Bacillus for preventing and treating camellia oleifera anthracnose and application thereof

Abstract

The invention discloses bacillus for preventing and treating anthracnose of camellia oleifera and application of the bacillus. The preservation number of the bacillus CH-1-7 provided by the invention is GDMCC (Glucose Digital Microorganism Center) No. 66219; the bacillus amyloliquefaciens has the capability of generating living-promoting substances, can generate organic phosphorus and siderophores, has the nitrogen fixation capability, can inhibit the growth of various pathogenic bacteria, especially colletotrichum gloeosporioides, can be used for preventing and treating camellia oleifera anthracnose, and has important application value in the field of plant protection.

Description

Technical Field

[0001] The invention belongs to the field of plant protection, and particularly relates to a bacillus for preventing and treating oil-tea camellia anthracnose and an application thereof. Background Art

[0002] Camellia oleifera Camellia oleifera Camellia oleifera is a woody oil-bearing tree species unique to my country, with a cultivation history of over 2,000 years. It is mainly distributed in the warm and humid low mountain and hilly areas of southern China. Its seed oil is rich in unsaturated fatty acids such as oleic acid and linoleic acid, with a content of over 90% and a human digestion and absorption rate of 97%. It is known as the "Oriental Olive Oil" and is widely used in the food, medicine and cosmetics industries. However, the occurrence of camellia anthracnose has seriously restricted the development of the oil-tea camellia industry. Camellia oleifera anthracnose is caused by Colletotrichum gloeosporioides ( Colletotrichum gloeosporioides ) infection, mainly harms young and tender tissues of Camellia oleifera such as fruits, leaves, branches and buds, among which fruits are the most seriously affected. The disease can cause symptoms such as fruit drop, leaf drop, bud drop, branch dieback and branch ulcers. In severe cases, it can cause the death of the entire plant, seriously affecting the yield and quality of Camellia oleifera. During the occurrence of Camellia oleifera anthracnose, chemical agents such as carbendazim, prochloraz, and benzoyl-pyraclostrobin are often used for prevention and control. However, the use of chemical agents often causes environmental pollution problems. Therefore, the use of biocontrol bacteria to prevent and control Camellia oleifera anthracnose not only provides a new technical solution for the prevention and control of Camellia oleifera anthracnose, but also provides the public with healthier organic tea oil products. Summary of the Invention

[0003] In view of the existing technical problems, the present application provides a Bacillus sp. to effectively prevent and control the anthracnose disease of Camellia oleifera caused by Colletotrichum gloeosporioides.

[0004] Bacillus of the present invention Bacillus sp. was isolated from wetland mud weeds and numbered CH-1-7. According to the Bergey Manual of Bacterial Identification, the morphological characteristics, physiological and biochemical properties of strain CH-1-7, and the phylogenetic tree analysis constructed by 16S rDNA sequence, strain CH-1-7 was identified as belonging to the genus Bacillus ( Bacillus ), recorded as Bacillus ( Bacillus sp.) CH-1-7 (the bacterium was deposited in Guangdong Provincial Microbiological Culture Collection Center (abbreviated as: GDMCC) on April 27, 2025, with the deposit number: GDMCC No. 66219).

[0005] The characteristics of Bacillus CH-1-7 bacteria and colonies are as follows: after constant temperature culture at 30°C on PDA medium for 72 h, the colony surface is rough, opaque, slightly yellowish or grayish white, with wrinkles and protrusions, and the inoculation loop will draw threads when touched lightly, and the colony edge is radial; Gram staining is positive.

[0006] Bacillus CH-1-7 has the ability to secrete extracellular enzymes, including proteases, cellulases, and amylases. It also has the ability to produce bioactive substances, including organic phosphorus, siderophores, and nitrogen fixation, but lacks the ability to dissolve inorganic phosphorus or potassium.

[0007] Physiological and biochemical characteristics of Bacillus CH-1-7: This strain grows well at pH 5.7 and 7% sodium chloride, cannot grow anaerobically, can decompose starch and reduce nitrate, has a positive VP test, can utilize D-xylose and citrate, and produces gelatinase, but cannot utilize L-arabinose, D-mannitol, or propionate, and is Gram-positive. Reference to the Bergey's Manual of Bacterial Identification revealed that this strain's physiological and biochemical characteristics are consistent with those of the genus Bacillus.

[0008] The first object of the present invention is to provide a Bacillus ( Bacillus sp.) CH-1-7, deposited with GDMCC No. 66219.

[0009] The second object of the present invention is to provide a biological preparation, which uses the culture, volatiles, fermentation broth and / or metabolites of Bacillus CH-1-7 as active ingredients.

