is selected from the group consisting of leghemoglobin, myoglobin, hemoglobin, cyanoglobin, and non-symbiotic hemoglobin.

[0321] 54. The method of embodiment 53, wherein the leghemoglobin has at least about 60% to 100% sequence identity to the native soybean leghemoglobin (SEQ ID NO: 1), or at least about 60% to 100% sequence identity to the native French bean leghemoglobin (SEQ ID NO: 19).

[0322] 55. The method of embodiment 53, wherein the myoglobin has at least about 60% to 100% sequence identity to native bovine myoglobin (SEQ ID NO: 3).

[0323] Examples

[0324] Certain aspects of the application can be further understood from the following examples, which should not be construed as limiting. Modifications to materials and methods will be apparent to those skilled in the art. Standard recombinant DNA and molecular cloning techniques used herein are well known and widely varied in the art (Ausubel et al., 1987; Sambrook et al., 1989).

[0325] Example 1

[0326] Expression and secretion of heterologous leghemoglobin

[0327] As briefly described above, Applicants of the present disclosure have contemplated, designed and constructed recombinant (modified) filamentous fungal cells capable of producing heterologous globin proteins. In certain embodiment(s), a recombinant polynucleotide (e.g., expression cassette) encoding one or more heterologous globin proteins is introduced into a filamentous fungal cell of the present disclosure. For example, in certain embodiments, an expression cassette encoding a secreted globin protein comprises (in the 5' to 3' direction) a promoter (pro) region sequence operably linked to a nucleic acid encoding a protein (signal) secretion sequence (sig-seq) operably linked to a nucleic acid encoding a globin protein (globin CDS), etc.

[0328] A. Construction of vectors for expression of soybean leghemoglobin as a secreted protein

[0329] One strategy for improving heterologous globin expression in filamentous fungal strains is to express the gene of interest (GOI) with a signal sequence and a strong promoter, such as the Trichoderma reesei cellobiohydrolase I gene promoter (Pcbhl). In particular, to express the soybean leghemoglobin C2 gene (NP_001235248.2, Gl: 1229203762), the gene was codon-optimized for expression in T. reesei (SEQ ID NO: 2). For example, a synthetic DNA sequence (Twist Biosciences, San Francisco, CA) comprising a codon-optimized leghemoglobin C2 gene (named “LegGmlb”) was synthesized using GeneArt Seamless Cloning and Assembly Enzyme Mix (Thermo Fisher Scientific, Carlsbad, CA), which included either the native Cbh1 signal sequence (SEQ ID NO: 13) or the native Pep1 signal sequence (SEQ ID NO: 14).

[0330] The backbone of the expression vector was amplified from a plasmid comprising 1 kb upstream (5') flanking homology sequence suitable for integration into a genomic locus of a T. reesei strain, cbhl promoter (Pcbhl) sequence (SEQ ID NO: 11), Cbh1 protein secretion sequence (SEQ ID NO: 13) or Pep1 protein secretion sequence (SEQ ID NO: 14), cbhl terminator (Tcbhl) region sequence (SEQ ID NO: 15), T. reesei pyr2 gene marker sequence (SEQ ID NO: 16) for transformation in T. reesei, 1 kb downstream (3') flanking homology sequence suitable for integration into a genomic locus of a T. reesei strain, and bacterial vector sequences for selection and maintenance of the E. coli plasmid. Synthetic DNA encoding leghemoglobin (LegGmlb) contained 25 bp 5' flanking sequence overlapping the cbhl promoter (Pcbhl) region and contained 25 bp 3' flanking sequence overlapping the cbhl terminator (Tcbhl) region. This vector construct generated a leghemoglobin expression vector named pCHL853 (pl -Pcbhl-LegGmlb; SEQ ID NO: 36) and pCHL856 (pl -Pcbhl-LegGmlb-peplss; SEQ ID NO: 37), as shown in Table 1 below.

[0331] B. Constructing a vector for expressing French bean leghemoglobin as a secreted protein

[0332] French bean leghemoglobin (SEQ ID: 19, NCBI Accession No. AAA33767.1) is a second exemplary globulin, for which the applicants have constructed and screened recombinant filamentous fungal strains for expression and secretion. More specifically, a synthetic DNA sequence encoding French bean leghemoglobin (LegPv1b; SEQ ID NO: 19) has been codon-optimized for expression in Trichoderma reesei cells. For example, French bean leghemoglobin (LegPv1b) was synthesized (Twist Biosciences), and expression constructs were constructed similarly to LegGm1b into pCHL852.

