Stem cell preparation as well as preparation method and application thereof in anti-aging repair

The stem cell preparation prepared through a composite process of 3D carrier-free suspension culture and probiotic fermentation solves the problems of high cell apoptosis rate, immune rejection and short half-life of antioxidants in stem cell therapy, and achieves efficient multi-dimensional anti-aging repair effects.

CN120771265AInactive Publication Date: 2025-10-14SICHUAN HUADA KANGYUAN BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511261437.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-05
Publication Date
2025-10-14
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Existing stem cell therapies have problems such as high cell apoptosis rate, immune rejection reaction, insufficient functional stability, short antioxidant half-life, and insufficient consideration of multi-organ correlation, which lead to limited efficacy and large-scale application.

Method used

The stem cell preparation is prepared using 3D carrier-free suspension culture technology combined with a probiotic fermentation compound process. It contains mesenchymal stem cells with a high CXCR4+ positive rate, probiotic fermentation supernatant and targeted delivery medium, and is combined with a cryopreservation protective matrix to ensure cell activity and multi-dimensional anti-aging mechanisms.

Benefits of technology

It improves the homing efficiency and survival rate of stem cells, enhances the ability to repair aging tissues, achieves multi-dimensional anti-aging effects, and breaks through the single efficacy and difficult targeting problems of traditional stem cell preparations.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention discloses a stem cell preparation as well as a preparation method and application thereof in anti-aging repair, and relates to the field of biological medicines. The stem cell preparation comprises the following components: a 3D mesenchymal stem cell suspension, a probiotic-plant fermentation supernatant, a targeted delivery medium and a cryopreservation protection matrix. The preparation method comprises the following steps: inoculating mesenchymal stem cells into a bioreactor in a serum-free culture medium, and carrying out suspension culture to obtain a 3D mesenchymal stem cell suspension; preparing probiotic-plant fermentation supernate on a basic culture medium through double-bacterium fermentation; and after mixing, adding a cryopreservation protection matrix, and after programmed cooling, performing liquid nitrogen cryopreservation. The stem cell preparation can be applied to preparation of anti-aging repair drugs. The stem cell preparation disclosed by the invention can solve the retention problem, break through concentration contradiction, overcome the burst release defect and reverse recovery injury; the traditional Chinese medicine composition has obvious effects on repairing senescence skin and improving senescence cardiac hypofunction.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to a stem cell preparation, a preparation method thereof and application thereof in anti-aging repair. BACKGROUND

[0002] Stem cell therapy, as the core means of regenerative medicine, has shown great potential in the field of anti-aging and tissue repair. Mesenchymal stem cells (MSCs) have become the main cell type for clinical transformation due to their multi-directional differentiation ability, immune regulation characteristics and low ethical controversy. However, the existing technology still has the following key problems, which seriously restrict its efficacy and large-scale application.

[0003] The existing culture mode has limitations. 2D static culture leads to flat growth of cells, and the expression of key homing factor CXCR4 is reduced by 60%~70%, and the apoptosis rate is as high as 80% within 72 hours after transplantation. The carrier-dependent 3D culture (such as microcarrier technology) can partially simulate the in-vivo environment, but the residual microcarriers cause immune rejection, and the enzymatic harvesting process damages the cell membrane integrin, resulting in decreased migration ability.

[0004] There are deficiencies in safety and functional stability. Incomplete differentiation of iPSCs may lead to teratoma (incidence rate 1.2%~4.7%), and CRISPR editing technology has off-target risks. There is also a risk of arrhythmia, and traditional expanded MSCs contain mixed GHRHR + cell subpopulation (accounting for 3%~8%), which abnormally expresses gap junction protein Cx43 after transplantation, interfering with myocardial electrical conduction. In addition, the traditional cryopreservation solution (10% DMSO + fetal bovine serum) results in a survival rate of only 60%~70% after resuscitation, and the homing function is decreased by more than 50%.

[0005] The existing stem cell preparation has single efficacy, relying on exogenous antioxidants (vitamins C / E), but small molecules have a short half-life (<2 hours), and only reduce ROS by 30% in the ultraviolet model, and have no significant effect on DNA damage repair. Most patents focus on single tissue repair, ignoring the multi-organ correlation of “inflammatory aging”. For example, the aging liver needs to activate the SIRT1 pathway, but traditional MSCs preparations have no regulatory ability.

[0006] Therefore, it is an urgent need to develop a stem cell preparation that takes into account high cell activity, multi-dimensional anti-aging mechanism and large-scale production potential, to break through the industry bottleneck. SUMMARY

[0007] The present application aims to solve the above problems, and provides a stem cell preparation, a preparation method thereof and application thereof in anti-aging repair, wherein the stem cell preparation is prepared by a 3D carrier-free suspension culture and a probiotic fermentation compound process, has high cell activity, multi-dimensional anti-aging mechanism and large-scale production potential, and can be applied in skin repair and systemic anti-aging and other organ function reconstruction.

[0008] To solve the above technical problems, the present application adopts the following technical solutions:

[0009] A stem cell preparation, comprising the following components in parts by weight:

[0010] 3D mesenchymal stem cell suspension 500-1000 parts, probiotic-plant fermentation supernatant 200-600 parts, targeted delivery medium 30-50 parts, and cryopreservation protective matrix 850-1000 parts;

[0011] The 3D mesenchymal stem cell suspension has a concentration of 5x10 5 ~1x10 6 + The cell diameter is less than or equal to 15 microns, and the CXCR4 positive rate is greater than or equal to 90%.

[0012] The probiotic-plant fermentation supernatant comprises 10-25% of fructus lycii polysaccharide and 7.5-20% of tea polyphenol based on the total amount of the fermentation supernatant.

[0013] The targeted delivery medium is a composite microsphere with a particle size of 100-200 nm, which comprises 5-15 parts of Fe3O4 nanoparticles, 20-30 parts of a gelatin coating layer, and 1-3 parts of loaded growth factors IGF-1 and VEGF, wherein the mass ratio of IGF-1 to VEGF is 0.98-1.02:1, and the Fe3O4 coating rate is greater than or equal to 95%.

[0014] The cryopreservation protective matrix comprises 15-25 parts of human blood albumin, 80-100 parts of DMSO, and 750-880 parts of a compound electrolyte solution, and the osmotic pressure of the compound electrolyte solution ranges from 280 to 320 mOsm / kg.

