Application of SNP (Single Nucleotide Polymorphism) site in predicting occurrence risk of type 2 diabetic nephropathy

Abstract

The invention discloses application of an SNP (Single Nucleotide Polymorphism) site in predicting the occurrence risk of type 2 diabetic nephropathy, and belongs to the technical field of biological detection. The application finds that the SNP site rs5741812 of the lipopolysaccharide binding protein (LBP) has obvious correlation with the occurrence of the type 2 diabetic nephropathy for the first time, and prompts that the rs5741812 can be used as a marker for predicting or assisting in predicting the occurrence risk of the type 2 diabetic nephropathy, so that the sensitivity and the specificity of predicting the occurrence risk of the type 2 diabetic nephropathy are improved; the method has important significance on clinically predicting early-stage type 2 diabetic nephropathy.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological detection, and particularly relates to the use of SNP site rs5741812 of LBP in predicting the risk of occurrence of type 2 diabetic nephropathy. BACKGROUND

[0002] Type 2 diabetes mellitus (T2DM) is a chronic metabolic disease, and its core feature is that insulin resistance or insufficient insulin secretion leads to persistent high blood sugar (hyperglycemia). Type 2 diabetes often has multiple complications, among which diabetic kidney disease (DKD) is one of the most common complications of type 2 diabetes, mainly manifested as progressive damage to the microvasculature and glomerular structure of the kidney, and eventually can lead to renal failure. Therefore, it is necessary to predict the risk of kidney disease in type 2 diabetes in advance, so as to intervene and prevent the occurrence of kidney disease at an early stage.

[0003] In existing research, genome-wide association study (GWAS) has revealed the key role of genetic variation in the course of renal failure, so finding genes or sites related to kidney disease can provide important basis for predicting the occurrence of kidney disease. For example, the Chinese patent application with publication number CN102246035A discloses a method and composition for diagnosing and prognosing kidney injury and renal failure, which involves using analysis of one or more markers as biomarkers for diagnosing and prognosing kidney injury and renal failure, such as cytoplasmic aspartate aminotransferase, soluble tumor necrosis factor receptor superfamily member 5, soluble CD40 ligand, etc. The Chinese patent application with publication number CN119351537A discloses an application for detecting SNP sites related to type 2 diabetic nephropathy, and the combination of SNP sites can be used to predict type 2 diabetic nephropathy. However, due to the multi-factor pathogenic characteristics of kidney disease, different markers may reflect the same pathological pathway (such as inflammation or fibrosis), leading to information overlap and difficulty in analyzing the interaction between markers; in addition, the pathological mechanisms of renal failure caused by different etiologies (such as diabetic nephropathy and hypertensive nephropathy) are quite different, and a single indicator cannot accurately reflect the damage to multiple pathways. Therefore, it is necessary to seek new related genes or sites to improve the accuracy of kidney disease prediction.

[0004] It has been shown that the SNP of Lipopolysaccharide Binding Protein (LBP) gene can be closely related to metabolic disorders by regulating gene expression or protein function and oxidative stress and renal fibrosis process. The present application is committed to elucidate a new SNP site for predicting the risk of type 2 diabetic nephropathy, which is located in the LBP gene. SUMMARY

[0005] Therefore, the primary purpose of the present application is to provide the use of SNP site in predicting the risk of type 2 diabetic nephropathy. The present application finds that the SNP site rs5741812 of LBP gene is significantly related to the risk of type 2 diabetic nephropathy by bioinformatics analysis, and further verifies that rs5741812 can be used as a marker for predicting or assisting in predicting the risk of type 2 diabetic nephropathy, and improves the sensitivity and specificity of predicting the risk of type 2 diabetic nephropathy, which is of great significance for predicting early type 2 diabetic nephropathy in clinic.

[0006] In order to achieve the above purpose, the present application adopts the following technical solutions: One aspect of the present application discloses the use of a reagent for detecting the genotype of a SNP site in at least one of a-c, wherein the SNP site is rs5741812 of the LBP gene: a: preparing a product for predicting the risk of type 2 diabetic nephropathy; b: preparing a product for screening or assisting in screening type 2 diabetic nephropathy; c: preparing a product for detecting the genotype of a SNP site related to type 2 diabetic nephropathy.

