Immature bitter orange-based original plant identification method based on InDel molecular marker and special primer combination

Abstract

The invention discloses an immature bitter orange-based original plant identification method based on an InDel molecular marker and a special primer combination, and belongs to the technical field of traditional Chinese medicinal material identification. In order to solve the problem of uncontrollable quality of medicinal materials caused by miscellaneous immature bitter orange base (lime, sweet orange and Yichang orange) in the prior art, two pairs of specific primers YCC-F / R (SEQ ID NO: 1-2) are screened out through genome re-sequencing and are used for specific identification of the Yichang orange (amplifying a single bande-1000bp); the invention relates to a specific primer for identifying three primary plants, in particular to a specific primer for identifying three primary plants, namely SC-F / R (SEQ ID NO: 3-4), which is used for distinguishing acid orange (single bande-1300 bp) and sweet orange (double bande-1200 bp / 1300 bp), and triple accurate identification of the three primary plants can be realized by combining PCR (Polymerase Chain Reaction) amplification and gel electrophoresis analysis. The method is simple and convenient to operate, low in cost, short in period and suitable for large-scale source tracing and quality control of medicinal materials.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and Chinese medicinal material identification, and particularly relates to a specific InDel molecular marker, a detection method and a kit for identifying the original plant of Citrus aurantium. Background Art

[0002] According to the Pharmacopoeia of the People's Republic of China (2020 edition), Aurantii Fructus Immaturus is a plant of the Rutaceae family, Citrus aurantium L.) and its cultivars or sweet orange ( Citrus sinensis Osbeck) dried young fruit. But in fact, Yichang orange ( Citrus ichangensis The sale of young fruit of the Swingle variety as raw material for Citrus aurantium has resulted in the plant origin of Citrus aurantium being unknown and its medicinal efficacy difficult to control. Citrus aurantium possesses the pharmacological properties of dispersing qi, eliminating stagnation, and resolving phlegm and dispersing abdominal distension. With consumers increasingly focused on health and wellness, its industrial development holds promising prospects. However, due to the similar morphological characteristics of young fruit of sour orange, sweet orange, and Yichang orange, which make it difficult to distinguish, traditional identification methods are limited by low efficiency, long processing times, and high costs. Furthermore, since sour orange, sweet orange, fragrant orange, and Yichang orange accumulate different secondary metabolites—such as high accumulation of neohesperidin and naringin in sour orange, hesperidin in sweet orange, and naringin in Yichang orange—the industrialization of medicinal Citrus aurantium faces significant challenges in terms of raw material traceability and quality control for traditional Chinese medicines.

[0003] Currently, molecular marker technologies such as Indel and KASP have been widely used in the assessment and precise identification of genetic diversity of citrus germplasm resources through targeted analysis of genomic polymorphic sites, providing technical support for the construction of an efficient plant germplasm identification system. However, there has been no systematic research report on specific molecular markers for different origin plants of Citrus aurantium, which has restricted the standardization of medicinal origins and the normalization of the industrial chain. Therefore, the development of a new molecular marker technology based on high-throughput sequencing to achieve rapid and accurate identification of Citrus aurantium origins has key scientific significance and practical value for ensuring the uniformity of medicinal material quality, improving the traceability system, and promoting the sustainable and high-quality development of the Citrus aurantium industry. Summary of the Invention

[0004] The purpose of the present invention is to provide a set of specific InDel primer combinations and application methods thereof that can accurately distinguish the three major original plants of Citrus aurantium (Yichang orange, sour orange, and sweet orange).

[0005] To achieve the above objectives, the applicant screened a set of specific primer pairs for identifying the original plant of Citrus aurantium by resequencing the genomes of sweet orange, sour orange, and Yichang orange, including: (a) primer pair YCC-F / R, the nucleotide sequences of which are shown in SEQ ID NO: 1 and SEQ ID NO: 2; (b) primer pair SC-F / R, the nucleotide sequences of which are shown in SEQ ID NO: 3 and SEQ ID NO: 4; The primer pair combination is used to distinguish Yichang orange, sour orange and sweet orange of Rutaceae plants.