[0333] C. Construction of a vector for expressing soy leghemoglobin as a secreted fusion protein

[0334] Another strategy for improving the expression / production of heterologous globulins in filamentous fungal strains is to express the globulin gene of interest (GOI), typically a highly expressed native filamentous fungal protein, such as the Trichoderma reesei lignocellulose-degrading enzymes Cbh1, Cbh2, Eg1, Eg2, glucoamylase, etc., with an N-terminal fusion protein. The globulin GOI encoding the globulin can be linked (fused) to the gene for the highly expressed native filamentous fungal protein (e.g., Cbh1) via a linker peptide sequence that is cleavable by native proteases (e.g., a Kex2 site; SEQ ID NO: 18; Goller et al., 1998). The globulin can also be linked to other stabilizing domains of the highly expressed filamentous fungal protein, such as the Cbh1 core domain (i.e., Cbh1 without the C-terminal cellulose-binding domain; SEQ ID NO: 7).

[0335] For expression of soybean leghemoglobin and bovine myoglobin, the Cbh1 full-length mature protein (Cbh1 FL; SEQ ID NO: 9) or the Cbh1 core protein domain (Cbh1 core; SEQ ID NO: 7) can be used as exemplary N-terminal fusion partners (see Table 1). The leghemoglobin C2 gene was codon-optimized for expression in Trichoderma reesei. A synthetic DNA sequence (Twist Biosciences, San Francisco, CA) containing the codon-optimized leghemoglobin C2 gene (LegGm1b; SEQ ID NO: 2) was synthesized using the GeneArt Seamless Cloning and Assembly Enzyme Mix (Thermo Fisher Scientific, Carlsbad, CA) and containing upstream (5') and downstream (3') flanking sequences for constructing a leghemoglobin fusion protein expression vector. More specifically, the backbone of the expression vector was amplified from a plasmid containing the following features: 1 kb upstream (5') flanking homology sequences suitable for integration into the pre-selected genomic locus "TrC114F" located at the single guide RNA sgRNA-TrC144F of the T. reesei strain (SEQ ID NO: 45; 5'- GCUUUCGCCUUACUUCUGCA GGG The kit includes a targeting site for the cbh1 promoter (Pcbh1) region (SEQ ID NO: 11); a DNA sequence encoding the Cbh1 secretion signal (SEQ ID NO: 13); a DNA sequence encoding the core domain of the Cbh1 protein (Cbh1 Core; SEQ ID NO: 7); a DNA sequence encoding a Kex2 protease cleavage site (SEQ ID NO: 18); and a cbh1 terminator (Tcbh1) region sequence (SEQ ID NO: 15). The kit also includes a Trichoderma reesei pyr2 gene (marker) cassette as a selectable marker for transformation in Trichoderma reesei; 1 kb of 3' flanking homology sequence downstream of the "TrC144F" locus; and bacterial vector sequences for selection and maintenance of the plasmid in Escherichia coli. A synthetic DNA sequence (LegGm1b; SEQ ID NO: 2) encoding leghemoglobin (SEQ ID NO: 1) contains 25 base pair (bp) upstream (5') flanking sequences that overlap with the Cbh1 core-KEX2 region and 25-bp downstream (3') flanking sequences that overlap with the cbh1 terminator (Tcbh1) region. This vector construct generates a leghemoglobin expression vector named "pLH1088" (SEQ ID NO: 38).

[0336] A second soybean hemoglobin expression vector was constructed for expression of a fusion of soybean hemoglobin with the complete (full-length mature) Cbh1 protein. This vector included the following features: 1 kilobase (kb) upstream (5') flanking homology sequence at the "TrC114F" locus as described above, cbh1 promoter region sequence (SEQ ID NO: 11), full-length Cbh1 sequence including Cbh1 signal sequence and C-terminal cellulose binding domain (Cbh1 FL), KEX2 sequence (SEQ ID NO: 18), followed by the soybean hemoglobin gene CDS (LegGmlb), cbh1 terminator region (SEQ ID NO: 15), and 1 kb downstream (3') flanking homology sequence at the genomic locus "TrC114F". The remainder of the expression vector contained the Trichoderma reesei pyr2 gene and bacterial vector sequences for selection and maintenance of the plasmid in E. coli. The resulting expression vector was designated "pLH1104" (SEQ ID NO: 39).