[0007] Another aspect of the present application discloses a kit containing a reagent for detecting the genotype of a SNP site, wherein the SNP site is rs5741812 of the LBP gene.

[0008] The present application has the following beneficial effects: The SNP site rs5741812 of the LBP gene disclosed in the present application is significantly related to the risk of type 2 diabetic nephropathy, and the genotype of the SNP site can predict the risk of type 2 diabetic nephropathy, providing a new basis for early prediction of the risk of type 2 diabetic nephropathy, facilitating early intervention or intervention of the occurrence of nephropathy, so that the high-risk population can reduce the occurrence of type 2 diabetic nephropathy through early intervention. BRIEF DESCRIPTION OF DRAWINGS

[0009] Figure 1 Figure 1 is a diagram of the results of SNP analysis in the ±2 kb region of the LBP gene using the GWAS database.

[0010] Figure 2 The distribution of different genotypes (AA, AT, TT) of the SNP site rs5741812 in 113 subjects with kidney disease.

[0011] Figure 3 The ROC curve based on the genomic sequencing results of 113 subjects and the diagnosis of type 2 diabetic nephropathy. DETAILED DESCRIPTION

[0012] The embodiments of the present application will be described below in detail, and the technical solutions in the embodiments described below are exemplary, and only possible technical implementations of the present application, and not all possible implementations. Those skilled in the art can combine the embodiments of the present application without creative labor to obtain other embodiments, and these embodiments are also within the protection scope of the present application.

[0013] The first aspect of the present application discloses the use of a reagent for detecting the genotype of a SNP site in at least one of a~c, wherein the SNP site is rs5741812 of the LBP gene.

[0014] The inventors of the present application determined through previous studies that LBP is highly expressed in proximal tubular cells (PT), while the expression of LBP in the renal tubules of DKD population is significantly reduced, suggesting that the reduction of LBP expression may be associated with DKD. Based on the results of the previous studies, the present application performed association analysis on the SNP located in the ±2 kb region of the LBP gene and the kidney-related characteristics, and determined that the SNP site rs5741812 on the LBP gene has the most significant correlation with kidney failure, and is mainly related to chronic kidney failure, i.e., kidney damage. Different genotypes of rs5741812 can predict the risk of occurrence of type 2 diabetic nephropathy, and have high sensitivity and specificity, which is of great significance for early prediction of the occurrence of type 2 diabetic nephropathy in clinical practice.

[0015] The wt wild sequence (AA genotype) containing the SNP site rs5741812 on the LBP gene is as follows: TCAACAAGCAAAAACTTTTTTAACACTTATAATTCTACCCCCACAACCAGAGACA ATGCCTCATGAC TCCTTGCTAAATATTTTCCAGATTGTTGAACATAGAAGCCTATTTTGAACCCCCCAAAATAGAACCTTACTCTATGGTGCCATTGGAAACGG ATGCCTCATGACATCCCTTTCCTTGCCAAGAAATACCTTTATTTCTGCAGCCTCACTTTAAGGGACA (SEQ ID NO. 1).

[0016] Mutant sequences (AT genotype and TT genotype): TCAACAAGCAAAAACTTTTTTAACACTTATAATTCTACCCCCACAACCAGAGACA ATGCCTCATGTC TCCTTGCTAAATATTTTCCAGATTGTTGAACATAGAAGCCTATTTTGAACCCCCCAAAATAGAACCTTACTCTATGGTGCCATTGGAAACGG ATGCCTCATGAC ATCCCTTTCCTTGCCAAGAAATACCTTTATTTCTGCAGCCTCACTTTAAGGGACA (SEQ ID NO. 2).

[0017] Wherein, the underlined sequence indicates the sequence containing rs5741812 site in the sequencing result, and the bold site is rs5741812.

[0018] Based on the different genotypes of rs5741812 of LBP gene, the following uses can be realized: a: preparing a product for predicting the risk of developing type 2 diabetic nephropathy, and judging the risk of developing type 2 diabetic nephropathy by different genotypes, wherein the risk of TT genotype is the highest, the risk of AT genotype is the second, and the risk of AA genotype is the smallest; b: preparing a product for screening or assisting in screening type 2 diabetic nephropathy, and assisting in screening whether the subject has type 2 diabetic nephropathy by different genotypes, which can be used as an auxiliary index to improve the screening accuracy of nephropathy in combination with other indexes; c: preparing a product for detecting the genotype of SNP site related to type 2 diabetic nephropathy.

