Pseudomonas paraxanthomonas strain 1653, biological preparation thereof and application of pseudomonas paraxanthomonas strain 1653

Abstract

The invention provides a pseudomonas paraxanthomonas strain 1653 and a biological preparation and application thereof, and relates to the technical field of biological control, the pseudomonas paraxanthomonas strain 1653 is collected from citrus leaves, isolated and cultured through a tissue isolation method to obtain a strain, and the strain is obtained through directional screening. The biological agent of the pseudomonas paraxanthomonas strain 1653 has a remarkable inhibition effect on citrus anthracnose and brown blotch, and has important practical significance on prevention and treatment of citrus anthracnose and brown blotch. And the biological agent is environment-friendly and non-toxic in source, has small influence on the ecological environment, and has a relatively good application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological control, in particular to a strain of Pseudomonas paracitroni, a biological preparation thereof and application. BACKGROUND

[0002] Citrus, as an important fruit crop widely planted around the world, occupies a key position in the field of agricultural economy. China is one of the main citrus producing areas, with a long history of cultivation and a wide variety of varieties. The citrus industry not only provides abundant fruit resources for the domestic large consumer market, but also has certain competitive advantage in international trade, playing an important role in promoting local economic development, increasing farmers' income and solving rural labor employment.

[0003] Citrus anthracnose is caused by Colletotrichum gloeosporioides, Colletotrichum acutatum and other fungi of the genus Colletotrichum. The disease can occur throughout the growth cycle of citrus and can infect various parts of citrus such as leaves, branches and fruits, causing leaf fall, branch dieback and fruit rot, etc.

[0004] Citrus brown spot, also known as citrus alternaria brown spot, has similar symptoms to anthracnose, but the pathogenic disease is quite different. Citrus brown spot mainly damages the new shoots, flower buds, leaves and fruits of citrus. It occurs more severely in seasons with warm temperatures and increased rainfall from March to April. Brown spot can cause flower buds and young fruits to fall off, and brown spot fruits may have raised lesions, but generally do not cause whole fruit rot.

[0005] Currently, the prevention and control of citrus anthracnose and brown spot mainly relies on chemical pesticides. Although chemical pesticides can effectively control the occurrence and spread of diseases in the short term, long-term and large-scale use of chemical pesticides has brought many negative effects. On the one hand, the pathogenic bacteria gradually develop resistance to chemical pesticides, which greatly reduces the control effect. In order to achieve the expected control effect, the dosage and frequency of pesticide use must be increased, which further aggravates the development of resistance, forming a vicious cycle. On the other hand, the large amount of chemical pesticide residues not only pollutes the ecological environment such as soil and water source, destroys the ecological balance, but also poses a potential threat to food safety and affects the health of consumers.

[0006] In addition, with the increasing attention to food safety and ecological environment protection, it is urgent to develop green, environmentally friendly and sustainable technologies for the prevention and control of citrus anthracnose and brown spot. Biological control, as an environmentally friendly control method, has received extensive attention. Biocontrol bacteria, as an important part of biological control, can inhibit the growth and infection of pathogenic bacteria through various mechanisms such as producing antibacterial substances, competing for nutrients and space, and inducing plant resistance, and have the advantages of safety, high efficiency, and no residue. Therefore, in-depth study of the technology and application of biocontrol bacteria for preventing and controlling citrus anthracnose and brown spot has important practical significance for the sustainable development of the citrus industry. SUMMARY

[0007] The purpose of the present application is to provide a strain of Pseudomonas paracitrea 1653, a biological preparation thereof and applications thereof. The biological preparation of the Pseudomonas paracitrea 1653 strain has a significant inhibitory effect on citrus anthracnose and brown spot, and can be effectively applied to the biological control of the above fungal diseases.

[0008] The embodiments of the present application are implemented as follows: The Pseudomonas paracitrea strain 1653 has a preservation number of GDMCC No. 66476 and was preserved in the Guangdong Microbial Culture Collection Center on June 6, 2025, at the address of 59 Building, 5th Floor, Guangzhou City, People's Martyrs Road, 100 Courtyard.

[0009] The biological preparation of the Pseudomonas paracitrea strain 1653 is a cell-free filtrate obtained by liquid culture, centrifugation and sterile filtration of the strain 1653.

[0010] The application of the biological preparation of the Pseudomonas paracitrea strain 1653 in the prevention and control of plant fungal diseases includes at least one of citrus anthracnose and citrus brown spot.