[0010] Preferably, the culture is prepared by the following method: inoculating Bacillus CH-1-7 into PDA solid culture medium and culturing at 30° C. to obtain Bacillus CH-1-7 culture; The fermentation broth is prepared by the following method: inoculating Bacillus CH-1-7 culture into KMB liquid culture medium, culturing at 30°C and 200 rpm for 2-3 days to obtain a fermentation broth; The metabolites are prepared by the following method: Bacillus CH-1-7 is inoculated onto KMB solid culture medium, cultured at 30°C for 10 days to obtain a culture, the culture that has been ground into powder and freeze-dried is mixed with methanol in a ratio of 1 g:5 mL to extract the metabolites produced by Bacillus CH-1-7.

[0011] Preferably, the PDA solid medium is composed of: 200 g / L potato, 20 g / L glucose, 17 g / L agar powder, the balance being water, pH 7.0-7.2; The composition of the KMB liquid medium is as follows: 20 g / L glucose, 20 g / L peptone, 1.5 g / L MgSO4, 1.5 g / L K2HPO4, and the balance is water; The composition of the KMB solid culture medium is as follows: 20 g / L glucose, 20 g / L peptone, 1.5 g / L MgSO4, 1.5 g / L K2HPO4, 15 g / L agar powder, and the balance is water.

[0012] The third object of the present invention is to provide the use of the Bacillus CH-1-7 or the biological preparation in at least one of the following (1)-(2): (1) Inhibit the growth of plant pathogens; (2) Promote plant growth.

[0013] Preferably, the plant pathogens are eucalyptus scorch blight AS-ZG-RAC, brown root pathogen L1-0-2, Colletotrichum gloeosporioides F1, Colletotrichum siamensis B0-2, Fusarium solani SM-LK-b5a, Colletotrichum T3-2-1, Colletotrichum T3-4-1, Sonneratia pseudodiscus hs2-1, Guangdong obscure red shell E1-1-a, Alternaria alternata WBHS-YK-2, Diplodia theobroma cocoa BZ-FL-1 and Fusarium solani GH-YB-1.

[0014] Preferably, the promoting of plant growth is by secreting extracellular enzymes, producing organic phosphorus, producing siderophores and / or fixing nitrogen.

[0015] Preferably, the extracellular enzyme is a protease, a cellulase and / or an amylase.

[0016] The fourth object of the present invention is to provide a method for preventing and controlling anthracnose of oil tea, comprising the step of applying the Bacillus CH-1-7 and / or the biological agent to oil tea.

[0017] Beneficial effects of the present invention: 1. Bacillus CH-1-7 can be used to prepare microbial fertilizer: The Bacillus CH-1-7 of the present invention has the ability to secrete extracellular enzymes, including proteases, cellulases, and amylases. It also produces substances that promote life, produces organophosphates and siderophores, and has the ability to fix nitrogen. It grows well under pH 5.7 and 7% sodium chloride conditions, decomposes starch, reduces nitrates, decomposes glucose to produce pyruvate, and utilizes D-xylose and citrate to produce gelatinase.

[0018] 2. Bacillus CH-1-7 is highly effective in preventing and treating anthracnose disease in oil-tea camellia and can be used to prepare biopesticides: After the tea leaves are pretreated with the Bacillus CH-1-7 fermentation liquid of the present invention, the tea leaves can be effectively controlled to cause anthracnose of the tea leaves caused by Colletotrichum gloeosporioides, and the preventive effect is good, which can reach 65.22%. The crude extract of the bacteria has a preventive effect of 28.04%, which is significantly different from the positive control.

[0019] The Bacillus CH-1-7 fermentation liquid of the present invention can control the anthracnose of the tea oil tea caused by Colletotrichum gloeosporioides after treating the diseased tea oil tea leaves, and the therapeutic effect can reach 28.36%, which is higher than that of pesticide treatment. The crude extract of the bacteria has a therapeutic effect of 19.40%, which is significantly different from the positive control.

[0020] Preservation Instructions The present invention Bacillus sp. CH-1-7 (Bacillus CH-1-7) was deposited in Guangdong Provincial Microbiological Culture Collection Center (abbreviated as: GDMCC) on April 27, 2025, with the deposit number: GDMCC No. 66219. The depository address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The screened soil bacteria have an inhibitory effect on anthrax.

[0022] Figure 2 The colony morphology and bacterial characteristics of Bacillus CH-1-7; A: Colony morphology of Bacillus CH-1-7 cultured on KMB, LB, and PDA media for 6 days; Bacillus CH-1-7 bacterial morphology under an optical microscope (B) and after Gram staining under an optical microscope (C).