[0019] As an example, the A>T base type of the SNP site can predict the risk of developing type 2 diabetic nephropathy. Specifically, the presence of T allele in rs5741812 site indicates an increased risk of developing type 2 diabetic nephropathy. Further, when the genotype of the SNP site is AT or TT genotype, it indicates a high risk of developing type 2 diabetic nephropathy. In the present application, the "risk" refers to the fact that an individual is more likely to develop a disease or disorder than the general population based on genetic, environmental, health and / or other risk factors. The increase in the likelihood of developing a disease can be an increase of about 10%, 20%, 50%, 100%, 150%, 200% or more.

[0020] In the present application, the detection of SNP site genotype can be carried out by methods well known to those skilled in the art, such as by PCR amplification and sequencing, but is not limited to this method, any technology capable of detecting SNP site genotype in the art can be used. As an example, the reagent contains primers or probes for detecting SNP site genotype. In the present application, the "primer" refers to a nucleic acid sequence with a free 3' hydroxyl group, which can form base pairs with a template complementary to a specific base sequence and serve as the starting point for template strand replication. Primers can initiate DNA synthesis in the presence of polymerase reagents (i.e. DNA polymerase or reverse transcriptase) and four different nucleotide triphosphates under appropriate buffer and temperature. Among them, the specific PCR conditions, the length of the forward and reverse primers can be appropriately selected according to the techniques known in the art, without particular limitation. The "probe" refers to a molecule that binds to a specific sequence or subsequence or other part of another molecule, unless otherwise indicated, the term "probe" generally refers to a nucleic acid probe that binds to another nucleic acid (also referred to herein as "target polynucleotide") by complementary base pairing.

[0021] As an example, the reagent contains primers for detecting SNP site genotype, which includes a forward primer with a nucleotide sequence as shown in SEQ ID NO. 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 4. In some examples, the primer also contains an extension primer with a nucleotide sequence as shown in SEQ ID NO. 5.

[0022] In the present application, the "sample", "biological sample" and "biological sample" refer to any sample containing nucleic acid from or derived from a subject. As an example, the biological sample is a blood sample of the subject, in particular a peripheral blood sample. Peripheral blood sample has the advantages of convenient sampling, small trauma and high compliance of the subject. In the present application, the "subject", "individual" and "patient" have the same meaning in the present application and can be used interchangeably, which generally refers to an animal subject, in particular a vertebrate subject, and even more particularly a mammalian subject, which includes but is not limited to primates, rodents (such as mice, rats or guinea pigs), rabbits, cows, sheep, goats, pigs, horses, dogs, cats, etc., and the preferred subject is a primate (such as a human, an ape, a monkey, a chimpanzee). The subject suitably suffers from type 2 diabetes.

[0023] In the present application, the product is any and well known in vitro detection product in the art, including but not limited to chips, kits, preparations, compositions, etc.

[0024] As an example, the product is a chip or a kit. The term "chip" refers to a chip that integrates biochemical analysis processes on the chip surface according to the principle of specific interaction between biomolecules, thereby realizing high-throughput and rapid detection of DNA, RNA, polypeptide, protein and other biological components. The term "kit" refers to a matched reagent combination for a specific detection item or experimental purpose, usually including various reagents (such as enzymes, antibodies, substrates, buffers) required for determination, standards, controls, reaction instruments (such as microwell plates, test tubes), and detailed instructions for use.

[0025] A second aspect of the present application discloses a kit containing reagents for detecting the genotype of a SNP site, the SNP site being rs5741812 of the LBP gene.

[0026] The configuration of the reagents in the kit is different according to the detection analysis technology. As an example, the detection of the genotype of the SNP site is realized by sequencing analysis after PCR amplification.

[0027] As an example, the reagents contain primers for detecting the genotype of the SNP site, the nucleotide sequence of the forward primer being as shown in SEQ ID NO. 3 and the nucleotide sequence of the reverse primer being as shown in SEQ ID NO. 4. In some examples, the reagents further contain an extension primer, the nucleotide sequence of the extension primer being as shown in SEQ ID NO. 5.