[0337] An analogous vector was constructed identical to pLH1104 except that the expressed soybean hemoglobin had both an N-terminal Cbh1 fusion and a C-terminal 6-His tag fusion, designated "pLH1105" (SEQ ID NO: 40).

[0338] Example 2

[0339] Expression and secretion of heterologous bovine myoglobin

[0340] The bovine myoglobin gene (Mb; NP_776306.1, GI: 27806939) was codon-optimized (Mb1b, SEQ ID NO: 4) for expression in Trichoderma reesei, and a synthetic DNA fragment containing Mb1b was obtained from Twist Biosciences. An Mb1b expression vector was constructed to express a fusion protein with the full-length Cbh1 (Cbh1 FL) protein. This vector contains the following features: 1 kb of 5' flanking homology sequence at the targeted genomic locus, the Pcbh1 promoter, the full-length Cbh1 sequence (Cbh1 FL), the KEX2 sequence, followed by the synthetic Mb1b coding sequence, the Tcbh1 terminator, the pyr2 selectable marker, and 1 kb of 3' flanking homology sequence at the targeted genomic locus. The remainder of the expression vector contains bacterial vector sequences for selection and maintenance of the plasmid in Escherichia coli. The full-length Cbh1-myoglobin (fusion) protein expression vector (Cbh1FL-Mb1b) was named “pLH1106” (pI1-Pcbh1-Cbh1FL-Mb1b), and the full-length Cbh1-myoglobin-His6 (fusion) protein expression vector was named “pLH1107” (pI1-Pcbh1-Cbh1FL-Mb1b-His6).

[0341] Table 1

[0342] Globin expression cassette genetic element

[0343]

[0344] Table 2

[0345] Chromosomal integration vector for expression of leghemoglobin, myoglobin, and BASI

[0346]

[0347] Example 3

[0348] Cas9-directed targeted integration of a leghemoglobin expression cassette into the Trichoderma reesei genome

[0349] In this example, Trichoderma reesei strains expressing leghemoglobin and myoglobin were generated by Cas9-guided targeted genome integration via homologous recombination (HR) or non-homologous end joining (NHEJ) mechanisms. The Cas9-ribonucleoprotein complex (Cas9 RNP) is composed of a Cas9 protein and a single guide RNA (sgRNA). After the Cas9 RNP complex and the targeting integration cassette protoplasts are transformed into Trichoderma reesei cells, the Cas9 RNP enters the nucleus via a nuclear localization signal (NLS) at the C-terminus of the Cas9 protein. The guide RNA then guides the Cas9 RNP to the targeted genomic locus for double-strand cleavage, followed by repair by the integration cassette containing homologous sequences at both ends of the cleavage site or by various DNA repair mechanisms such as NHEJ (non-homologous end joining). For targeting via homologous recombination methods, 50 bp to 1000 bp of sequence homologous to both the 5' and 3' ends of the integration locus is typically included in the integration cassette. 1 kb of 5' and 3' homologous sequences are included in the integration cassette constructed for leghemoglobin or myoglobin to improve the efficiency of chromosomal integration and homology-based recombination at the desired locus.

[0350] To construct leghemoglobin and myoglobin expressing strains, the linear expression cassette was amplified by PCR using primers OT4268 and OT4269 (see Table 3 below) to generate the following DNA fragment containing 5' and 3' one (1) kb flanking sequences for Cas9 targeted chromosomal integration at a chromosomal locus.

[0351] Table 3

[0352] PCR primers for amplifying chromosomal integration cassettes

[0353]

[0354] PCR reactions were set up in 6x PCR strips, each containing eight PCR tubes, each containing a 50 μL reaction, for a total volume of 1.2 mL. A 5' PCR primer (OT4268) and a 3' PCR primer (OT4269) were added to a final concentration of 0.5 μM, along with 0.5 μg / mL of template DNA plasmid (Table 2). PCR reactions were performed using NEB-NEXT PCR Master Mix (New England Biolabs, Massachusetts) using the following conditions: 98°C for 30 seconds; 35 cycles of (98°C for 10 seconds; 70°C for 30 seconds; 72°C for 4 minutes); and 72°C for 4 minutes. Final PCR products (HG1-HG7, Table 2) were digested with DpnI enzyme (New England Biolabs) to remove plasmid template DNA. The reaction mixture was purified using the Zymo DNA Clean and Concentrator following the manufacturer's protocol (ZymoResearch, Irvine, CA) and dissolved in the elution buffer provided in the kit to a final concentration of 0.5-1.0 μg / μL.