[0015] The cell diameter in the 3D mesenchymal stem cell suspension is less than or equal to 15 microns, and the CXCR4 + ​The positive rate is greater than or equal to 90%, and the homing efficiency is increased by 3 times; the polysaccharide of medlar in the probiotic-plant fermentation liquor is 10-25%, and the tea polyphenol is 7.5-20%, which can remove ROS and activate the SIRT1 pathway; the target delivery medium Fe3O4 coating rate is greater than or equal to 95%, and the accurate ratio of IGF-1 / VEGF ensures that the release rate of ischemic tissue factors is increased by 85%; the electrolyte osmotic pressure of the cryopreservation protection matrix is 280-320 mOsm / kg, which ensures that the survival rate is greater than or equal to 95% and the dry gene is completely retained. When CXCR4 + When the positive rate is greater than or equal to 90% and the tea polyphenol accounts for greater than or equal to 15% of the total amount of fermentation supernatant, the tea polyphenol removes the microenvironment ROS, protects the homing stem cells from apoptosis, and cooperatively up-regulates the collagen synthesis gene, and the collagen density of the skin of the aging mouse is increased by 162%. The synergistic architecture of the 3D high-homing stem cell + accurate concentration of fermentation active substance + high-coating magnetic targeting; the interaction of each component makes the anti-aging effect exceed the theoretical value by more than 2 times; the three major problems of low survival of transplanted cells, single efficacy and difficult targeting are broken through.

[0016] Further, the mesenchymal stem cells are derived from umbilical cord Wharton's jelly, adipose tissue or placenta, and CD73 + / CD90 + / CD105 + expressions are greater than or equal to 95%.

[0017] Wharton's Jelly of umbilical cord: a gelatinous tissue rich in MSCs in the umbilical cord, with strong proliferation capacity (passage > P10 without aging) and low immunogenicity (HLA-DR⁻).

[0018] Adipose tissue: obtained by liposuction, rich in MSCs (5×10 4 / g tissue).

[0019] Placenta: derived from chorion or amnion, secretes anti-inflammatory factor TSG-6 (concentration ≥ 200 pg / 10 6 cells).

[0020] CD73⁺ mediates adenosine secretion and inhibits inflammatory response; CD90⁺ maintains stem cell migration ability; CD105⁺ promotes angiogenesis.

[0021] Further, the solvent of the compound electrolyte solution is sterile distilled water, and the compound electrolyte solution includes the following components according to the mass fraction of the solvent: sodium chloride 5.0-5.5‰, sodium gluconate 4.8-5.2‰, sodium acetate 2-2.4‰, potassium chloride 0.35-0.40‰, magnesium chloride 0.12-0.16‰.

[0022] A preparation method suitable for the preparation of the stem cell preparation includes the following steps:

[0023] S100, seeding mesenchymal stem cells into a bioreactor in a serum-free medium, and culturing the mesenchymal stem cells in suspension to obtain a 3D mesenchymal stem cell suspension;

[0024] S200, preparing a probiotic-plant fermentation supernatant by double-bacterial fermentation on a basal medium;

[0025] S300, mixing the 3D mesenchymal stem cell suspension and the fermentation supernatant, adding a targeted delivery medium, mixing, adding a cryopreservation matrix, and then performing programmed cooling and liquid nitrogen cryopreservation.

[0026] Further, in step S100, the serum-free medium comprises the following components: DMEM / F12 basal medium: 880-900 ml / L, human platelet lysate: 100-120 ml / L, bFGF: 5-10 ng / ml, EGF: 5-8 ng / ml, Pluronic F-68: 0.5-1.0 g / L, hydroxyethyl starch: 1.0-2.0 g / L, CHIR99021: 3-5 μmol / L, SB431542: 5-10 μmol / L, and the cell aggregate diameter in suspension culture is 50-150 μm.

[0027] DMEM / F12 provides basic nutrients such as amino acids, vitamins, and inorganic salts; human platelet lysate (hPL) contains growth factors such as PDGF / IGF, which promotes cell proliferation; bFGF activates the MAPK / ERK pathway and maintains stem cell pluripotency; EGF enhances cell migration ability; Pluronic F-68 reduces surface tension and protects cell membranes from shear stress damage; hydroxyethyl starch (HES) increases the viscosity of the culture medium to 4-6 cP (simulates the in vivo environment) and promotes the formation of uniform aggregates; CHIR99021 is a GSK-3β inhibitor that activates the Wnt / β-catenin pathway to maintain stemness; SB431542 is a TGF-β receptor inhibitor that blocks Smad2 / 3 phosphorylation and inhibits fibroblast differentiation; and ensures the formation of aggregates with a diameter of 50-150 μm. The medium of the present application has a diameter deviation of ±15 μm (DLS), OCT4 + (maintenance of stemness)>95%, and the cells double every 24 hours.

[0028] In step S100, the rotation speed is set to 100-150 rpm to form a culture mode of dynamic suspension without carriers, and 3D mesenchymal stem cell suspension is prepared, and small molecule inhibitors CHIR99021 and SB431542 are added to achieve high homing stem cell expansion.

[0029] Furthermore, in step S200, a mixture of crushed wolfberry, tea leaves, and beetroot is used as a base culture medium, deionized water and a fermentation promoter are added, and the mixture is mixed with a Bifidobacterium breve bacterial solution, and anaerobically fermented at 36-38°C for 8-12 hours; then a Lactobacillus plantarum bacterial solution is added, and aerobic fermentation is carried out at 30-37°C for 6-10 hours, and the mixture is inactivated and centrifuged to obtain the supernatant.

[0030] In step S200, a mixture of ground wolfberry, tea leaves and beetroot is used as a base culture medium, Bifidobacterium breve degrades the cell walls of wolfberry to release polysaccharides, and Lactobacillus plantarum converts tea polyphenols into a bioactive form (γ-aminobutyric acid).

[0031] The mass ratio of wolfberry, tea, and beetroot is 3.8-4.2:0.98-1.02:1;

[0032] The addition amount of Bifidobacterium breve and Lactobacillus plantarum were both ≥3.5×10 9 CFU / g raw material;

[0033] The material-liquid ratio of basal culture medium to deionized water is 1:4.8~5.2;

[0034] The fermentation promoter includes the following components, calculated by mass fraction of the basic culture medium: yeast extract powder 0.5~1.5%, manganese sulfate 0.05~0.1‰, Tween 80: 0.05~0.1%, and dipotassium hydrogen phosphate 0.1~0.3%.

[0035] Furthermore, in step S300, at room temperature, the 3D mesenchymal stem cell suspension and the fermentation supernatant are mixed, and then the targeted delivery medium is added. The mixture is cooled to 3-5°C and kept warm for 25-35 minutes. Then, a cryopreservation protective matrix is ​​added and mixed. The mixture is then cooled to -80°C at a cooling rate of 1°C / min and then cryopreserved in a liquid nitrogen vapor phase at -190°C to -150°C.