[0028] It can be understood that, in addition to the necessary reagents for detecting the genotype of the SNP site, the kit also contains enzymes, buffers, cleaning solutions, etc., which can be configured as needed, and those skilled in the art have such ability.

[0029] In the present application, the kit contains instructions, which record a method for detecting the genotype of the SNP site, the method comprising the following steps: Extracting a biological sample of a subject and extracting genomic DNA of the biological sample; Detecting the base sequence of the genomic DNA of the biological sample at the SNP site and determining the genotyping of the genomic DNA at the SNP site.

[0030] In the present application, the kit can be a kit for detecting the genotype of rs5741812 of the SNP site on the LBP gene.

[0031] In other examples, the kit is a kit for predicting the risk of developing type 2 diabetic nephropathy, and at this time, the method further comprises: The step of predicting the risk of developing type 2 diabetic nephropathy based on the measured genotype of the SNP site.

[0032] The genotypes of the detected SNP sites are TT genotype, AT genotype and AA genotype respectively; among the three genotypes, the risk of kidney disease is highest in TT genotype, followed by AT genotype, and the risk of kidney disease is lowest in AA genotype. Specifically, in some examples, the probability of kidney disease in TT genotype is 2.5 times that of AA genotype, and the probability of kidney disease in AT genotype is 1.9 times that of AA genotype.

[0033] In other examples, the kit is a kit for screening or assisting in screening type 2 diabetic nephropathy, and the method further comprises: Screening or assisting in screening type 2 diabetic nephropathy based on the measured genotype of the SNP site.

[0034] The genotypes of the detected SNP sites are TT genotype, AT genotype and AA genotype respectively; among the three genotypes, if the genotype is TT genotype or AT genotype, it indicates that the patient is likely to have kidney disease, which can be comprehensively judged in combination with other indicators or clinical manifestations.

[0035] The present application will be further illustrated by specific examples below. It should be noted that the specific examples below are only for illustrative purposes, and do not limit the scope of the present application in any way.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application.

[0037] In addition, unless otherwise specified, the methods without specific description of conditions or steps are conventional methods, and the reagents and materials used can be obtained from commercial channels.

[0038] Example 1 In this embodiment, bioinformatics analysis found that the SNP site rs5741812 of LBP gene has the most significant correlation with kidney failure, and further found that rs5741812 is mainly related to chronic kidney failure, i.e. kidney injury. The relevant information of SNP site rs5741812 can be found at https: / / www.ncbi.nlm.nih.gov / snp / rs5741812.

[0039] The specific research of this embodiment is as follows: Firstly, the SNP located in the region of ±2 kb of LBP gene was associated with kidney-related traits using GWAS database (http: / / geneatlas.roslin.ed.ac.uk / ). Further, a nested case-control study was designed to investigate the association between SNP rs5741812 of LBP gene and DKD risk in T2DM patients using the data of UK Biobank (UKB) cohort. This prospective cohort recruited over 500,000 participants aged 37 to 78 years old in 21 assessment centers between 2006 and 2010. More detailed study protocol and assessment methods of UKB cohort can be found in previous studies. Among them, participants who met one of the following six criteria were defined as T2DM patients: (1) hospitalization records showed diabetes diagnosis, ICD-9 code 250.00, 250.10, 250.20 and 250.90, or ICD-10 code E11; (2) self-reported physician diagnosis; (3) self-reported history of using hypoglycemic drugs; (4) self-reported use of insulin; (5) random blood glucose level ≥11.1 mmol; (5) hemoglobin A1c (HbA1c) level ≥48 mmol / mol (6.5%).

[0040] The analysis of the correlation between SNP sites in the 5' region and 3' region of the LBP gene and kidney failure in the GWAS database showed that the rs5741812 site was most significantly correlated with kidney failure Figure 1 ), and classification of kidney failure data set found that the rs5741812 site was mainly related to chronic kidney failure, i.e., kidney injury (Table 1).

[0041] Table 1 Association study of rs5741812 site based on genome-wide association analysis (GWAS) and kidney failure

[0042] Table 2 Association analysis of rs5741812 site and DKD in T2DM patients in UKB database

[0043] Table 2 shows the analysis results of UKB database. As can be seen from Table 2, the genotype of SNP site rs5741812 on LBP gene is significantly associated with type 2 diabetic nephropathy. Specifically, the probability of kidney disease for AT genotype of rs5741812 is 2 times that of AA genotype; the probability of kidney disease for TT genotype is 2.5 times that of AA genotype; the probability of DKD for AT genotype and TT genotype is about 10% higher than that of AA genotype.