[0011] The beneficial effects of the embodiments of the present application are as follows: The present application provides a strain of Pseudomonas paracitrea 1653, a biological preparation thereof and applications thereof. The Pseudomonas paracitrea 1653 strain is collected from citrus leaves, isolated and cultured by tissue separation method to obtain the strain, and obtained by directional screening. The biological preparation of the Pseudomonas paracitrea 1653 strain has a significant inhibitory effect on citrus anthracnose and brown spot, and has important practical significance for the prevention and control of citrus anthracnose and brown spot. Moreover, the biological preparation is environmentally friendly and non-toxic, has little impact on the ecological environment, and has good application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0012] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the following will briefly introduce the drawings needed to be used in the embodiments. It should be understood that the following drawings only show some of the embodiments of the present application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.

[0013] Figure 1 The confrontation effect diagram of the Pseudomonas parafilavida strain 1653 provided by the present application and citrus anthracnose; Figure 2 The confrontation effect diagram of the Pseudomonas parafilavida strain 1653 provided by the present application and citrus brown spot; Figure 3 The inhibition effect diagram of the biological preparation of the Pseudomonas parafilavida strain 1653 provided by the test example 1 on the PDA plate; Figure 4 The comparison diagram of the colony diameter of the biological preparation of the Pseudomonas parafilavida strain 1653 provided by the test example 1 and the control group; Figure 5 The inhibition effect diagram of the biological preparation of the Pseudomonas parafilavida strain 1653 provided by the test example 2 on the PDA plate; Figure 6 The comparison diagram of the colony diameter of the biological preparation of the Pseudomonas parafilavida strain 1653 provided by the test example 2 and the control group; Figure 7 The inhibition effect diagram of the biological preparation of the Pseudomonas parafilavida strain 1653 provided by the test example 3 on the leaves of red orange; wherein, the left diagram is the CK control group, the middle diagram is the citrus anthracnose treatment group, and the right diagram is the strain 1653+ citrus anthracnose treatment group; Figure 8 The inhibition effect diagram of the biological preparation of the Pseudomonas parafilavida strain 1653 provided by the test example 3 on the leaves of red orange; wherein, the left diagram is the CK control group, the middle diagram is the citrus brown spot treatment group, and the right diagram is the strain 1653+ citrus brown spot treatment group. DETAILED DESCRIPTION

[0014] In order to make the purpose, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be described clearly and completely. The specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not mentioned by the manufacturers are all conventional products that can be obtained by market purchase.

[0015] The Pseudomonas parafilavida strain 1653, its biological preparation and application of the embodiments of the present application will be described in detail below.

[0016] The embodiment of the present application provides a strain of Pseudomonas paracitrea 1653, the preservation number of which is GDMCC No.66476, which was preserved in the Guangdong Microbial Culture Collection Center on June 6, 2025, and the address of the preservation is the 5th floor of No. 59 Building, the Institute of Martyrs, Guangzhou, China.

[0017] Further, the strain 1653 is isolated from citrus leaves and has the activity of inhibiting X. axonopodis and C. gloeosporioides.

[0018] Specifically, the isolation method of the strain 1653 comprises the following steps: Citrus leaves are collected, and the pseudostem base is cut into tissue blocks; After the tissue blocks are sterilized and dried, they are inoculated in LB medium and cultured at 25-28°C for 3-4 days to obtain initial colonies; Bacteria in the initial colonies are selected and purified on LB medium by plate streaking to obtain single colonies; Taking X. axonopodis as a target, the strain 1653 with obvious antibacterial effect on X. axonopodis is screened.

[0019] Further, the citrus leaves are collected from Ganzhou City, Jiangxi Province, and are cut into tissue blocks after being washed and surface sterilized. The tissue blocks are sterilized with ethanol and sodium hypochlorite in sequence, and then washed with sterile water. After the water is dried, the tissue blocks are inoculated in LB medium.

[0020] When the strain is screened, PDA plate medium is used, a 7mm-diameter X. axonopodis cake is placed on the plate, a sterilized toothpick is used to pick up a small amount of bacterial liquid of the single colony, and the toothpick is streaked at a distance of about 5cm from the cake. The plate is cultured in a 28°C incubator for 4-5d. Figure 1 The confrontation effect of the 1653 strain on X. axonopodis on the plate is shown. In the same way, C. gloeosporioides is tested by streaking, and the results are shown in Figure 2 It can be seen that the 1653 strain has the confrontation effect on X. axonopodis and C. gloeosporioides.