[0006] Furthermore, a method for identifying the original plant of Citrus aurantium was developed using the primer pair combination, comprising the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR amplification is performed using the primer pair combination. (3) The PCR products were subjected to gel electrophoresis, and the Rutaceae plants Yichang orange, sour orange, and sweet orange were distinguished based on the specific bands.

[0007] The PCR amplification reaction system is as follows: 10 μL 2×Phanta Max Buffer, 0.4 μL dNTPMix, 0.4 μL Phanta Max Super-Fidelity DNA Polymerase, 0.8 μL forward primer, 0.8 μL reverse primer, 1 μL DNA template, and 6.6 μL ddH2O.

[0008] The PCR amplification reaction procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles; and extension at 72°C for 10 min.

[0009] Among them, using YCC-F / R as primers, if gel electrophoresis produces a single band of 1000 bp, it is identified as Yichang orange; if gel electrophoresis produces double bands of 1000 bp and 1200 bp, it is identified as sour orange or sweet orange, thus realizing the germplasm differentiation between Yichang orange and sour orange, and between Yichang orange and sweet orange; using SC-F / R as primers, if gel electrophoresis produces a single band of 1300 bp, it is identified as sour orange; if gel electrophoresis produces double bands of 1200 bp and 1300 bp, it is identified as sweet orange, thus realizing the germplasm differentiation between sour orange and sweet orange.

[0010] The present invention also provides a molecular marker kit for identifying the original plant of Citrus aurantium, comprising the primer pair combination, PCR reaction reagents (high-fidelity enzyme, dNTPs, buffer) and positive control DNA (Yichang orange / sour orange / sweet orange genome).

[0011] The beneficial effects of the present invention are: This invention is the first to develop a specialized molecular marker combination targeting the original plant of Citrus aurantium, filling a technological gap in this field. The designed primers offer strong specificity, a low-cost method, and a short turnaround time. This method requires only a conventional PCR instrument and electrophoresis equipment, eliminating the need for sequencing, making it suitable for large-scale traceability of medicinal materials. The reliability of the primers and method was confirmed by testing the method on 22 samples of Yichang oranges, 17 samples of sour oranges, and 8 samples of sweet oranges, representing major cultivated varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 : Gel electrophoresis of the original plant of Citrus aurantium amplified by primers YCC-F / R. In the figure, A is Yichang orange; B is sour orange; C is sweet orange; M is marker; sample number and germplasm information are shown in Table 1.

[0013] Figure 2 : Gel electrophoresis of the original plant of Citrus aurantium using primers SC-F / R. In the figure, M is a marker; the sample number and germplasm information are shown in Table 1.

[0014] Figure 3 :Schematic diagram of the process of identifying the original plant of Citrus aurantium using molecular marker primers. DETAILED DESCRIPTION

[0015] The technical solutions of the present invention are further described in detail below with reference to specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art on the basis of the following examples should also be deemed to fall within the scope of protection of the present invention. The experimental methods for which specific conditions are not specified in the following examples are generally implemented according to conventional conditions or reference books such as "Molecular Cloning Laboratory Guide" (NewYork: Cold Spring Harbor Laboratory, 2017), or implemented according to the methods recommended in the operating manual provided by the manufacturer. The materials whose sources are not specified in the examples are all commonly used materials in the field and can be obtained through commercial channels.

[0016] 1. Materials and Methods 1.1 Reagents and Materials Reagents: Phanta Max Super-Fidelity DNA Polymerase and PCR kit were purchased from Nanjing Vazyme Biotech Co., Ltd.; PCR primers were synthesized by Tianjin Tsingke Biotechnology Co., Ltd.

[0017] Plant materials: The information of different Citrus aurantium original plant samples is shown in Table 1.