[0044] The above results show that the genotype of SNP site rs5741812 on the LBP gene can predict the risk of type 2 diabetic nephropathy.

[0045] Example 2 In this embodiment, a detection method of the genotype of SNP site rs5741812 on the LBP gene is disclosed. The detection method can detect the genotyping of SNP site rs5741812 on the LBP gene, and provides an application basis for predicting the risk of type 2 diabetic nephropathy.

[0046] The specific steps are as follows: 2.1 Collect 2 mL of peripheral venous blood of T2DM patients in an EDTA anticoagulant tube, and mix well immediately after blood collection to ensure that the blood and anticoagulant are fully mixed; extract DNA according to the instructions of the blood genomic DNA extraction kit DP304-02 (China Genereach Limited Company).

[0047] 2.2 Use the Nanodrop 4000 spectrophotometer of Thermo to detect the DNA concentration. Dilute the detected sample DNA concentration to 10 ng / μL with high-pressure sterilized deionized water as a DNA template for use.

[0048] 2.3 PCR amplification The PCR primer sequence, reaction system and reaction program are shown in Tables 3, 4 and 5, respectively: Table 3 PCR primer sequence information

[0049] Table 4 PCR reaction system

[0050] Table 5 PCR reaction program

[0051] 2.4 Gel purification of PCR product (1) Place the PCR product under item 2.3 in a 2% concentration agarose gel for electrophoresis treatment, then cut the target band from it for gel recovery and purification.

[0052] (2) Add 500 μl Buffer BL to the centrifugal adsorption column, stand for 1 min, centrifuge at 12000 rpm at room temperature for 1 min, discard the waste liquid in the collection tube, and put the centrifugal adsorption column back into the collection tube.

[0053] (3) After electrophoresis, quickly cut out the target fragment under UV light. Place the gel block into a 1.5 ml sterile centrifuge tube (self-provided), weigh it, and calculate the gel weight. The gel block in each tube should not exceed 700 mg. (Note: Try to remove the DNA-free part of the gel block and cut the gel block into small pieces as much as possible.) (4) Add Buffer MB at a ratio of 1 μl Buffer MB per 1 mg of gel (1:1), mix thoroughly, and place in a 55°C water bath to ensure complete dissolution of the gel (approximately 5-10 minutes). Invert the tube several times during the water bath to accelerate dissolution.

[0054] (5) After the gel solution has cooled to room temperature, transfer it to a centrifugal adsorption column (with a collection tube), let it stand for 1 min, and then centrifuge it at 12,000 rpm for 1 min at room temperature.

[0055] (6) Add the waste liquid in the collection tube back into the centrifugal adsorption column, reinsert it into the collection tube, let it stand for 1 min, and centrifuge it at 12,000 rpm for 1 min at room temperature. (Note: Do not centrifuge at low temperature, otherwise the adsorption efficiency will be reduced).

[0056] (7) Add 600 μl of Buffer MW (with anhydrous ethanol added) to the centrifugal adsorption column, centrifuge at 12,000 rpm for 30 s at room temperature, and discard the waste liquid in the collection tube.

[0057] (8) Reinsert the centrifugal adsorption column into the collection tube and repeat the previous step.

[0058] (9) Centrifuge at 12,000 rpm for 2 minutes at room temperature and discard the collection tube. Place the adsorption column in a 1.5 ml sterile centrifuge tube and air dry for 2 minutes.

[0059] (10) Add 20 μl of autoclaved deionized water (preheated to 55°C before use) to the center of the adsorption column, let it stand at room temperature for 1 min, and centrifuge at 12,000 rpm for 1 min.

[0060] (11) After centrifugal collection, deionized water can be added to the centrifugal adsorption column again to repeat the elution, and the adsorption column can be discarded to obtain DNA fragments.

[0061] 2.5 Sanger sequencing (1) Sequencing reaction system: The total sequencing reaction system is 5µl, including 1µl of sequencing primer (3.2µM), 1-3µl of PCR product purified under "2.4", and 1µl of BigDye Mix kit.