[0021] The strain 1653 is identified by a molecular biology method. Specifically, 16S rRNA gene sequencing is used for preliminary screening. Single colonies are picked up in 3mL LB liquid medium, and are cultured overnight in a 28°C, 180rpm shaker. The DNA of the bacteria is extracted according to the method of OMEGAD3350-1 Bacteria DNA Kit, and is stored at -20°C for standby. 16S rRNA universal primers 27F / 1492R are used for PCR amplification, and after detection, the sequencing is performed by Shengong Bioengineering (Shanghai) Co., Ltd.

[0022] The 16S rRNA sequencing results were submitted to NCBI for sequence alignment, and the results showed that the strain 1653 had high homology with multiple strains of Pseudomonas, such as Pseudomonas parafulva strain JBCS1880, Pseudomonas parafulva strain CRS01-1, Pseudomonas sp. SC11 chromosome, Pseudomonas sp. REB1044, Pseudomonas putida strain PP112420 and other strains, as high as 99%. Therefore, it is difficult to determine the taxonomic status of the strain 1653 by 16S rRNA sequence alone.

[0023] In order to determine the specific taxonomic status of the strain 1653, the gyrB gene sequence was further analyzed. After PCR amplification with the conserved gyrB primers UP1 / UP2S and passing the detection, the sequencing was entrusted to Shengong Bioengineering (Shanghai) Co., Ltd.

[0024] The nucleotide sequence amplified from the strain 1653 is as shown in SEQ ID NO: 1, and is as follows: GCGAACTGTGCAGACGATGTCATCGTCATCTTCAGCGCCCATGGCGTGTCCCAGGCTGTGCGTCAAGAAGCGGCGGGGCGCGGACTGAAGGTATTCGATGCCACTTGTCCGTTGGTGACCAAGGTGCACATCGAGGTGGCCAAGTACAGCCGTGATGGTCGTGAGTGCATTCTCATCGGCCATGCCGGGCACCCGGAAGTCGAAGGCACCATGGGTCAGTACGATGCCAGCAATGGCGGTGCGATCTACCTGGTCGAGGACGAGAAGGATGTTGCCACCTTGCAGGTGCGCGACCCGGAGCATCTGGCGTTCGTCACCCAGACCACCTTGTCGATGGATGACACCAGTCGCGTCATCGACGCCTTGCGAGCACGCTTTCCGAACATTGGCGGCGATTTTGA.

[0025] The 16S rRNA sequence and the conserved gene gyrB sequence of the strain 1653 and other Pseudomonas parafulva are used to construct a phylogenetic tree by using MEGA v11.0 software, and the results show that the strain 1653 has a homology of 99% with Pseudomonas parafulva, and the gyrB sequence has a homology of 96% with Pseudomonas parafulva, and it is determined that the strain 1653 is Pseudomonas parafulva.

[0026] The embodiment of the present application also provides a biological preparation of the Pseudomonas parafulva strain 1653, wherein the biological preparation is obtained by centrifuging and sterile filtering a cell-free filtrate obtained by liquid culturing the strain 1653.

[0027] Specifically, the liquid culture adopts LB culture medium, and the culture condition is 25-28 DEG C, 150-200 rpm oscillation culture for 10-15 h. The centrifugal speed is 2000-4000 rpm, and the time length is 5-20 min. Under the above condition, the culture effect is better.

[0028] The embodiment of the present application also provides an application of the biological preparation of the Pseudomonas parafulva strain 1653 in preventing and treating plant fungal diseases, and the plant fungal diseases include at least one of citrus anthracnose and citrus brown spot.

[0029] Further, the biological preparation is applied to the surface of citrus leaves or fruits when the prevention and treatment are performed. The application mode of the biological preparation is pressure inoculation or spraying, and the preparation concentration is OD 600 =0.05-0.15.

[0030] The features and performances of the present application are further described in detail in combination with the embodiments. Embodiment

[0031] The present embodiment provides a Pseudomonas parafulva strain 1653, and the separation process is as follows: S1. Prepare PDA culture medium and LB culture medium, and the specific preparation method is as follows: The PDA culture medium is prepared by washing and peeling potatoes, weighing 200g of the potatoes, cutting the potatoes into small pieces, boiling (boiling for 20-30 min, and the boiling can be stopped when the potatoes are broken by a glass rod), filtering with eight layers of gauze, adding 20g of glucose, adding water to 1000mL, stirring and mixing, adding 15g of agar, fully heating and dissolving, and then distributing into 250mL triangular bottles, 121 DEG C wet heat sterilization for 20 min, and preservation.

[0032] LB medium is prepared by weighing 10 g of tryptone, 5 g of yeast extract, and 10 g of sodium chloride, adding water to 1000 mL, stirring to mix, then adding 15 g of agar, heating to dissolve, and then pouring into 250 mL triangular bottles, sterilizing at 121°C for 20 min, and storing for later use.