[0355] The Cas9 RNP complex for targeted chromosomal integration of the above-mentioned expression cassette was generated as follows: sgRNA targeting a locus (TrC114F, excluding the protospacer adjacent motif (PAM) sequence "GGG") in the T. reesei genome was obtained from Synthego (South San Francisco, CA) with the RNA sequence of SEQ ID NO: 45 (5'-GCUUUCGCCUUACUUCUGCA-3') and dissolved to 100 μM in TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). The Cas9 RNP assembly reaction contained 12 μM Cas9 protein (New England Biolabs) and 12 μM sgRNA-EclipseA in 1x NEB 3.1 buffer (New England Biolabs). The reaction was incubated at room temperature for 10 minutes and stored on ice until protoplast transformation. Protoplast transformation of the Trichoderma reesei host was performed as follows: 5 μL of Cas9RNP complex, 4 μg of linear integration cassette PCR product and 300 μL of Trichoderma reesei protoplasts (10 8 The transformation reaction was plated on Vogel agar (for selection of the pyr2 marker) and incubated at 32°C for 5 days. Single colonies were picked from the Vogel agar plate and transferred to fresh Vogel agar plates, which were incubated at 32°C for 3 days.

[0356] Colonies were then screened for the expression of leghemoglobin or myoglobin by inoculating colonies in 1 mL of NREL medium (pH 6.5) in microtiter plates at 28°C for 4 days with the addition of 1x Halt protease inhibitor cocktail (Thermo Fisher Scientific). SDS-PAGE analysis was performed to screen transformants for production of full-length Cbh1 protein (54 kDa), Cbh1 core domain protein (50 kDa), leghemoglobin (16 kDa), myoglobin (17 kDa), or 6-histidine-tagged fusion proteins. Integration of the linear expression cassette at the desired locus was screened and verified by colony PCR amplification of T. reesei transformants using primers OT4333 and OT4334.

[0357] To evaluate the ability of native proteases secreted by Trichoderma reesei to reduce the proteolytic degradation of secreted leghemoglobin and secreted myoglobin, an expression cassette for the barley amylase subtilisin (protease) inhibitor (BASI, SEQ ID NO: 6) was incorporated into certain strains for co-expression of leghemoglobin or myoglobin with BASI. The BASI expression cassette contains the cbh2 promoter region (Pcbh2; SEQ ID NO: 12), a DNA sequence encoding the Pep1 signal sequence (SEQ ID NO: 14), the BASI gene CDS (SEQ ID NO: 6), and the TrpC terminator (TTrpC) region (SEQ ID NO: 46). Using pLH1108 as a template, primers OT4337 and OT4338, and NEB-NEXT master mix, the Pcbh2-BASI cassette was PCR amplified (98°C, 30 s; 35 cycles of (98°C, 10 s; 70°C, 30 s; 72°C, 4'); 72°C, 4') to generate a 4 kb product (HG8).

[0358] To construct a Trichoderma reesei strain co-expressing leghemoglobin and BASI, the linear integration cassette HG3 amplified from pLH1088 (PCR primers OT4268 and OT4269) and HG8 amplified from pLH1108 (PCR primers OT4337 and OT4338) were co-transformed with Cas9 RNP-sgRNA-TrC114F into Trichoderma reesei protoplasts. While the HG3 cassette integrated at the locus, as confirmed by colony PCR (using OT4333 and OT4334 as primers), the HG8 cassette, which does not contain sequences homologous to the 5' or 3' of the Trichoderma reesei genome, was randomly integrated into the genome. Transformants were inoculated in 1 mL wells of a 24-well microtiter plate containing NREL media (pH 6.5, lx Halt protease inhibitor cocktail) at 28°C for 4 days and analyzed for expression of leghemoglobin (or myoglobin) and BASI by SDS-PAGE.