[0036] Furthermore, in step S300, the method for preparing the targeted delivery medium includes the following steps:

[0037] Step 1, forming gelatin-Fe3O4 composite microspheres by emulsification-crosslinking method;

[0038] Step 2: Use 0.15 M ammonium sulfate to establish a pH gradient and load IGF-1 / VEGF.

[0039] The preparation method of the targeted delivery medium comprises the following steps:

[0040] (1) Synthesis of oleic acid-coated Fe3O4 nanoparticles (particle size 10±2nm) with a magnetic saturation of ≥65 emu / g;

[0041] (2) Emulsification-crosslinking: Fe3O4 nanoparticles were mixed with 10% gelatin solution, shear emulsified in liquid paraffin containing 1.5% Span 80 at 10000 rpm for 10 min, and crosslinked with glutaraldehyde at 10°C for 2 h;

[0042] (3) pH gradient loading: The microspheres were preloaded with 0.15 M ammonium sulfate (pH 4.0), then incubated in citrate buffer (pH 4.0) containing IGF-1 / VEGF (0.5 mg / ml), and replaced with pH 7.4 PBS to form a transmembrane pH gradient.

[0043] The 10% gelatin solution uses water for injection as the solvent, the gelatin type is type A (derived from pig skin), and the dissolution temperature is 60±2℃.

[0044] The invention discloses an application of a stem cell preparation in the preparation of an anti-aging and repairing drug.

[0045] Furthermore, the stem cell preparation is used in repairing aging skin or improving aging-related heart function impairment.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] The stem cell preparation of the present invention achieves high stem cell homing: CXCR4⁺ ≥ 90% and diameter ≤ 15μm, solving the retention problem. The fermentation broth has precise activity: polysaccharides 10-25%, polyphenols 7.5-20%, overcoming concentration contradictions. It also achieves precise control of targeted delivery: coverage ≥ 95% and IGF-1 / VEGF near 1:1, overcoming the burst release defect. It also achieves biomimetic cryopreservation: osmotic pressure 280-320mOsm / kg, reversing resuscitation damage. The stem cell preparation of the present invention can be used in the preparation of anti-aging and repair drugs, with significant effects in repairing aging skin and improving age-related cardiac dysfunction.

[0048] PBS is the abbreviation of Phosphate-Buffered Saline.

[0049] CXCR4 (CXC Chemokine Receptor Type 4) is a chemokine receptor that belongs to the G protein-coupled receptor (GPCR) superfamily and plays a core role in stem cell homing, immune regulation and tissue repair.

[0050] Span 80: Sorbitan monooleate. DETAILED DESCRIPTION

[0051] Example 1

[0052] The preparation method of the targeted delivery medium comprises the following steps:

[0053] Step 1: Synthesis of Fe3O4 nanoparticles

[0054] Raw materials ratio:

[0055] FeCl3-6H2O: 5.0 g; FeCl2-4H2O: 2.0 g; ammonia (25%): 15 ml; oleic acid: 1.5 ml (surface modifier).

[0056] Process: Dissolve FeCl3-6H2O and FeCl2-4H2O in 100 ml deoxygenated water (nitrogen bubbling for 30 min) with mechanical stirring (500 rpm); add ammonia water dropwise in a 70 °C water bath, and react for 30 min. The solution changes from brownish red to black. Add oleic acid and continue stirring at 80 °C for 1 h. Centrifuge (12000 g x 15 min) to collect the precipitate. Wash with ethanol / water (3:1) for 3 times, and dry at 60 °C under vacuum to obtain oleic acid-coated Fe3O4 nanoparticles.

[0057] Step 2: Construction of gelatin microspheres carrier (emulsion-crosslinking method)

[0058] Raw materials: gelatin (Type A) 25 g, prepared into 10% (w / v); Fe3O4 nanoparticles, 10 g; IGF-1 and VEGF, 2 g; liquid paraffin; Span 80, 1.5% (v / v); glutaraldehyde (25%), prepared into 0.1 mL / g gelatin.

[0059] Process: Preparation of 10% gelatin solution: dissolve 25 g gelatin in 250 mL water for injection, keep the temperature at 60 °C, and disperse under 200 W ultrasonic condition for 5 min.

[0060] Primary emulsification: disperse Fe3O4 nanoparticles in 10% gelatin solution; inject into liquid paraffin containing Span 80 (oil / water ratio 4:1), and emulsify at high speed (10000 rpm x 10 min) to obtain W / O emulsion.

[0061] Crosslinking and solidification: cool down to 10 °C, add glutaraldehyde (0.1 ml / g gelatin), and crosslink for 2 h; add glycine (0.1 M) to terminate the reaction, and centrifuge (8000 g x 10 min) to collect the microspheres.

[0062] Purification: wash with ether, acetone, and PBS (pH 7.4) for 3 times in sequence to remove the oil phase and residual crosslinking agent.

[0063] Step 3: Loading of growth factors by pH gradient method

[0064] Loading solution system:

[0065] IGF-1 / VEGF, 0.5 mg / ml (1 : 1); citric acid buffer, inner aqueous phase pH 4.0, 0.1 M, outer aqueous phase pH 7.4, 0.01 M;

[0066] Ammonium sulfate 0.15 M.

[0067] Loading step:

[0068] Pre-loading of ammonium sulfate: The gelatin-Fe304 microspheres were soaked in 0.15 M ammonium sulfate solution (pH 4.0) and dialyzed at 4 °C for 12 h to form a high concentration of ammonium ions inside the microspheres.

[0069] Establishment of pH gradient: The microspheres were transferred to the IGF-1 / VEGF-containing citric acid buffer (pH 4.0, 0.1 M) and incubated at 37 °C for 30 min; they were then quickly replaced with the outer aqueous phase (pH 7.4) and immediately cooled in an ice bath.

[0070] Example 2

[0071] Preparation method of the targeted delivery medium, comprising the following steps:

[0072] Step 1: Synthesis of ferroferric oxide nanoparticles (Fe304) was the same as in Example 1.

[0073] Step 2: Construction of gelatin microsphere carrier (emulsification-crosslinking method)

[0074] Raw materials: gelatin (Type A) 20 g, prepared into 10% (w / v); Fe304nanoparticles, 5 g; IGF-1 and VEGF, 1 g; liquid paraffin; Span 80, 1.5% (v / v); glutaraldehyde (25%), prepared into 0.1 mL / g of gelatin.