[0023] Figure 3 This is the phylogenetic tree of Bacillus CH-1-7 based on the 16S rRNA gene.

[0024] Figure 4 It is a test of the ability of Bacillus CH-1-7 to produce pro-vitamin substances and secrete extracellular enzymes.

[0025] Figure 5 It is the antagonistic effect of Bacillus CH-1-7 antibacterial substances and volatile gases on pathogenic strains; A: antagonistic effect of Bacillus CH-1-7 antibacterial substances on pathogenic strains; B: inhibitory effect of Bacillus CH-1-7 volatile gases on pathogenic strains; C: inhibition rate of Bacillus CH-1-7 antibacterial substances and volatile gases on pathogenic strains.

[0026] Figure 6 It is the preventive effect of Bacillus CH-1-7 on anthracnose of Camellia oleifera.

[0027] Figure 7 It is the therapeutic effect of Bacillus CH-1-7 on oil-tea camellia anthracnose. DETAILED DESCRIPTION

[0028] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.

[0029] Example 1: Isolation and screening method of antagonistic strains (1) Strain isolation: The strain isolation materials were obtained from plant rhizosphere soils in forests, wetlands, parks and other areas in various prefecture-level cities in Guangdong Province. 2-4 soil samples were collected from each collection point. Each soil sample came from the rhizosphere of a different plant and was taken from a depth of 10 cm-20 cm underground. 10 g of rhizosphere soil from each plant was weighed and added to 0.1% Tween water for gradient dilution to obtain soil dilution solutions with concentrations of approximately 10, 100, and 1000 times dilution. The soil dilution solutions were then evenly applied to PDA plates. The PDA plates were incubated at a constant temperature of 30°C for 1-2 days.

[0030] (2) Strain purification: Use the plate streak method. Use a sterilized toothpick to pick up bacteria from the plate, streak culture on LB solid medium, culture at 30℃ for 1-2 days, and pick a single colony for preservation.

[0031] (3) Screening of strains: The plate confrontation culture method was used. A small amount of bacteria was picked and streaked on the PDA plate (2.0 cm long), and cultured at 30℃ for 1 day. The target strain anthracnose bacteria (fir anthracnose pathogenic strain T3-2-1) was placed 2.5 cm away from the bacteria and cultured at 30℃. A blank PDA plate was inoculated with anthracnose bacteria (fir anthracnose pathogenic strain T3-2-1) as a control and cultured at 30℃. The colony diameter and inhibition width were measured every day. The antagonistic effect of the bacterial culture on the anthracnose pathogen was determined. Among them, the colony diameter was determined by the cross-cross method, and the calculation formula for the inhibition rate measured by the colony diameter method is as follows: Pathogen growth inhibition rate = (control group colony growth diameter - treatment group colony growth diameter) / control group colony growth diameter × 100%. The experimental results showed that ( Figure 1 , Table 1). Among the seven selected bacterial strains, CH-1-7 showed the strongest ability to inhibit the target strain, with an inhibition rate of up to 87%. Homology comparison analysis was performed in the NCBI (http: / / blast.ncbi.nlm.nih.gov / ) gene library, and it was found that the CH-1-7 strain belongs to the genus Bacillus ( Bacillus In subsequent experiments, CH-1-7 strain was selected as the object of subsequent experiments.

[0032] Table 1 Inhibition rate of soil bacteria against anthrax Example 2: Identification of Bacillus CH-1-7 1. Identification of the morphology, culture characteristics, and physiological and biochemical properties of Bacillus CH-1-7: (1) The surface of the colony of Bacillus CH-1-7 on PDA medium is rough, opaque, slightly yellow or off-white, with wrinkled ridges and bulges on the surface. The inoculation loop touches the surface and draws lines. The edge of the colony is radial. The surface of the colony on KMB medium is rough, opaque, yellow, with wrinkled ridges and bulges on the surface. The inoculation loop touches the surface and draws lines. The surface of the colony on LB medium is rough, opaque, off-white, with wrinkled ridges and bulges on the surface. The inoculation loop touches the surface and draws lines. Figure 2 The bacterial morphology of Bacillus CH-1-7 under an optical microscope before and after Gram staining is as follows: Figure 2 As shown in B and C. According to Bacillus biochemical identification strips (Haibo Biotechnology Co., Ltd., Qingdao High-Tech Industrial Park), Bacillus CH-1-7 grows well at pH 5.7 and 7% sodium chloride, but cannot grow anaerobically. It can decompose starch and reduce nitrates, and the VP test is positive. It can utilize D-xylose and citrate and produce gelatinase, but cannot utilize L-arabinose, D-mannitol, or propionate (see Table 2). Reference to the Bergey's Manual of Bacterial Identification revealed that the physiological and biochemical characteristics of this strain are consistent with those of the genus Bacillus.