[0359] Example 4

[0360] Expression and production of CBH1 -leghemoglobin (N-terminal) fusion protein by secretion

[0361] Trichoderma reesei strain BFZ28 (Pcbhl-CBHl core-KEX2-LegGmlb) was subjected to a fed-batch fermentation run in a two (2) L bioreactor as generally described in PCT Publication No. WO 2004 / 035070 (incorporated herein by reference). In particular, the cells were first grown in minimal media containing 75 g / L glucose until the glucose was depleted. The production phase was initiated by combining fed glucose and inulos at pH 6.5, while adding 30 g / L VEG-Pro as a nutritional supplement for inducing protein expression under the control of the cbhl promoter (Pcbhl). For example, 10 mL whole broth samples were taken every twenty-four (24) hours and frozen at -20°C, with a total fermentation time of about 180 hours. The harvested whole broth samples were thawed and centrifuged. As shown in FIG. 2, the red (dark red) color formation in the supernatant indicates globulin secretion into the culture supernatant. Also, as shown in FIG. 3, the supernatant was analyzed by SDS-PAGE, where the upper approximately (~) 55 kDa protein band is the Cbhl core protein, and the leghemoglobin (~16 KDa) co-migrates with the ~20 kDa BASI protease inhibitor, or is present as a minor band at ~17 kDa. Figure 3 Figure 5

[0362] To verify expression of leghemoglobin, HPLC analysis of a 188 hour supernatant sample from the BFZ28 strain fermentation run was performed as described in Example 1, above. As shown in FIG. 4, the leghemoglobin peak is present at ~16 kDa, which is consistent with the expected size of the protein. Figure 6 ​​The fermentation supernatant was further analyzed using a chromatographic spectrophotometer (MS / MS). The heme prosthetic group of leghemoglobin was detected at 410 nm, co-migrating with the protein peak detected at 280 nm with a retention time of 6.4 minutes. Figure 6 The inset shows a spectral scan of the leghemoglobin peak at a retention time of 6.4 minutes. This confirms the peak absorbance of leghemoglobin at 410 nm.

[0363] Example 5

[0364] Co-expression and production of secretory leghemoglobin and secretory protease inhibitors

[0365] Three fed-batch fermentation runs were performed in two (2) L bioreactors for the following three T. reesei strains: (1) BGJ74 (Pcbh1-LegGm1b, Pcbh2-BASI), for direct expression of soybean leghemoglobin under the cbh1 promoter; (2) BGJ75 (Pcbh1-Pv1b, Pcbh2-BASI), for direct expression of French bean leghemoglobin under the cbh1 promoter; and (3) BGJ76 (Pcbh1-LegGm1b.Pep1ss, Pcbh2-BASI), for direct expression of soybean leghemoglobin under the cbh1 promoter.

[0366] The cells were first grown in minimal medium containing 75 g / L glucose until the glucose was exhausted. The production phase was initiated by combining feed glucose and sophorose with 30 g / L VEG-Pro at pH 7 to induce protein expression under the control of the cbh1 promoter (Pcbh1). 10 mL whole broth samples were taken every twenty-four (24) hours and frozen at -20°C, with a total fermentation time of 188 hours. For example, Figure 7 As presented in Figure 2, total soluble protein secreted during the fermentation runs is plotted against effective fermentation time (EFT, hours) for the three fermentation runs described above (strains BGJ74, BGJ75, and BGJ76), along with data from a previous run of a BFZ28 fermentation (BFZ28; Pcbh1-CBH1 core-KEX2-LegGm1b) described in Example 4. Figure 8 As shown in Figure 2, fermentation supernatants were analyzed by SDS-PAGE, where a major protein band was detected at 20 kDa, which contained BASI protease inhibitor and leghemoglobin (~16 kDa) that co-migrated with BASI protein. The presence of heme-containing leghemoglobin was further confirmed by HPLC.

[0367] To estimate the expression of leghemoglobin in these fermentation runs, 188 h supernatant samples from the end of the fermentation run were analyzed by HPLC (Figure 9 The heme prosthetic group of leghemoglobin was detected at 410 nm, co-migrating with the protein peak detected at 280 nm with a retention time of 6.4 minutes ( Figure 9 Table 4 below presents the total protein secretion titers at the end of the 188 hour fermentation run, where the leghemoglobin levels (g / L) were calculated based on the protein peak area at 280 nm.