[0062] (2) Reaction procedure: 94°C for 1 min; 28 cycles: then 94°C for 20 s, 50°C for 10 s, 60°C for 4 min; 4°C for 30 min, complete.

[0063] (3) NH4A C •EDTA purification: After gene sequencing is completed, centrifuge the 96-well culture plate at 3700 rpm for 0.5 min; then add 1µl of NH4AC•EDTA solution to each well and centrifuge at 3700 rpm for 30 seconds; then place on a mixer and shake rapidly for 30 seconds, and then centrifuge at 3700 rpm for 30 seconds.

[0064] (4) Precipitation with 100% alcohol: Add 18µl of 100% anhydrous ethanol solution and precipitate at -20°C for half an hour. Then centrifuge at 4500 rpm for 30 minutes, and then centrifuge at 400 rpm for 2 minutes in an inverted state.

[0065] (5) Washing with 75% alcohol: Add 50µl of 75% alcohol, then centrifuge at 4500rpm for 10min, and then centrifuge at 400rpm for 2min in an inverted state.

[0066] (6) Denaturation: Add 6µl Hi-Di, centrifuge at 3700rpm for 30s, and store in a -20℃ refrigerator until loaded on a 3730xl sequencer.

[0067] (7) Gene sequencing was performed using a 3730xl sequencer. DNA sequencing analysis software was used for processing and analysis, Sequencing Analysis 5.2.0 software was used for interpretation, and Sequencher 5.1 software package was used for final alignment analysis to determine the genotyping of the SNP loci.

[0068] Example 3 In this example, the prediction of the risk of type 2 diabetic nephropathy by rs5741812 was further studied in combination with specific clinical cases.

[0069] 3.1 A total of 119 clinical cases from the First Affiliated Hospital of the University of Science and Technology of China were included in the study sample. These cases were all patients with type 2 diabetes and were divided into two groups. Group 1, consisting of 75 patients, included patients with type 2 diabetes but no kidney disease; Group 2, consisting of 44 patients, included patients with type 2 diabetes and kidney disease. The basic information of the cases is shown in Table 6: Table 6 Basic information of 119 clinical cases

[0070] The genotypes of the SNP site rs5741812 of these 119 clinical cases were detected using the method in Example 2. The results are shown in Table 7: Table 7 Genotype sequencing results of SNP site rs5741812

[0071] From the experimental results in Table 7, it can be seen that the genotype of rs5741812 of the LBP gene is significantly correlated with DKD. In patients with type 2 diabetes and nephropathy, the TT genotype has the highest proportion, followed by the AT genotype, and the AA genotype has the least.

[0072] 3.2 113 patients with type 2 diabetes and nephropathy from the First Affiliated Hospital of the University of Science and Technology of China were enrolled in the study. Eligibility criteria included type 2 diabetes diagnosed with type 2 diabetic nephropathy and clinical indicators (urine albumin, urine Scr (mg / dL), and urine albumin-to-creatinine ratio (UACR mg / gCr)) suggestive of renal impairment. Genotyping of the SNP site rs5741812 was performed using the method described in Example 2, and sequencing results were obtained. Basic information and genotyping of the patients are shown in Table 8: Table 8 Basic information and genotyping of 113 clinical cases

[0073] 3.2.1 Based on the sequencing results of 113 clinical cases, the chi-square test was used to further verify the correlation between the genotype of SNP site rs5741812 and type 2 diabetic nephropathy. The results are shown in Tables 9-11 and Figure 2 .

[0074] Table 9 Chi-square test contingency table analysis of genotype expected frequencies

[0075] Table 10 Chi-square statistics based on expected frequency analysis

[0076] Table 11 Key values ​​of chi-square test for genotype sequencing results

[0077] In Table 11, the degrees of freedom are: df = (r - 1) × (c - 1), where r is the number of rows and c is the number of columns. Here, r = 3 (the three genotypes) and c = 2 (the two cases of non-nephropathy and nephropathy), so df = (3 - 1) × (2 - 1) = 2.

[0078] Based on the chi-square test results, the chi-square statistic is 6.1159 (approximately 6.12 to two decimal places), the P value is 0.047 (approximately 0.05 to two decimal places), and the degrees of freedom are 2. In statistics, 0.05 is usually used as the significance level. When the P value is less than or equal to 0.05, we reject the null hypothesis.