[0033] Table 2 Morphology and basic physiological and biochemical characteristics of Bacillus CH-1-7 (2) DNA identification of Bacillus CH-1-7: The genome of Bacillus CH-1-7 was extracted by thermal lysis. A single colony was inoculated into a 1.5 mL centrifuge tube containing 50 μL of sterile water. The cells were lysed at 100°C for 10 minutes and centrifuged at 10,000 rpm for 5 minutes. The supernatant was then used as a template. PCR amplification was performed using universal primers 27F and 1492R for 16 bacterial rRNA genes. The primer sequences are: 27F: AGAGTTTGATCCTGGCTCAG, SEQ ID NO. 2; 1492R: GGTTACCTTGTTACGACTT, SEQ ID NO. 3. The PCR reaction system (25 μL) consisted of: 12.5 μL PCR Mix, 1 μL DNA template, 1 μL 27F, 1 μL 1492R, and the remainder in dd water. The PCR amplification reaction procedure was as follows: initial denaturation at 94°C for 4 min; 35 cycles of denaturation at 94°C for 4 min, annealing for 30 s, annealing at 55°C for 1 min, and extension at 72°C for 30 s; and a final extension at 72°C for 10 min, followed by termination at 4°C. PCR products were checked by electrophoresis on a 1% agarose gel and subsequently sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. A fragment of approximately 1.4 kb was amplified by PCR, the nucleotide sequence of which is shown in SEQ ID NO. 1. This sequence was aligned using Chromas sequence assembly software and compared with the NCBI (http: / / blast.ncbi.nlm.nih.gov / ) gene library. Phylogenetic analysis was performed using MEGA 11 software using the neighbor-joining method to construct a phylogenetic tree. The numbers above each branch indicate the percentage of support after 1000 bootstrap resampling analyses.

[0034] In the early stage, homology comparison analysis was performed in the NCBI (http: / / blast.ncbi.nlm.nih.gov / ) gene library, and it was found that the CH-1-7 strain belongs to the genus Bacillus ( Bacillus ). Based on phylogenetic analysis ( Figure 3 ), further confirmed that the CH-1-7 strain belongs to the genus Bacillus and Bacillus amyloliquefaciens (Md1-43) strains have a close genetic relationship. Combining the morphological characteristics, physiological and biochemical properties of the strains and 16S rDNA, it was determined that the CH-1-7 strain belongs to the genus Bacillus and was recorded as Bacillus ( Bacillus sp.) CH-1-7.

[0035] Example 3: Detection of the ability of Bacillus CH-1-7 to produce probiotics and secrete extracellular enzymes (1) Protease detection Assay medium: 20 g skim milk powder, 15 g agar, and pure water to adjust the total volume to 1000 mL, pH 7.2-7.4.

[0036] Detection method: Inoculate the activated test strain cake (5 mm) on a 1% skim milk agar plate and culture at 30°C for 3 days. Observe whether a clear transparent hydrolysis zone appears around the colony. If so, it indicates that protease is produced. Repeat each treatment 3 times.

[0037] (2) Amylase detection Assay medium: 2 g soluble starch, 10 g tryptone, 5 g yeast extract, 10 g NaCl, and deionized water to adjust the total volume to 1000 mL.

[0038] Detection method: Inoculate the activated test strain cake (5 mm) on the culture medium and culture for 48 hours. After obvious colonies are formed, add Lugol's iodine solution to the plate for staining for 10 minutes. Wash the plate with 70% ethanol aqueous solution. A clear transparent hydrolysis zone can be seen around the colonies that produce amylase. Repeat each treatment 3 times.

[0039] (3) Cellulase detection Assay medium: 6 g NaCl, 0.1 g MgSO4, 0.5 g KH2PO4, 0.1 g CaCl2, 2.0 g (NH4)SO4, 2.0 g K2HPO4, 15 g agar, 5 g CMC-Na (sodium carboxymethyl cellulose), adjusted to a total volume of 1000 mL with deionized water, and the pH was adjusted to 7.0.

[0040] Detection Method: Inoculate a 5 mm cake of the activated test strain onto a cellulose screening medium plate, incubate at 30°C for 2 days, stain with 0.1% Congo red solution for 10 minutes, and decolorize with 1 mol / L NaCl solution for 5 minutes. If the strain produces cellulase, a clear transparent zone will appear around the cake. Repeat each treatment three times.