[0075] Process: Preparation of 10% gelatin solution: 20 g of gelatin was dissolved in 200 mL of water for injection, the temperature was maintained at 62 °C, and the dispersion was performed under ultrasonic conditions at 200 W for 5 min.

[0076] Other process procedures and parameters were the same as in Example 1.

[0077] Step 3: Loading of growth factors by pH gradient method

[0078] Loading solution system:

[0079] IGF-1 / VEGF, 0.49 mg / ml (0.98: 1); citric acid buffer, inner aqueous phase pH 4.0, 0.1 M, outer aqueous phase pH 7.4, 0.01 M;

[0080] Ammonium sulfate 0.15 M.

[0081] Loading step: the same as in Example 1.

[0082] Example 3

[0083] The preparation method of the targeted delivery medium comprises the following steps:

[0084] Step 1: The synthesis of ferroferric oxide nanoparticles (Fe3O4) is the same as that in Example 1.

[0085] Step 2: Gelatin microsphere carrier construction (emulsification-crosslinking method)

[0086] Solution preparation: 30 g of gelatin (Type A), prepared to 10% (w / v); 15 g of Fe3O4 nanoparticles; 3 g of IGF-1 and VEGF; liquid paraffin; 1.5% (v / v) Span 80; and 25% glutaraldehyde, prepared to 0.1 mL / g of gelatin.

[0087] Process: Preparation of 10% gelatin solution: dissolve 30g gelatin in 300mL water for injection, maintain the temperature at 58℃, and disperse for 5min under 200W ultrasonic conditions.

[0088] Other process and parameters are the same as those in Example 1.

[0089] Step 3: pH gradient method to load growth factors

[0090] Loading solution system:

[0091] IGF-1 / VEGF, 0.51 mg / ml (1.02:1); citrate buffer, internal aqueous phase pH 4.0, 0.1 M, external aqueous phase pH 7.4, 0.01 M; ammonium sulfate 0.15 M.

[0092] Loading steps: same as Example 1.

[0093] Comparative Example 1

[0094] The solvent of the 10% gelatin solution was replaced with ultrapure water (not water for injection), and other data parameters and processes were the same as those in Example 1.

[0095] Comparative Example 2

[0096] The solvent of the 10% gelatin solution was replaced with normal saline, and other data parameters and processes were the same as those in Example 1.

[0097] The performance of the targeted delivery media prepared in Examples 1 to 3 is shown in Table 1.

[0098] Table 1 Performance of the targeted delivery media prepared in Examples 1 to 3

[0099] Item Fe3O4 coating rate Microsphere size (nm) IGF-1 encapsulation efficiency VEGF encapsulation efficiency Example 1 96.3% 125±18 97.1% 95.8% Example 2 95.7% 142±21 96.5% 96.2% Example 3 97.0% 108±15 98.0% 97.3%

[0100] As shown in Table 1, in Examples 1-3, the Fe₃O₄ coverage was >95%, the microsphere particle size ranged from 1000 to 200 nm, the IGF-1 encapsulation efficiency was >96%, and the VEGF encapsulation efficiency was >95%. This pH gradient-driven active loading mechanism overcomes the low encapsulation efficiency of conventional methods. Combined with the pH-responsive degradation properties of gelatin, this method enables precise controlled release of growth factors into ischemic tissue.

[0101] In Example 1 and Comparative Examples 1-2, different solvents were used to prepare 10% gelatin solutions. The effects on the microsphere particle size, Fe3O4 coverage rate, and growth factor leakage rate (24 h) are shown in Table 2.

[0102] Table 2 Effect of using different solvents to prepare 10% gelatin solution

[0103] Solvent Microsphere size (nm) Fe3O4 coating rate Growth factor leakage rate (24 h) Water for injection (Example 1) 125±18 96.3% <5% Ultrapure water (Comparative Example 1) 153±25 89.7% 12% Physiological saline (Comparative Example 2) 195±30 84.5% 23%

[0104] As shown in Table 2, only water for injection can simultaneously meet the requirements for particle size control (100-200 nm), high encapsulation efficiency (≥95%), and low leakage rate. When ultrapure water and normal saline are used as solvents, the Fe₃O₄ encapsulation efficiency is less than 90%, and the growth factor leakage rate (24 hours) is ≥12%.

[0105] Example 4

[0106] A stem cell preparation comprising the following components:

[0107] 3D mesenchymal stem cell suspension 750g, probiotics-plant fermentation supernatant 400g, targeted delivery medium 40g, cryopreservation protection matrix 920g;

[0108] Among them, the concentration of 3D dynamic cultured mesenchymal stem cell suspension was 7.5×10 5 / mL, cell diameter 12μm, CXCR4 + The positive rate was 92%;

[0109] The probiotic-plant fermentation supernatant includes wolfberry polysaccharides accounting for 17.5% of the total fermentation supernatant and tea polyphenols accounting for 14% of the total fermentation supernatant.

[0110] Example 1 Method Preparation of targeted delivery medium.

[0111] The cryoprotective matrix includes 20 g of human serum albumin, 90 g of DMSO, and 820 g of a compound electrolyte solution; the osmotic pressure range of the compound electrolyte solution is 300 mOsm / kg.

[0112] The mesenchymal stem cells are derived from the umbilical cord Wharton's jelly, and CD73 + / CD90 + / CD105 + Expression 98%.

[0113] The solvent of the compound electrolyte solution is sterile distilled water, and the compound electrolyte solution includes the following components according to the mass fraction of the solvent: sodium chloride 5.2 ‰, sodium gluconate 5 ‰, sodium acetate 2.2 ‰, potassium chloride 0.38 ‰, magnesium chloride 0.14 ‰.

[0114] A preparation method suitable for the preparation of stem cell preparations, comprising the following steps:

[0115] S100, in a serum-free medium, mesenchymal stem cells are inoculated into a bioreactor for suspension culture to obtain a 3D mesenchymal stem cell suspension;

[0116] The serum-free medium includes the following components: DMEM / F12 basic medium 890 ml / L, human platelet lysate 110 ml / L, bFGF 7.5 ng / ml, EGF 6.5 ng / ml, Pluronic F-68: 0.75 g / L, hydroxyethyl starch 1.5 g / L, CHIR99021: 4 μmol / L, SB431542: 7.5 μmol / L, and the cell aggregate diameter in suspension culture is 100 μm.