[0079] Here, the null hypothesis is that there is no association between genotype and the presence of kidney disease. Since the calculated P value is approximately 0.05, which is less than or equal to the commonly used significance level of 0.05, we have sufficient evidence to reject the null hypothesis and conclude that there is a significant association between the genotype of the SNP site rs5741812 and the presence of kidney disease. This means that the genotype of the SNP site rs5741812 (AA, AT, TT) and the kidney disease status (nephropathy, non-nephropathy) are not independent of each other, and different genotypes may affect the development of kidney disease. This further confirms that the SNP site rs5741812 can be used to predict the risk of kidney disease in type 2 diabetes.

[0080] 3.2.2 Based on the sequencing results of 113 clinical cases, the ROC curve was drawn ( Figure 3 ), to study the sensitivity and specificity of SNP site rs5741812 genotype in predicting the risk of type 2 diabetic nephropathy.

[0081] True positive rate (TPR): The calculation formula is ,in TP is the number of true positive samples (actually kidney disease and predicted to be kidney disease), FN is the number of false positive samples (those with actual kidney disease but predicted to have no kidney disease).

[0082] False positive rate (FPR): The calculation formula is ,in FP is the number of false positive samples (predicted to have kidney disease but without kidney disease), TN is the number of true negative samples (those who actually do not have kidney disease and are predicted to have no kidney disease).

[0083] The optimal threshold on the ROC curve is usually the point that maximizes the Youden's Index. The Youden's Index is calculated as follows: Youden's Index = True Positive Rate (TPR) + Specificity (TNR) - 1. Specificity = 1 - False Positive Rate (FPR).

[0084] Table 12 ROC curve key point threshold distribution and prediction score

[0085] The predicted scores (probability of kidney disease) in the data are: 0.214, 0.407, 0.538. We traverse these three values and the values outside the interval (such as -∞ and +∞) as thresholds, and generate 4 valid threshold points in total.

[0086] Threshold > 0.538: At this time, all samples will be predicted as negative class (no kidney disease). Because the threshold is very high, no sample's predicted score can exceed it. So the number of true positives (TP) and false positives (FP) are both 0. According to the formula TPR = 0, FPR = 0.

[0087] Threshold = 0.538: This threshold is the probability of kidney disease for TT genotype. Only the samples with predicted score greater than or equal to this threshold in TT genotype will be predicted as positive class (kidney disease). Since the predicted scores of other genotypes are all less than this threshold, the number of false positives (FP) is 0, i.e. FPR = 0. Only the patients with kidney disease in TT genotype can be correctly detected, while the patients with kidney disease in AA and AT genotypes will be missed, so TPR = 0.318.

[0088] Threshold = 0.407: This threshold is the probability of kidney disease for AT genotype. At this time, the samples with predicted score greater than or equal to this threshold in AT and TT genotypes will be predicted as positive class. This makes the number of true positives enough, the true positive rate is high, and most patients with kidney disease (patients with kidney disease in AT and TT genotypes) can be detected, TPR = 0.864, i.e. all samples with kidney disease are correctly predicted. At this threshold, the false positive rate is 0, i.e. no non-kidney disease patients are misdiagnosed as kidney disease, so FPR = 0.

[0089] Threshold = 0.214: This is the probability of kidney disease for AA genotype. Because the predicted scores of all samples are greater than or equal to this very low threshold, all samples will be predicted as positive class. This results in TPR = 1.000000 (all samples with kidney disease are correctly predicted) and FPR = 1.000000 (all samples without kidney disease are incorrectly predicted as kidney disease).

[0090] Genotype risk: For AA genotype: probability of kidney disease = 6 / (22 + 6) = 6 / 28 ≈ 0.214; For AT genotype: probability of kidney disease = 24 / (35 + 24) = 24 / 59 ≈ 0.407; For TT genotype: probability of kidney disease = 14 / (12 + 14) = 14 / 26 ≈ 0.538; TT genotype has the highest risk (53.8% probability of kidney disease), which is 2.5 times that of AA genotype; The AT genotype risk is the second (40.7% probability of kidney disease), which is 1.9 times of the AA type; The AA genotype risk is the lowest (21.4% probability of kidney disease).