[0041] (4) Siderophore activity detection The ability to produce siderophores was detected by the chrome azurol S agar colorimetric method, and the detection culture medium used was a modified siderophore solid medium (Beijing Coolaibo Technology Co., Ltd., PM0821-1L).

[0042] Detection method: Take a single colony of Bacillus CH-1-7 cultured in LB for 24 hours and spot-inoculate it on the siderophore activity detection medium. Incubate it at 30℃ for 3 days and observe whether there is a yellow halo around the colony.

[0043] (5) Inorganic phosphorus decomposition ability test Assay medium: 10 g glucose, 5 g Ca3(PO4)2, 5 g MgCl2·6H2O, 0.25 g MgSO4·7H2O, 0.2 g KCl, 0.1 g (NH4)2SO4, 15 g agar, adjusted to a total volume of 1000 mL with deionized water, and the pH was adjusted to 7.0-7.2.

[0044] Detection method: Inoculate the activated bacterial cake (5 mm) of the test strain on an inorganic phosphorus plate, culture at 30°C for 3 days, and observe whether there is a hydrolysis zone around the colony.

[0045] (6) Detection of organophosphorus decomposition ability Assay medium: 10.0 g glucose, 0.5 g ammonium sulfate, 0.3 g magnesium sulfate, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.03 g ferrous sulfate, 0.03 g manganese sulfate, 0.2 g lecithin, 5.0 g calcium carbonate, 18.0 g agar, distilled water to 1 L, pH adjusted to 7.0-7.5.

[0046] Detection method: Inoculate the activated bacterial cake (5 mm) of the test strain on an organophosphorus plate, culture at 30°C for 3 days, and observe whether there is a hydrolysis zone around the colony.

[0047] (7) Potassium-dissolving ability test Detection culture medium: Use potassium-dissolving medium (Beijing Coolaibo Technology Co., Ltd., MM5081-250 g) to detect the ability of insoluble potassium in the culture medium to be converted into soluble potassium.

[0048] Detection method: Inoculate a 5 mm bacterial cake on the potassium-solubilizing culture medium and culture it in a constant temperature incubator at 30℃ for 3 days. Observe whether there are transparent oil droplet-like colonies on the potassium-solubilizing bacterial culture medium plate. The presence of transparent oil droplet-like colonies proves that the bacteria has the ability to solubilize potassium.

[0049] (8) Nitrogen fixation capacity test Modified Ashby nitrogen-free medium: 0.2 g MgSO4·7H2O, 0.1 g CaSO4, 0.2 g KH2PO4, 5.0 g CaCO3, 0.2 g NaCl, 10.0 g glucose, 15 g agar, make up to 1,000 mL with pure water, and adjust the pH to 7.0-7.2.

[0050] Detection method: Inoculate a 5 mm bacterial cake on a modified Ashby nitrogen-free medium, culture at 30°C for 3 days, transfer three generations, and observe whether there is a transparent hydrolysis zone around the colony.

[0051] The experimental results showed that Bacillus CH-1-7 has the ability to secrete extracellular enzymes and can produce protease, cellulase, and amylase. It has the ability to produce substances that promote life, can produce organic phosphorus, siderophore, and nitrogen fixation, but has no ability to dissolve inorganic phosphorus and potassium ( Figure 4 ).

[0052] Example 4: Antagonistic Effects of Bacillus CH-1-7 Antibacterial Substances and Volatile Gases on Colletotrichum gloeosporioides (1) Use a pipette tip to dip the Bacillus CH-1-7 cells that have been cultured for 2 days, and draw a 2 cm line on a plate containing 20 mL of PDA (each 1000 mL contains 200 g of potato, 20 g of glucose and 17 g of agar powder, pH 7.0-7.2). Then place the plate in a constant temperature of 30℃ and culture for 2 days to obtain a solid culture.