[0117] S200, in step S200, the mixture of crushed wolfberry, tea leaves and beetroot is used as a basic medium, deionized water and a fermentation promoter are added, mixed with Bifidobacterium breve bacterial liquid, and subjected to anaerobic fermentation at 37℃ for 10 hours; then Lactobacillus plantarum bacterial liquid is added, and subjected to aerobic fermentation at 34℃ for 8 hours, and the supernatant is obtained by inactivation and centrifugation.

[0118] The mass ratio of wolfberry, tea leaves and beetroot is 4:1:1;

[0119] The addition amount of Bifidobacterium breve and the addition amount of Lactobacillus plantarum are both 4×10 9 CFU / g of raw materials;

[0120] The ratio of the basic medium to deionized water is 1:5;

[0121] The fermentation promoter includes the following components according to the mass fraction of the basic medium: yeast extract powder 0.75%, manganese sulfate 0.08 ‰, Tween 80 0.07%, and dipotassium hydrogen phosphate 0.2%.

[0122] S300, the 3D mesenchymal stem cell suspension and the fermentation supernatant are mixed at room temperature of 25℃, then a targeted delivery medium is added, and the temperature is reduced to 4℃, and after incubation for 30 min, a cryopreservation protective matrix is added and mixed, and then the temperature is reduced to -80℃ at a reduction rate of 1℃ / min, and then the sample is placed in a -170℃ liquid nitrogen gas phase zone for cryopreservation.

[0123] Example 5

[0124] A stem cell preparation, comprising the following components:

[0125] 3D mesenchymal stem cell suspension 500g, probiotic-plant fermentation supernatant 200g, targeted delivery medium 30g, cryopreservation protective matrix 850g;

[0126] wherein the 3D dynamically cultured mesenchymal stem cell suspension has a concentration of 5x10 5 cells / mL, a cell diameter of 15μm, and a CXCR4 + positive rate of 90%;

[0127] The probiotic-plant fermentation supernatant comprises 10% of wolfberry polysaccharide and 7.5% of tea polyphenol based on the total amount of the fermentation supernatant.

[0128] The targeted delivery medium is prepared by the method of Example 1.

[0129] The cryopreservation protective matrix comprises 15g of human blood albumin, 80g of DMSO, and 750g of compound electrolyte solution, and the compound electrolyte solution has an osmotic pressure in the range of 280 mOsm / kg.

[0130] The mesenchymal stem cells are derived from adipose tissue and have a CD73 + / CD90 + / CD105 + expression rate of 95%.

[0131] The solvent of the compound electrolyte solution is sterile distilled water, and the compound electrolyte solution comprises the following components in terms of mass fraction: sodium chloride 5.0‰, sodium gluconate 4.8‰, sodium acetate 2‰, potassium chloride 0.35‰, and magnesium chloride 0.12‰.

[0132] A preparation method suitable for the preparation of a stem cell preparation, comprising the following steps:

[0133] S100, inoculating mesenchymal stem cells into a bioreactor in a serum-free medium and culturing the cells in suspension to obtain a 3D mesenchymal stem cell suspension;

[0134] The serum-free medium comprises the following components: DMEM / F12 basic medium 880ml / L, human platelet lysate 100ml / L, bFGF 5ng / ml, EGF 5ng / ml, Pluronic® F-68: 0.5g / L, hydroxyethyl starch 1.0g / L, CHIR99021: 3μmol / L, and SB431542: 5μmol / L, and the cell aggregate diameter in the suspension culture is 150μm.

[0135] S200, the mixture of crushed wolfberry, tea leaves and beetroot is used as the basic medium, deionized water and fermentation accelerator are added, mixed with Bifidobacterium breve bacterial liquid, anaerobic fermentation at 36℃ for 8 hours; then Lactobacillus plantarum bacterial liquid is added, aerobic fermentation at 30℃ for 6 hours, inactivated and centrifuged to obtain supernatant.

[0136] The mass ratio of wolfberry, tea leaves and beetroot is 3.8:0.98:1;

[0137] The adding amount of Bifidobacterium breve and Lactobacillus plantarum is 3.5×10 9 CFU / g raw material respectively;

[0138] The ratio of the basic medium to deionized water is 1:4.8;

[0139] The fermentation accelerator includes the following components according to the mass fraction of the basic medium: yeast extract powder 0.5%, manganese sulfate 0.05‰, Tween 80 0.05%, potassium phosphate dibasic 0.1%.

[0140] S300, the 3D mesenchymal stem cell suspension is mixed with the fermentation supernatant at room temperature of 25℃, then a targeted delivery medium is added, the temperature is reduced to 5℃, and after 35 minutes of incubation, a cryopreservation protective matrix is added and mixed, then the temperature is reduced to-80℃ at a rate of 1℃ / min, and then cryopreservation is performed in a liquid nitrogen gas phase zone at-150℃.

[0141] Embodiment 6

[0142] A stem cell preparation includes the following components:

[0143] 3D mesenchymal stem cell suspension 1000g, probiotic-plant fermentation supernatant 600g, targeted delivery medium 50g, and cryopreservation protective matrix 1000g;

[0144] The concentration of the 3D dynamically cultured mesenchymal stem cell suspension is 1×10 6 / mL, the cell diameter is 10μm, and the CXCR4 + positive rate is 95%;

[0145] The probiotic-plant fermentation supernatant includes 25% wolfberry polysaccharide and 20% tea polyphenol based on the total amount of the fermentation supernatant;

[0146] The targeted delivery medium is prepared by the method of Embodiment 1;

[0147] The cryopreservation protective matrix includes human blood albumin 25g, DMSO 100g, and compound electrolyte solution 880g; the osmotic pressure of the compound electrolyte solution ranges from 320 mOsm / kg.

[0148] The mesenchymal stem cells are derived from rat placenta, and CD73 + / CD90 + / CD105 + expressed 98%.

[0149] The solvent of the compound electrolyte solution is sterile distilled water, and the compound electrolyte solution includes the following components according to the mass fraction of the solvent: sodium chloride 5.5 ‰, sodium gluconate 5.2 ‰, sodium acetate 2.4 ‰, potassium chloride 0.40 ‰, and magnesium chloride 0.16 ‰.

[0150] A preparation method suitable for the preparation of stem cell preparations, comprising the following steps:

[0151] S100, in a serum-free medium, mesenchymal stem cells are inoculated into a bioreactor for suspension culture to obtain a 3D mesenchymal stem cell suspension;

[0152] The serum-free medium includes the following components: DMEM / F12 basic medium 900 ml / L, human platelet lysate 120 ml / L, bFGF 10 ng / ml, EGF 8 ng / ml, Pluronic F-68 1.0 g / L, hydroxyethyl starch 2.0 g / L, CHIR99021: 5 μmol / L, SB431542: 10 μmol / L, and the cell aggregate diameter in suspension culture is 50 μm.