[0091] The area under the ROC curve AUC = 0.8785 (about 0.88).

[0092] At the optimal threshold = 0.407 (i.e. about the Youden index MAX = 0.864) Overall accuracy (Accuracy): the proportion of all samples correctly predicted.

[0093] Accuracy = = 0.947.

[0094] From these data, it can be seen that the probability of kidney disease of different genotypes is significantly different. The probability of kidney disease of AA genotype is relatively low, while the probability of kidney disease of TT genotype is relatively high. With the change of genotype from AA to TT, the probability of kidney disease shows an upward trend.

[0095] The above experimental results show that based on the mutation of SNP site rs5741812 (i.e. genotype) to predict type 2 diabetic nephropathy has good effect. SNP site rs5741812 can be used as a marker or auxiliary marker to predict the risk of type 2 diabetic nephropathy, providing a basis for early screening of high-risk kidney disease population and realizing early intervention of kidney disease.

[0096] It should be noted that the present application is not limited to the above embodiments. The above embodiments are only examples, and embodiments having the same technical idea and playing the same role and effect within the scope of the technical solutions of the present application are all included in the technical scope of the present application. In addition, within the scope of the main idea of the present application, various modifications of the embodiments that can be thought of by those skilled in the art, and other ways constructed by combining part of the constituent elements of the embodiments are also included in the scope of the present application.

Claims

1. Use of a reagent for detecting SNP genotype in at least one of the following items a to c, wherein: The SNP site is rs5741812 of the LBP gene: a: Prepare a product to predict the risk of developing type 2 diabetic nephropathy; b: Preparation of products for screening or assisting in screening of type 2 diabetic nephropathy; c: Prepare products for detecting the genotype of SNP sites associated with type 2 diabetic nephropathy.

2. The use according to claim 1, characterized in that The A>T base type of the SNP site can predict the risk of type 2 diabetic nephropathy; Preferably, the presence of the T allele at the SNP site indicates an increased risk of type 2 diabetic nephropathy; Preferably, when the genotype of the SNP site is AT or TT genotype, it indicates a high risk of developing type 2 diabetic nephropathy.

3. The use according to claim 1, characterized in that The reagent contains primers or probes for detecting the genotype of the SNP site.

4. The use according to claim 3, wherein The reagent contains primers for detecting the genotype of the SNP site, wherein the primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; Preferably, the primer further comprises an extension primer, and the nucleotide sequence of the extension primer is shown in SEQ ID NO.

5.

5. The use according to any one of claims 1 to 4, characterized in that The sample for detecting the SNP site genotype is the subject's blood sample.

6. A kit, characterized in that The kit contains a reagent for detecting the genotype of a SNP site, and the SNP site is rs5741812 of the LBP gene.

7. The kit according to claim 6, wherein The reagent contains primers for detecting the genotype of the SNP site, wherein the primers contain a forward primer having a nucleotide sequence as shown in SEQ ID NO.3 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; Preferably, the primer further comprises an extension primer, and the nucleotide sequence of the extension primer is shown in SEQ ID NO.

5.

8. The kit according to claim 6, wherein The kit contains instructions, which describe a method for detecting the genotype of the SNP site, comprising the following steps: extracting a biological sample from a subject, and extracting genomic DNA from the biological sample; detecting the base sequence of the genomic DNA of the biological sample at the SNP site to determine the genotype of the genomic DNA at the SNP site; Preferably, the biological sample is a peripheral blood sample of a subject; Preferably, the subject suffers from type 2 diabetes.

9. The kit according to claim 8, wherein The method further comprises: The method comprises the following steps: predicting the risk of type 2 diabetic nephropathy based on the genotype of the measured SNP site; or screening or assisting screening for type 2 diabetic nephropathy based on the genotype of the measured SNP site.

10. The kit according to claim 9, wherein The three genotypes of the detected SNP loci were TT, AT, and AA. Among the three genotypes, the TT genotype had the highest risk of kidney disease, followed by the AT genotype, and the AA genotype had the lowest risk of kidney disease. Preferably, the probability of nephropathy in the TT genotype is 2.5 times that of the AA genotype, and the probability of nephropathy in the AT genotype is 1.9 times that of the AA genotype.

Images