[0053] (2) The isolated Bacillus CH-1-7 was subjected to growth inhibition tests on Chinese fir leaf pathogens, Sonneratia apetala leaf pathogens, Cone serrata branch pathogens, Ficus microcarpa root pathogens, Osmanthus fragrans pathogens, Ficus microcarpa leaf pathogens, and Chinese fir seedling pathogens. The plate confrontation culture method was used, and a hole puncher (5 mm) was used to cut the test pathogen Eucalyptus wilt ( Calonectria ilicicola )AS-ZG-RAC (Eucalyptus), Brown Rhizoctonia solani ( Phellinus noxius ) L1-0-2 (Ficus microcarpa), Colletotrichum gloeosporioides ( Colletotrichum gloeosporioides )F1 (Camellia oleifera), Colletotrichum siamensis ( Colletotrichum siamense )B0-2 (Camellia oleifera), Fusarium solani ( Fusarium solani )SM-LK-b5a (Chinese fir), Sonneratia pseudospora ( Pestalotiopsis sonneratiae ) hs2-1 (Sonneratia apetala), Diplospora cocoa ( Lasiodiplodia theobromae ) BZ-FL-1 (white cone), Guangdong dark red shell ( Celoporthe guangdongensis ) E1-1-a (Sonneratia apetala), Fusarium spp. ( Neofusicoccum parvum )GH-YB-1 (Osmanthus fragrans), Alternaria ( Alternaria pogostemonis )WBHS-YK-2 (Sonneratia apetala), Colletotrichum spp. ( Colletotrichum sp.) T3-2-1 (fir) and T3-4-1 (fir) were inoculated onto the PDA plates containing the solid culture in step (1); 5 mm diameter bacterial cakes of each strain were inoculated onto empty PDA plates as the control group, with three replicates for each treatment. Cultures were placed in a 30°C incubator, and colony diameters and inhibition widths were measured daily. The antagonistic effect of Bacillus sp. CH-1-7 culture against the pathogenic bacteria of oil-tea anthracnose was determined.

[0054] (3) The pathogenic bacteria cakes described in step (2) were inoculated into PDA plates, and then placed on the PDA plates containing the solid culture in step (1) to serve as the treatment group; a blank PDA plate was placed on the PDA plate inoculated with the pathogenic bacteria cakes described in step (2) to serve as the control group; each treatment was repeated 3 times, and the plates were cultured at a constant temperature of 30°C. The colony diameters were measured every other day, and the radial growth inhibition rate of the pathogens was calculated to determine the inhibitory effect of the volatile gas of Bacillus CH-1-7 on the pathogens of oil-tea anthracnose.

[0055] The calculation formula is as follows: Pathogen growth inhibition rate = (colony growth diameter of the control group - colony growth diameter of the treatment group) / colony growth diameter of the control group × 100%.

[0056] The results show that ( Figure 5 ), the antibacterial substances in Bacillus CH-1-7 had different degrees of inhibitory effects on the tested pathogens, among which the antibacterial substances against Colletotrichum gloeosporioides ( Colletotrichum gloeosporioides )F1 (Camellia oleifera), Colletotrichum spp. ( Colletotrichum sp.) T3-2-1 (fir), Siamese spiny spore fungus ( Colletotrichum siamense ) B0-2 (Camellia oleifera), Sonneratia pseudodiscus ( Pestalotiopsis sonneratiae ) strain hs2-1 (Sonneratia apetala), Guangdong dark cluster red shell ( Celoporthe guangdongensis ) strain E1-1-a (Sonneratia apetala) had a strong inhibitory effect, with an inhibition rate of more than 70%. Figure 5 A in the equation represents the antagonistic effect of the antibacterial substance of Bacillus CH-1-7 on pathogenic strains; Figure 5 C is the inhibition rate of Bacillus CH-1-7 antibacterial substances and volatile gases on pathogenic strains.

[0057] Bacillus CH-1-7 produces antibacterial volatiles during its growth process, which can significantly inhibit the growth of Colletotrichum gloeosporioides ( Colletotrichum gloeosporioides) F1 (Camellia oleifera) and Sonneratia gloeosporioides ( Pestalotiopsis sonneratiae ) strain hs2-1 (Sonneratia apetala). Colony diameter and inhibition rate are as follows Figure 5 As shown, Figure 5 B in the figure is the inhibitory effect of the volatile gas of the CH-1-7 strain on the pathogenic strain; Figure 5 C is the inhibition rate of CH-1-7 antibacterial substances and volatile gases against pathogenic strains. Combined with the actual application prospects, F1 oil-tea camellia anthracnose bacteria was finally selected as the further experimental object.

[0058] Example 5: Experiment on the control effect of Bacillus CH-1-7 on anthracnose of oil-tea camellia 1. Test methods (1) Preparation of fermentation broth: Use a bacterial loop to dip the Bacillus CH-1-7 cells cultured for 3 days and inoculate them into a 500 mL Erlenmeyer flask containing 300 mL of KMB liquid culture medium (each 1000 mL contains 20 g glucose, 20 g peptone, 1.5 g MgSO4, and 1.5 g K2HPO4). Place the flask on a shaker and shake at 30°C and 200 rpm for 64 h to obtain the fermentation broth. After the fermentation is completed, the fermentation broth is mixed with sterile KMB liquid culture medium at a volume ratio of 1:20, and the bacterial concentration is measured as OD 600 =0.898.