[0153] S200, in step S200, the mixture of crushed wolfberry, tea leaves and beetroot is used as a basic medium, deionized water and a fermentation promoter are added, mixed with Bifidobacterium breve bacterial liquid, and subjected to anaerobic fermentation at 38℃ for 12 hours; then Lactobacillus plantarum bacterial liquid is added, and subjected to aerobic fermentation at 37℃ for 10 hours, and the supernatant is obtained by inactivation and centrifugation.

[0154] The mass ratio of wolfberry, tea leaves and beetroot is 4.2:1.02:1;

[0155] The addition amount of Bifidobacterium breve and the addition amount of Lactobacillus plantarum are both 4.5×10 9 CFU / g raw material;

[0156] The solid-liquid ratio of the basic medium to deionized water is 1:5.2;

[0157] The fermentation promoter includes the following components according to the mass fraction of the basic medium: yeast extract powder 1.5%, manganese sulfate 0.1 ‰, Tween 80 0.1%, and dipotassium hydrogen phosphate 0.3%.

[0158] In step S300, the 3D mesenchymal stem cell suspension is mixed with the fermentation supernatant at room temperature of 25℃, then a targeted delivery medium is added, and the temperature is lowered to 3℃, and after incubation for 25 min, a cryopreservation matrix is added and mixed, and then the temperature is lowered to -80℃ at a rate of 1℃ / min, and then the sample is placed in a -190℃ liquid nitrogen gas phase zone for cryopreservation.

[0159] Comparative Example 3

[0160] The serum-free medium component was removed CHIR99021, CXCR4 + The positive rate was 82%.

[0161] Other parameters and steps were the same as in Example 4.

[0162] Comparative Example 4

[0163] The probiotic-plant fermentation supernatant included 30% tea polyphenols in the total fermentation supernatant; other parameters and steps were the same as in Example 4.

[0164] Comparative Example 5

[0165] The targeted delivery medium was replaced with the targeted delivery medium prepared by the method of Comparative Example 2, and other parameters and steps were the same as in Example 4.

[0166] Comparative Example 6

[0167] The sterile distilled water in the compound electrolyte solution was reduced by 15%, and the electrolyte osmotic pressure was increased to 350 mOsm / kg. Other parameters and steps were the same as in Example 4.

[0168] Comparative Example 7

[0169] The serum-free medium component was removed SB431542, and other parameters and steps were the same as in Example 4.

[0170] The performance parameters of the stem cell preparations prepared in Examples 4-6 and Comparative Examples 3-7 are shown in Table 3.

[0171] Table 3 Performance parameters of stem cell preparations prepared in Examples 4-6 and Comparative Examples 3-7

[0172] Group Homing efficiency (%) Transplantation 28-day survival rate (%) Skin collagen density improvement (%) Myocardial blood flow recovery rate (%) Recovery survival rate (%) Example 4 91.2±3.1 63.5±4.2 78.3±5.6 87.1±3.8 96.8±1.2 Example 5 89.5±2.8 60.1±3.9 72.5±4.9 84.3±4.1 95.3±1.5 Example 6 93.7±2.5 65.8±3.6 80.1±4.3 89.4±2.9 97.5±0.8 Comparative Example 3 41.7±6.3 22.8±5.1 35.2±7.8 38.6±6.9 94.1±2.1 Comparative Example 4 83.6±4.1 45.3±6.7 18.9±3.2 76.5±5.8 92.7±2.3 Comparative Example 5 87.4±3.9 34.2±7.1 68.3±6.1 51.7±8.3 95.8±1.6 Comparative Example 6 90.1±3.5 58.9±4.8 71.8±5.4 82.7±5.2 76.3±4.9 Comparative Example 7 62.3±8.7 29.7±6.4 40.5±7.2 43.1±9.6 93.2±2.4

[0173] In Table 3, homing efficiency: 48 h after tail vein injection in mice, live cell count at myocardial ischemic site; skin collagen: UV-induced aging mice, Masson staining after 28 days of injection; myocardial blood flow: coronary ligation rat model, SPECT detection of infarct area blood flow; data source: 3 batches of independent experiments (n=15), *p<0.01 vs corresponding example.

[0174] In Examples 4-6, the homing efficiency was >86%, the survival rate after 28 days of transplantation was up to 69.4%, the skin collagen density was increased by 84.4%,

[0175] The myocardial blood flow recovery rate was greater than 80%, and the resuscitation survival rate was >93%.

[0176] In comparative example 3, CHIR99021 was deleted and CXCR4 + The positive rate was 82%, resulting in inhibition of the Wnt / β-catenin pathway and downregulation of CXCR4 and integrin β1 expression; cells were retained in the lungs / liver and unable to target damaged tissues, resulting in a decrease in homing efficiency to 41.7±6%, an increase in skin collagen density of only 35.2±7.8%, and a myocardial blood flow recovery rate of 38.6±6.9%; apoptosis increased: the apoptosis rate rose to 58.3% 72 hours after transplantation, and the 28-day survival rate was 22.8±5.1%.

[0177] In comparative example 4, high concentrations of tea polyphenols inhibited the PI3K / Akt pathway, the activity of fibroblast collagen synthase (prolyl hydroxylase) decreased significantly, and the increase in skin collagen density decreased to 18.9% ± 3.2%.

[0178] In Comparative Example 5, the Fe3O4 coating rate in the targeted delivery medium prepared by the method of Comparative Example 2 was 84.5%, which was insufficient. Fibrinogen in the blood adsorbed the nanoparticles, magnetic targeting failed, growth factors were released suddenly, and the release was >50% in 0-6 hours; the nanoparticles were abnormally enriched in the spleen, and the myocardial blood flow recovery rate dropped to 51.7±8.3%.

[0179] In Comparative Example 6, hypertonicity caused cell dehydration, mitochondrial cristae rupture, and ATP synthesis decreased by 80%; the migration speed of the revived cells dropped to 12 μm / h, and the resuscitation survival rate dropped to 76.3%±4.9%.

[0180] In comparative example 7, TGF-β was not inhibited, Smad2 / 3 was phosphorylated, and the cells differentiated into myofibroblasts; the differentiated cells secreted TGF-β1, which accelerated host tissue fibrosis, and the survival rate dropped to 29.7%±6.4% 28 days after transplantation.

[0181] Example 7

[0182] Application for repairing aging skin, local dermal injection.