[0033] S2. The citrus leaf and soil samples were brought back to the laboratory, washed and surface sterilized, and then cultured by tissue separation method to obtain the bacterial strain. The specific steps are as follows: the collected citrus leaf samples were washed with sterile water, the pseudostem base was cut into tissue blocks, and then sterilized in 75% (v / v) ethanol for 30 s, followed by sterilization in 3% (v / v) sodium hypochlorite for 1 min, and then washed with sterile water for 3 times. After the surface moisture was dried, the samples were inoculated on LB medium plates and incubated at 28°C for 3-4 days. The bacteria were picked and cultured as single colonies, and the strains were purified on LB solid medium plates by plate streaking method to obtain single colonies, which were ready for use.

[0034] S3. With citrus anthracnose as the target, a 7 mm diameter citrus anthracnose fungus cake was placed on a PDA plate culture medium, and a small amount of bacterial liquid of the strain obtained in step S2 was taken with a sterilized toothpick and streaked at a distance of about 5 cm from the fungus cake, and then incubated at 28°C for 4-5 days. A strain with obvious inhibition effect on the target bacteria was selected and named as 1653. EMBODIMENT

[0035] This embodiment provides a biological preparation of a Pseudomonas paracitrica strain 1653, and the preparation method is as follows: S1. A small amount of bacterial liquid of the strain 1653 selected in Example 1 was taken and placed in a 250 mL conical flask containing 150 mL of liquid LB medium, and then incubated at 28°C on a shaker at 180 rpm for 12 h.

[0036] S2. The bacterial liquid was centrifuged at 3000 rpm for 10 min, and then the bacterial bodies were filtered and removed by a bacterial filter to obtain the biological preparation of the strain 1653.

[0037] TEST EXAMPLE 1 This test example is used to test the inhibition effect of the biological preparation of the Pseudomonas paracitrica strain 1653 provided in Example 2 on citrus anthracnose, and the specific method is as follows: The biological preparation and PDA medium were mixed at a ratio of 1:9, and then poured into plates. A 7 mm diameter citrus anthracnose fungus cake was inoculated in the center of each plate as the experimental group. At the same time, sterile water was used to replace the biological preparation, and the control group (CK) was set up in the same way. The experimental group and the control group were incubated at 28°C at the same time until the control group was full of culture dishes. At this time, the diameter of the experimental group was measured, and the inhibition rate was calculated by the diameter ratio.

[0038] Figure 3 The results of the antibacterial experiment are shown, wherein Figure 3 The left side is the control group, and the right side is the experimental group. Figure 4 The diameter data of the two are compared. It can be seen that the biological agent in the experimental group has a significant inhibitory effect on citrus anthracnose. Through further calculation, the antibacterial rate is 26.49%.

[0039] Test Example 2 This test example is used to test the inhibitory effect of the biological agent of the Pseudomonas parahydrogena strain 1653 provided in Example 2 on citrus brown spot. The specific method is as follows: The biological agent and PDA medium are mixed at a ratio of 1:9, and the plate is poured. A 7mm diameter citrus brown spot fungus cake is inoculated in the center of the plate as the experimental group. At the same time, sterile water is used to replace the biological agent, and the control group (CK) is set up in the same way. The experimental group and the control group are cultured at 28°C at the same time until the control group is full of culture dishes. At this time, the diameter of the test group is measured, and the antibacterial rate is calculated by the diameter ratio.

[0040] Figure 5 The results of the antibacterial experiment are shown, Figure 5 The left side is the control group, and the right side is the experimental group, Figure 6 The diameter data of the two are compared. It can be seen that the biological agent in the experimental group has a significant inhibitory effect on citrus brown spot. Through further calculation, the antibacterial rate is 26.49%.

[0041] Test Example 3 This test example investigates the antibacterial effect of the biological agent of the Pseudomonas parahydrogena strain 1653 provided in Example 2 when applied to the leaf surface. The specific method is as follows: S1. Take 2-3 citrus anthracnose fungus cakes and place them in a 250mL sterilized conical flask containing 150mL YPD medium, and shake the fungus in a 28°C incubator for 2d. Filter the mycelium and collect the spores. Dilute the spores with sterile water to a concentration of 10 7 individual / mL of spore suspension, and store for later use.

[0042] S2. Again, use a loop to take a little single colony of strain 1653 and place it in a 250mL sterilized conical flask containing 150mL LB liquid medium, and shake the fungus in a 28°C incubator for 12h. Dilute the 1653 bacterial solution with sterile water to an OD 600 of about 0.1.