[0059] (2) Preparation of crude extract: Bacillus CH-1-7 cultured for 3 days was inoculated into sterile KMB solid medium and cultured for another 10 days. The culture was then ground into powder and freeze-dried. A methanol extraction method was used to extract the secondary metabolites produced by Bacillus CH-1-7 by mixing the culture with methanol at a mass volume ratio of 1 g:5 mL to obtain a crude extract. The crude extract was diluted with sterile KMB liquid medium at a volume ratio of 1:25 to obtain a crude extract.

[0060] (3) The preventive effect of Bacillus CH-1-7 on anthracnose of camellia oleifera The test strain F1 of Colletotrichum gloeosporioides was inoculated onto sterilized PDA plates and incubated at 25°C in the dark for 5 days before use. Healthy, disease-free leaves from spring shoots of Camellia oleifera were selected and rinsed with clean water. These leaves were disinfected with 75% ethanol for 30 seconds and then rinsed three times with sterile water. After the leaves dried, the petioles were sealed with wax oil to preserve the leaves in vitro for as long as possible. Two symmetrical locations on the leaf surface were punctured with a sterile syringe needle. Thirty leaves were included in each group.

[0061] The processing groups set up are as follows: Fermentation liquid group: leaves were immersed in fermentation liquid for 3 s; Crude extract group: leaves were soaked in crude extract for 3 s; Pesticide group: The leaves were immersed in a pesticide solution (containing 150 mg / L salicylic acid and 200 mg / L prochloraz) diluted in KMB sterile liquid medium for 3 s.

[0062] Positive control group: soak the leaves in KMB sterile liquid medium for 3 s.

[0063] Treated leaves from the four treatment groups were placed on 15 mm plates (with sterile filter paper moistened with sterile water placed on the bottom). The plates were then sealed and placed in a 28°C incubator. After 24 hours, each pinhole was inoculated with a 5 mm F1 strain of Colletotrichum gloeosporioides anthracnose. The leaves were then placed in a 28°C incubator, and in vitro efficacy was calculated after 13 days. For the negative control group, leaves were soaked in KMB sterile liquid medium for 3 seconds, then inoculated with blank medium 24 hours later. Incubation conditions were the same as those for the four treatment groups above.

[0064] (4) The therapeutic effect of Bacillus CH-1-7 on anthracnose of camellia oleifera Before the experiment, tea oil leaves were rinsed, disinfected, cleaned, and punctured as described in the preventive test. Leaves from the fermentation liquid, crude extract, pesticide, and positive control groups were inoculated with a 5 mm cake of Colletotrichum gloeosporioides at the puncture site using a sterile syringe needle. The leaves were then placed on 15 mm plates (with sterile filter paper moistened with sterile water placed at the bottom), and the plates were sealed. Leaves from the negative control group were inoculated with blank PDA medium. Leaves from all treatment groups were placed in a 28°C incubator and immersed in the liquid from the different treatment groups after infection.

[0065] Fermentation liquid group: leaves were immersed in fermentation liquid for 3 s; Crude extract group: leaves were soaked in crude extract for 3 s; Pesticide group: The leaves were immersed in a pesticide solution (containing 150 mg / L salicylic acid and 200 mg / L prochloraz) diluted in KMB sterile liquid medium for 3 s; Positive control group: leaves were immersed in KMB sterile liquid culture medium; Negative control group: the leaves were immersed in KMB sterile liquid culture medium.

[0066] After treatment, the plants were placed in a constant temperature incubator at 28°C, and the in vitro protective effect was calculated after 10 days.

[0067] (5) Data statistics and analysis Leaves were placed on a scanner and scanned by a computer to obtain scanned photos of leaves from different treatment groups. The photos were dragged into Image-Pro Plus 6.0 one by one, and lesions were selected using Image-Pro Plus 6.0 software to measure the lesion area.

[0068] Grade standard for anthracnose of oil tea: 0: Leaf spot area ≤ 0.12 cm 2 (Average lesions in negative control group); 1: 0.12 cm 2 Leaf spot area ≤ 1 cm 2 ; 2: 1 cm 2<Leaf lesion area ≤3 cm 2 ; 3: 3 cm 2 Leaf spot area ≤5 cm 2 ; 4:5 cm 2 Leaf spot area ≤8 cm 2 ; 5:8 cm 2 <Leaf lesion area.