[0183] 1. Preparation

[0184] Stem cell preparation: Take the preparation prepared in Example 4 (containing 7.5×10 3D MSCs 5 / ml);

[0185] Compounding method: Mix with hyaluronic acid (molecular weight 1.5MDa) in a 1:1 volume ratio and shake evenly.

[0186] 2. Subjects

[0187] UVB-induced skin photoaging mice (female BALB / c, 12 weeks old, n = 15);

[0188] Grouping:

[0189] Treatment group (n=10), 100 μl / point of the compound preparation was injected into the dermis layer;

[0190] Control group (n=5), an equal amount of normal saline was injected.

[0191] 3. Treatment method

[0192] Injection site: the shaved area on the back, 1 cm apart, a total of 3 points;

[0193] Frequency: once a week, for 4 consecutive weeks.

[0194] 4. Detection index and result (as shown in Table 4)

[0195] Table 4. Detection index and result after treatment in the method of Example 7

[0196] Index Treatment group Control group Detection method Collagen density 162.3±12.7% 8.2±3.1% Masson staining + ImageJ Epidermis thickness Recovery to 45.2 ± 3.8 μm 32.1 ± 2.9 μm (atrophy) H&E section microscopic measurement ROS clearance rate 89.5±4.1% 21.3±5.7% DHE fluorescent probe flow COL1A1 gene expression 3.8 times No significant change qPCR (primer sequence see Table 5)

[0197] Table 5. Primer sequence

[0198] Gene Forward primer (5'-3') Reverse primer (5'-3') COL1A1 GAGGGCCAAGACGAAGACATC CAGATCACGTCATCGCACAAC SIRT1 ACAGTGGCATCTTCGGATACC TGCATGTTCCTGTGGCATGT GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA

[0199] As shown in Table 4, the collagen density of the treatment group was 162.3 ± 12.7%, which was much higher than that of the control group, 8.2 ± 3.1%. In the treatment group, MSCs secreted TGF-β to activate fibroblasts, and tea polyphenols inhibited MMP-1 enzyme.

[0200] The epidermal thickness of the treatment group was restored to 45.2 ± 3.8 μm, close to the standard of young skin; the epidermal thickness of the control group was 32.1 ± 2.9 μm, which was a typical state of aging atrophy.

[0201] The ROS clearance rate of the treatment group was 89.5 ± 4.1%, and that of the control group was only 21.3 ± 5.7%. In the treatment group, tea polyphenols in the stem cell preparation provided electrons to neutralize ROS, and wolfberry polysaccharides increased the Nrf2 pathway and the expression of SOD / GPx.

[0202] The expression of COL1A1 gene in the treatment group was increased by 3.8 times, and there was no significant change in the control group. The reason is that hyaluronic acid can achieve slow-release of stem cells and provide mechanical stimulation.

[0203] It is shown that the stem cell preparation of the application has a significant effect on repairing aging skin.

[0204] Example 8

[0205] Improvement of senile cardiac hypofunction, intravenous infusion.

[0206] 1. Preparation of the preparation

[0207] Stem cell preparation: take the preparation prepared in Example 6 (containing 3D MSCs 1×10 6 / ml);

[0208] Magnetic targeting: activate Fe3O4 by oscillating in a 0.5T magnetic field for 10 min before injection.

[0209] 2. Test subject

[0210] Aging-related heart failure rats (24-month-old SD rats, n=18);

[0211] Grouping:

[0212] Treatment group (n=12), tail vein infusion of 2.5×10 6 cells / kg;

[0213] Control group (n=6), infusion of equal amount of PBS.

[0214] 3. Treatment method

[0215] Dose: 2.5×10 6 cells / kg (precise corresponding to 60kg adult dose 1.5×10 8 cells);

[0216] Frequency: once every 5 weeks, a total of 3 times.

[0217] 5. Detection index and result (as shown in Table 6)

[0218] Table 6 Detection index and result after treatment by the method of Example 8

[0219] Index Treatment group Control group Detection method Left ventricular ejection fraction (LVEF) 62.5±3.8% 41.2±4.6% Cardiac ultrasound (Vevo 3100) Myocardial blood flow (MBF) 88.7 ± 5.3 ml / min / g 52.3 ± 6.1 ml / min / g Microsphere perfusion method Serum NT-proBNP 65.3 ± 8.1 pg / ml 215.4 ± 22.7 pg / ml ELISA kit Infarct size 18.2±3.5% 35.7±4.8% TTC staining

[0220] As shown in Table 6, the left ventricular ejection fraction of the treatment group increased to 62.5±3.8%, while that of the control group was only 41.2±4.6%; the myocardial blood flow of the treatment group increased to 88.7±5.3 ml / min / g, while that of the control group was only 52.3±6.1 ml / min / g; the serum NT-proBNP of the treatment group decreased to 65.3±8.1 pg / ml, while that of the control group was as high as 215.4±22.7 pg / ml; the infarct size of the treatment group decreased to 18.2±3.5%, while that of the control group was as high as 35.7±4.8%. It shows that the stem cell preparation of the application can effectively improve the aging heart function.

[0221] Comparative Example 8

[0222] The stem cell preparation and hyaluronic acid compounded dermal injection were replaced by stem cell preparation dermal injection alone. The remaining steps and parameters were consistent with Example 7. The index results after treatment by stem cell preparation dermal injection alone are shown in Table 7.

[0223] Table 7 Index results after dermal injection of stem cell preparations

[0224] Group Treatment method Collagen density improvement Cell retention rate (7 days) Treatment group (Example 7) Compound hyaluronic acid dermal injection 162.3±12.7% 38.5±4.2% Comparative Example 8 Stem cell preparation dermal injection alone 72.8±9.3% 12.1±3.7%

[0225] As shown in Table 7, dermal injection of the stem cell preparation alone increased skin collagen density by only 72.8 ± 9.3%, and the cell retention rate (7 days) was 12.1 ± 3.7%, significantly lower than that of the treatment group. This suggests that hyaluronic acid hydrogels can sustain the release of MSCs, and that combined injections of the stem cell preparation and hyaluronic acid offer superior results.

[0226] Comparative Example 9

[0227] In the cardiac function treatment, magnetic field guidance was eliminated and direct intravenous infusion was performed without a magnetic field. The remaining steps and parameters were consistent with those in Example 8. The results of direct intravenous infusion (without a magnetic field) for the treatment of age-related cardiac dysfunction are shown in Table 8.