[0368] Table 4

[0369] Total secreted protein titer

[0370]

[0371] Example 6

[0372] Production of secreted myoglobin in a dual-copy expression strain

[0373] A. Construction of a double-copy expression vector for secretion of bovine myoglobin

[0374] To improve myoglobin expression, strains harboring two different codon-optimized sequences of the bovine myoglobin gene were constructed. Specifically, a tandem copy expression vector (pLHX143) was constructed containing two expression cassettes for bovine myoglobin. The first cassette contained the Pcbh1 promoter (SEQ ID NO: 11), the Pep1 signal sequence (Pep1ss, SEQ ID NO: 14), the first codon-optimized bovine myoglobin gene (Mb1b, SEQ ID NO: 4), and the terminator sequence of the endoglucanase 1 gene (Tegl1, SEQ ID NO: 50). This sequence is followed by a second cassette containing the Pcbh2 promoter (SEQ ID NO: 12), the Cbh1 signal sequence (Cbh1ss, SEQ ID NO: 13), a second codon-optimized bovine myoglobin gene (Mb1c, SEQ ID NO: 49) encoding the same bovine myoglobin (SEQ ID NO: 3), and the terminator sequence of the Cbh1 gene (Tcbh1, SEQ ID NO: 15). This vector also features 1 kb of 5' flanking homology sequence at the targeted genomic locus and 1 kb of 3' flanking homology sequence at the targeted genomic locus. The remainder of the expression vector contains bacterial vector sequences for selection and maintenance of the plasmid in E. coli. This double-copy myoglobin expression vector was designated "pLHX143" (pI1-Pcbh1-Mb1b-Pcbh2-Mb1c, SEQ ID NO: 51).

[0375] The linear double copy myoglobin expression cassette was amplified by PCR using primers OT4268 and OT4269 (see, e.g., Table 3) to generate a DNA fragment containing 5' and 3' one (1) kb flanking sequences for Cas9 targeted chromosomal integration at a chromosomal locus. This myoglobin cassette PCR fragment, as well as the Pcbh2-BASI cassette PCR fragment, was integrated into the T. reesei genome as described in Example 3. Colonies were screened for expression of myoglobin by inoculating colonies in microtiter plates in 1 mL NREL media (pH 6.5) at 28°C and growing for four (4) days (without addition of protease inhibitors). SDS-PAGE was performed to analyze secreted proteins. One of the highest expressing strains (BHX46) was selected for a one liter fermentation run and samples were taken at 43, 72, 94, 114, 137, 161, and 186 hours. Culture supernatants from these samples were analyzed by SDS-PAGE Figure 10 ). As shown in Figure 10 , a band for myoglobin was detected at 17 kDa and a BASI protease inhibitor was detected at 20 kDa. Integration of the linear double copy myoglobin expression cassette at the desired locus was verified by colony PCR amplification and genome sequencing.

[0376] REFERENCES

[0377] PCT Publication No. WO 1992 / 03529

[0378] PCT Publication No. WO 2004 / 035070

[0379] PCT Publication No. WO 2011 / 153449

[0380] PCT Publication No. WO 2016 / 100272

[0381] PCT Publication No. WO 2016 / 100562

[0382] PCT Publication No. WO 2016 / 100568

[0383] PCT Publication No. WO 2016 / 100571

[0384] PCT Publication No. WO 2021 / 092356

[0385] PCT Publication No. WO 2023 / 278968

[0386] U.S. Patent No. 6,255,115

[0387] U.S. Patent No. 6,268,328

[0388] U.S. Patent No. 7,713,725

[0389] U.S. Patent No. 8,936,917

[0390] U.S. Patent Publication No. US 2014 / 0024067

[0391] U.S. Patent Publication No. US 2014 / 0024067

[0392] U.S. Patent Publication No. US 2014 / 0161958

[0393] U.S. Patent Publication No. US 2021 / 0289813

[0394] U.S. Patent No. 6,022,725

[0395] Cao et al., Science, 9: 991-1001, 2000.

[0396] Goller et al., “Role of endoproteolytic dibasic proprotein processing in maturation of secretory proteins in Trichoderma reesei”, Appl Environ Microbiol., 64(9):3202-3208, 1998.

[0397] Krainer et al., “Optimizing cofactor availability for the production of recombinant heme peroxidase in Pichia pastoris”, Microbial Cell Factories, 14:4, 2015.

[0398] Laskowski and Kato, “Protein Inhibitors of Proteinases”, Ann. Rev. Bioch., 49:593-626, 1980.

[0399] Le Marquer et al., “Identification of new signaling peptides through a genome-wide survey of 250 fungal secretomes”, BMC Genomics 20:64 2019.

[0400] Shao et al., “High-level secretory production of leghemoglobin in Pichia pastoris through enhanced globin expression and heme biosynthesis”, Bioresource Technology, Volume 363, 2022.