[0043] S3. Take 54 pieces of tender leaves of red orange and place them in a culture dish with filter paper (a total of 18 groups), use a syringe to pressure inoculate the leaves and place them in an incubator, pressure inoculate the citrus leaves in 6 groups in the spore suspension (1653 and citrus anthracnose treatment group), another 6 groups are inoculated with citrus anthracnose (citrus anthracnose treatment group), 6 groups are inoculated with 1653 bacterial solution (1653 treatment group), and the remaining 6 groups are irrigated with sterile water as a control (CK control group). Observe the citrus leaf disease every day.

[0044] The experimental results are shown in Table 3. Figure 7 As shown in Table 3, after the leaves grow for 7 days, the 1653 treatment group has no pathogenic effect on citrus itself, and has obvious growth promotion effect compared with the CK control group. Compared with the citrus anthracnose treatment group, the leaf disease degree of the 1653 and citrus anthracnose treatment group is obviously reduced.

[0045] Test Example 4 This test example investigates the bacteriostatic effect of the biological preparation of the Pseudomonas parahens strain 1653 provided in Example 2 when applied to the leaf surface. The specific operation method is consistent with that of Test Example 3, and the difference is that the citrus anthracnose is replaced by citrus brown spot disease, and the experimental results are shown in Table 4. Figure 8 As shown in Table 4, after the leaves grow for 7 days, compared with the citrus brown spot disease treatment group, the leaves of the 1653 and citrus brown spot disease treatment group have no obvious brown spot symptoms, which shows that the 1653 strain has a better prevention and control effect on citrus brown spot disease.

[0046] In summary, the present application provides a Pseudomonas parahens strain 1653, a biological preparation thereof and application thereof, the Pseudomonas parahens strain 1653 is collected from citrus leaves, and is obtained by tissue separation method and directional screening. The biological preparation of the Pseudomonas parahens strain 1653 has a significant inhibitory effect on citrus anthracnose and brown spot disease, and has important practical significance for preventing and treating citrus anthracnose and brown spot disease. Moreover, the biological preparation is environmentally friendly and non-toxic, has little impact on the ecological environment, and has a good application prospect.

[0047] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A Pseudomonas paraxanthinus strain 1653, characterized in that: The deposit number is GDMCC No. 66476, and it was deposited in the Guangdong Provincial Microbiological Culture Collection on June 6, 2025. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. The Pseudomonas paraxanthinospora strain 1653 according to claim 1, characterized in that The strain 1653 is isolated from citrus leaves and has the activity of inhibiting citrus anthracnose and brown spot pathogens.

3. The Pseudomonas paraxanthinospora strain 1653 according to claim 2, characterized in that The isolation method of the strain 1653 comprises: Collecting the citrus leaves, and cutting the pseudostem bases into tissue blocks; After the tissue block is sterilized and dried, it is inoculated into LB medium and cultured at 25-28°C for 3-4 days to obtain initial colonies; Bacteria from the initial colonies were selected and purified on LB medium by a plate streak method to obtain single colonies; Using citrus anthracnose as a target, a strain having a significant inhibitory effect on citrus anthracnose was screened out, namely the strain 1653.

4. The Pseudomonas paraxanthinospora strain 1653 according to claim 3, characterized in that The strain 1653 was amplified by PCR using gyrB primers UP1 / UP2S, and the resulting nucleotide sequence is shown in SEQ ID NO:

1.

5. A biological preparation of Pseudomonas paraxanthinospora strain 1653 according to any one of claims 1 to 4, characterized in that: The biological preparation is a cell-free filtrate obtained by liquid culture, centrifugation and sterile filtration of the strain 1653.

6. The biological preparation of Pseudomonas paraxanthinosus strain 1653 according to claim 5, characterized in that The liquid culture adopts LB medium, and the culture conditions are 25-28° C. and 150-200 rpm shaking culture for 10-15 h.

7. The biological preparation of Pseudomonas paraxanthinosus strain 1653 according to claim 6, characterized in that The centrifugal speed is 2000~4000rpm and the duration is 5~20min.

8. Use of a biological agent derived from the Pseudomonas paraxanthinus strain 1653 according to any one of claims 5 to 7 in preventing and controlling plant fungal diseases, characterized in that: The plant fungal diseases include at least one of citrus anthracnose and citrus brown spot.

9. The use according to claim 8, characterized in that The biological preparation is applied to the surface of citrus leaves or fruits.

10. The use according to claim 9, characterized in that The biological agent is applied by pressure inoculation or spraying, and the concentration of the agent is OD 600 =0.05~0.15.

Images