[0228] Table 8 Results of direct intravenous infusion (without magnetic field) for the treatment of age-related cardiac dysfunction

[0229] Group Treatment method LVEF improvement Cardiac cell retention rate Treatment group (Example 8) Magnetic field guided intravenous infusion +21.3% 86.5% Comparative Example 9 Direct intravenous infusion (without magnetic field) +9.7% 28.3%

[0230] As shown in Table 8, in Comparative Example 8, direct intravenous infusion (without a magnetic field) resulted in a mere 9.7% increase in LVEF, while the cardiac cell retention rate was as high as 28.3%. A Fe₃O₄ coverage rate of ≥95% requires magnetic field-activated targeting; otherwise, the cells are retained in the lungs and liver.

[0231] The data of Examples 7-8 and Comparative Examples 8-9 were independently verified in 3 batches (n≥10), *p<0.01 vs control group.

Claims

1. A stem cell preparation, characterized in that: Calculated by weight, it includes the following components: 500-1000 parts of 3D mesenchymal stem cell suspension, 200-600 parts of probiotic-plant fermentation supernatant, 30-50 parts of targeted delivery medium, and 850-1000 parts of cryopreservation protection matrix; Among them, the concentration of 3D dynamic cultured mesenchymal stem cell suspension was 5×10 5 ~1×10 6 cells / mL, cell diameter ≤15 μm, CXCR4 + Positive rate ≥90%; The probiotic-plant fermentation supernatant includes wolfberry polysaccharides accounting for 10-25% of the total amount of the fermentation supernatant and tea polyphenols accounting for 7.5-20% of the total amount of the fermentation supernatant; The targeted delivery medium is a composite microsphere with a particle size of 100-200 nm, including 5-15 parts of Fe3O4 nanoparticles, 20-30 parts of gelatin coating layer, and 1-3 parts of loaded growth factors IGF-1 and VEGF, with a mass ratio of IGF-1 to VEGF of 0.98-1.02:1; the Fe3O4 coating rate is ≥95%; The cryoprotective matrix includes 15-25 parts of human serum albumin, 80-100 parts of DMSO, and 750-880 parts of a compound electrolyte solution; the osmotic pressure of the compound electrolyte solution ranges from 280 to 320 mOsm / kg.

2. A stem cell preparation according to claim 1, characterized in that The mesenchymal stem cells are derived from umbilical cord Wharton's jelly, adipose tissue or placenta, and CD73 + / CD90 + / CD105 + Expression ≥95%.

3. The stem cell preparation according to claim 1, characterized in that The solvent of the compound electrolyte solution is sterile distilled water. Calculated by mass fraction of the solvent, the compound electrolyte solution includes the following components: sodium chloride 5.0~5.5‰, sodium gluconate 4.8~5.2‰, sodium acetate 2~2.4‰, potassium chloride 0.35~0.40‰, and magnesium chloride 0.12~0.16‰.

4. A preparation method suitable for preparing the stem cell preparation according to any one of claims 1 to 3, characterized in that: The following steps are involved: S100, inoculating mesenchymal stem cells into a bioreactor in a serum-free medium and culturing them in suspension to obtain a 3D mesenchymal stem cell suspension; S200, preparing a probiotic-plant fermentation supernatant by dual-bacteria fermentation on a basal culture medium; S300, after mixing the above-mentioned 3D mesenchymal stem cell suspension and fermentation supernatant, add the targeted delivery medium at room temperature and mix evenly, add the cryoprotective matrix after cooling, and freeze in liquid nitrogen after programmed cooling.

5. The preparation method according to claim 4, characterized in that In step S100, the serum-free culture medium includes the following components: DMEM / F12 basal medium: 880-900 ml / L, human platelet lysate: 100-120 ml / L, bFGF: 5-10 ng / ml, EGF: 5-8 ng / ml, Pluronic® F-68: 0.5-1.0 g / L, hydroxyethyl starch: 1.0-2.0 g / L, CHIR99021: 3-5 μmol / L, SB431542: 5-10 μmol / L. The diameter of the cell aggregates in the suspension culture is 50-150 μm.

6. The preparation method according to claim 4, characterized in that In step S200, a mixture of ground wolfberry, tea leaves, and beetroot is used as a base culture medium, deionized water and a fermentation promoter are added, and the mixture is mixed with a Bifidobacterium breve bacterial solution and fermented anaerobically at 36-38°C for 8-12 hours; then a Lactobacillus plantarum bacterial solution is added, and the mixture is fermented aerobically at 30-37°C for 6-10 hours, inactivated, and centrifuged to obtain a supernatant; Among them, the mass ratio of wolfberry, tea, and beetroot is 3.8~4.2:0.98~1.02:1; The addition amount of Bifidobacterium breve and Lactobacillus plantarum were both ≥3.5×10 9 CFU / g raw material; The material-liquid ratio of basal culture medium to deionized water is 1:4.8~5.2; The fermentation promoter includes the following components, calculated by mass fraction of the basic culture medium: yeast extract powder 0.5~1.5%, manganese sulfate 0.05~0.1‰, Tween 80: 0.05~0.1%, and dipotassium hydrogen phosphate 0.1~0.3%.

7. The preparation method according to claim 4, characterized in that In step S300, the 3D mesenchymal stem cell suspension is mixed with the fermentation supernatant at room temperature, and then the targeted delivery medium is added. The mixture is cooled to 3-5°C and kept warm for 25-35 minutes. The cryoprotectant matrix is ​​then added and mixed. The mixture is then cooled to -80°C at a cooling rate of 1°C / min and then cryopreserved in a liquid nitrogen vapor phase at -190°C to -150°C.

8. The preparation method according to claim 4, characterized in that In step S300, the method for preparing the targeted delivery medium includes the following steps: Step 1, forming gelatin-Fe3O4 composite microspheres by emulsification-crosslinking method; Step 2: Use 0.15 M ammonium sulfate to establish a pH gradient and load IGF-1 / VEGF.

9. Use of the stem cell preparation according to any one of claims 1 to 8 in the preparation of anti-aging and repair drugs.

10. The use according to claim 9, characterized in that The application of the stem cell preparation in repairing aging skin or improving aging-related heart function impairment.

Citation Information

Patent Citations

  • Process for preparing mercapto-pyridazine-N-oxides or their salts.

    CH431542A

  • Vesicles with inner and outer aqueous-phase gradient difference and preparation method and application thereof

    CN101991536A

  • Three-dimensional induction method for obtaining mesenchymal stem cells through differentiation of pluripotent stem cells

    CN117683712A

  • Process for preparing human adipose-derived stem cell preparation and clinical application of human adipose-derived stem cell preparation

    CN118750654A

  • Stem cell biological preparation, preparation method and application of preparation as rhinitis treatment medicine

    CN120093789A