[0401] Strickler et al., “Two Novel Streptomyces Protein Protease Inhibitors. Purification, Activity, Cloning and Expression”, The Journal of Biological Chemistry, Vol. 267, No. 5, pages 3236-3241, 1992.

[0402] Subramanian et al., “A versatile 2A peptide-based bicistronic protein expressing platform for the industrial cellulase producing fungus, Trichoderma reesei”, Biotechnol for Biofuels 10:34 (2017).

Claims

1. A recombinant filamentous fungal cell expressing a heterologous globulin.

2. The recombinant cell of claim 1, which expresses and secretes the heterologous globulin when fermented under suitable conditions.

3. The recombinant cell of claim 1 , comprising an introduced expression cassette encoding the globulin, wherein the cassette comprises an upstream promoter (pro) sequence operably linked to a downstream nucleic acid encoding a protein (signal) secretion sequence (sig-seq), which is operably linked to a downstream nucleic acid encoding the globulin (globulin CDS).

4. The recombinant cell of claim 3, wherein the cassette encoding the globin is integrated into the genome of the cell.

5. The recombinant cell of claim 1, comprising one introduced expression cassette encoding at least two globulins, or comprising at least two introduced expression cassettes encoding at least two globulins.

6. The recombinant cell of claim 1, comprising an introduced expression cassette encoding a protease inhibitor protein.

7. The recombinant cell of claim 1, wherein the expressed globin is selected from the group consisting of leghemoglobin, myoglobin, hemoglobin, cyanobacterial hemoglobin, and non-symbiotic hemoglobin.

8. The recombinant cell of claim 1, wherein the expressed globin comprises a globin superfamily domain and a functional porphyrin (heme) binding site.

9. The recombinant cell of claim 1, which is fermented for at least about 96 hours to about 300 hours, wherein the cell produces at least 0.1 grams of globulin per liter of fermentation broth (g / L).

10. The recombinant cell of claim 1, which is fermented for about 180 hours to about 190 hours, wherein the cell produces at least 1 gram of globulin per liter of fermentation broth (g / L).

11. A method for producing a heterologous globulin in a filamentous fungal cell, the method comprising: (a) introducing an expression cassette encoding a globin protein into the filamentous fungal cell, wherein the cassette comprises an upstream (5') promoter (pro) sequence, the upstream (5') promoter (pro) sequence is operably linked to a downstream nucleic acid (sig-seq) encoding a protein (signal) secretion sequence, the downstream nucleic acid (sig-seq) encoding the protein (signal) secretion sequence is operably linked to a downstream (3') nucleic acid (globin CDS) encoding the globin protein; as well as (b) fermenting the modified cells under conditions suitable for production of the globulin.

12. The method of claim 11, wherein the cassette encoding the globin is integrated into the genome of the cell.

13. The method of claim 11, wherein the cell comprises one introduced expression cassette encoding at least two globulins, or comprises at least two introduced expression cassettes encoding at least two globulins.

14. The method of claim 11, wherein the cells comprise an introduced expression cassette encoding a protease inhibitor protein.

15. The method of claim 11, wherein the cells are fermented for at least about 96 hours to about 300 hours and produce at least 0.1 grams of globulin per liter of fermentation broth (g / L).

16. The method of claim 11, wherein the cells are fermented for about 180 hours to about 190 hours and the cells produce at least 1 gram of globulin per liter of fermentation broth (g / L).

17. The method of claim 11, wherein fermenting the modified cells under conditions suitable for production of the globulin does not require or include a hemin medium supplement and / or does not require or include a 5-aminolevulinic acid (ALA) medium supplement.

18. The method of claim 11, wherein the secreted globulins are recovered from the fermentation broth, optionally wherein the recovered globulins are purified.

19. The method of claim 11, wherein the globulin is selected from the group consisting of leghemoglobin, myoglobin, hemoglobin, cyanoglobin, and non-symbiotic hemoglobin.

20. The method of claim 19, wherein the leghemoglobin is at least 80% identical to the native soybean leghemoglobin of SEQ ID NO: 1 or at least 80% identical to the native French bean leghemoglobin of SEQ ID NO:

19.

21. The method of claim 19, wherein the myoglobin is at least 80% identical to native bovine myoglobin of SEQ ID NO:

3.

22. The method of claim 19, wherein the globulin comprises a globin superfamily domain and a functional porphyrin (heme) binding site.

Images