[0069] The calculation formula is as follows: Disease incidence (%) = diseased leaves in each treatment group / total leaves in each treatment group × 100%; Disease index = ∑ (number of diseased leaves at each level × value of the disease level) / (total number of leaves × highest level value) × 100%; Therapeutic effect or preventive effect = (disease index of positive control group - disease index of treatment group) / positive control group.

[0070] 2. Test results (1) Prevention trial results Bacillus CH-1-7 has a good preventive effect on anthracnose of Camellia oleifera (Table 3, Figure 6 ), among which the fermentation liquid of Bacillus CH-1-7 can effectively control the anthracnose of camellia oil tea caused by Colletotrichum gloeosporioides after pretreatment of camellia oil tea leaves, with a good preventive effect of up to 65.22%. The crude extract of the fungus had a preventive effect of 28.04%, which was significantly different from the positive control.

[0071] Table 3 Preventive effects of Bacillus CH-1-7 fermentation broth, crude extracts and pesticides on anthracnose of Camellia oleifera (2) Treatment trial results Table 4 The therapeutic effects of Bacillus CH-1-7 fermentation broth, crude extract and pesticides on anthracnose of Camellia oleifera The fermentation liquid of Bacillus CH-1-7 can control the anthracnose of tea oil tea caused by Colletotrichum gloeosporioides after treating the diseased tea oil tea leaves (Table 4, Figure 7 ), the therapeutic effect can reach 28.36%, which is higher than that of pesticide treatment. The therapeutic effect of the crude extract of the fungus is 19.40%, which is significantly different from the positive control.

Claims

1. A strain of Bacillus ( Bacillus sp.) CH-1-7, characterized in that The deposit number is GDMCC No. 66219.

2. A biological agent, characterized in that The invention comprises the culture, volatile matter, fermentation liquid and / or metabolite of Bacillus CH-1-7 according to claim 1 as an active ingredient.

3. The biological preparation according to claim 2, characterized in that The culture is prepared by the following method: inoculating Bacillus CH-1-7 onto a PDA solid culture medium and culturing at 30° C. to obtain a Bacillus CH-1-7 culture; The fermentation broth is prepared by the following method: inoculating Bacillus CH-1-7 culture into KMB liquid culture medium, culturing at 30°C and 200 rpm for 2-3 days to obtain a fermentation broth; The metabolites are prepared by the following method: Bacillus CH-1-7 is inoculated onto KMB solid culture medium, cultured at 30°C for 10 days to obtain a culture, the culture that has been ground into powder and freeze-dried is mixed with methanol in a ratio of 1 g:5 mL to extract the metabolites produced by Bacillus CH-1-7.

4. The biological preparation according to claim 3, characterized in that The PDA solid medium is composed of 200 g / L potato, 20 g / L glucose, 17 g / L agar powder, and the balance is water, with a pH of 7.0-7.

2. The composition of the KMB liquid medium is as follows: 20 g / L glucose, 20 g / L peptone, 1.5 g / L MgSO4, 1.5 g / L K2HPO4, and the balance is water; The KMB solid culture medium is composed of 20 g / L glucose, 20 g / L peptone, 1.5 g / L MgSO4, 1.5 g / L K2HPO4, 15 g / L agar powder, and the balance is water.

5. Use of the Bacillus CH-1-7 according to claim 1 or the biological preparation according to claim 2 in at least one of the following (1)-(2): (1) Inhibit the growth of plant pathogens; (2) Promote plant growth.

6. The use according to claim 5, characterized in that The plant pathogens are eucalyptus scorch pathogen AS-ZG-RAC, brown rhizoctonia solani L1-0-2, Colletotrichum gloeosporioides F1, Colletotrichum siamensis B0-2, Fusarium solani SM-LK-b5a, Colletotrichum t3-2-1, Colletotrichum t3-4-1, Sonneratia pseudodiscus hs2-1, Guangdong obscure red shell E1-1-a, Alternaria alternata WBHS-YK-2, Diplodia theobroma cocoa BZ-FL-1 and Fusarium solani GH-YB-1.

7. The use according to claim 5, characterized in that The plant growth promotion is achieved by secreting extracellular enzymes, producing organic phosphorus, producing siderophores and / or fixing nitrogen.

8. The use according to claim 7, characterized in that The extracellular enzyme is protease, cellulase and / or amylase.

9. A method for preventing and treating anthracnose of oil-tea camellia, characterized in that: The method comprises the steps of applying the Bacillus CH-1-7 according to claim 1 and / or the biological preparation according to claim 2 to Camellia oleifera.

Images