[0018] Table 1. Information on different citrus germplasms that can be used to produce Fructus Aurantii Immaturus

[0019] 1.2 Experimental Methods 1.2.1 InDel primer design and screening InDel primer design: Based on genome resequencing data from sweet orange, sour orange, and Yichang orange, specific, high-quality primer pairs were designed. Sites with large insertion / deletion (InDel) fragments larger than 50 bp were selected to ensure significant polymorphism. SnpGene 4.1.9 software was used to design primer pairs 500 bp upstream and downstream of the InDel site to ensure amplification specificity.

[0020] InDel Primer Screening: The above-mentioned InDel marker primer pairs were screened for effectiveness, and two pairs of InDel primers, YCC-F / R and SC-F / R, were ultimately selected to distinguish between different Citrus aurantium plant species. YCC-F / R can be used to distinguish Yichang oranges from sour oranges and Yichang oranges from sweet oranges; SC-F / R can be used to distinguish sour oranges from sweet oranges. Their nucleotide sequences are: YCC-F: CTAATTTTCTTTGTACTGCGTGC5'-3' YCC-R: AAGTAGCTTAATTCGTTCACAGAC5'-3' SC-F: TAGTGCAACAAGCACCTCTCTTA5'-3' SC-R: GAAACATTTAGTGGTGTTCTCATG5'-3' 1.2.2 PCR amplification and gel electrophoresis analysis PCR amplification system (20 μL): 10 μL 2× Phanta Max Buffer, 0.4 μL dNTP Mix, 0.4 μL Phanta Max Super-Fidelity DNA Polymerase, 0.8 μL forward primer, 0.8 μL reverse primer, 1 μL DNA template, 6.6 μL ddH₂O. The reaction procedure was: initial denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 1 min; and a final extension at 72°C for 10 min. After amplification, the PCR product was stored at 4°C until use.

[0021] Gel electrophoresis analysis: Perform gel electrophoresis on the PCR products using a DYY-6C gel electrophoresis instrument. Set the voltage to 80 V, the current to 400 mA, and the electrophoresis time to 45 min. Save the electrophoresis image.

[0022] 2. Experimental Results DNA was extracted from the leaves of the above-mentioned Citrus aurantium plant and amplified using the molecular marker primers YCC-F / R and SC-F / R. The resulting PCR products were then subjected to agarose gel electrophoresis. Using YCC-F / R as primer, a single product of approximately 1000 bp was generated for the amplification of Yichang Orange DNA ( Figure 1 A), while the DNA amplification of sour orange and sweet orange showed double band characteristics at approximately 1000 bp and 1200 bp ( Figure 1 B, C), so the YCC-F / R primers can be used to identify the germplasm of Yichang orange; using SC-F / R as primers, the sour orange DNA amplification produced a single band of approximately 1300 bp, while the sweet orange DNA showed a double band amplification characteristic at approximately 1200 bp and 1300 bp (Figure 2), so the YCC-F / R primers can be used to distinguish the germplasm of sour orange and sweet orange.

[0023] The above experimental results show that the YCC-F / R primers can specifically identify Yichang orange germplasm from the original plants of Citrus aurantium, such as Yichang orange, sour orange and sweet orange, while the SC-F / R primers can further achieve interspecific differentiation between sour orange and sweet orange. This molecular marker combination provides an effective technical means for the accurate identification of the original plants of Citrus aurantium.

Claims

1. A set of specific primer pairs for identifying the original plant of Citrus aurantium, characterized in that: Include: (a) primer pair YCC-F / R, the nucleotide sequences of which are shown in SEQ ID NO: 1 and SEQ ID NO: 2; (b) primer pair SC-F / R, the nucleotide sequences of which are shown in SEQ ID NO: 3 and SEQ ID NO: 4, The original plant of the Citrus aurantium is the Rutaceae plant Yichang orange ( Citrus ichangensis Swingle), lime ( Citrus aurantium L.) and sweet orange ( Citrus sinensis Osbeck).

2. A method for identifying the original plant of Citrus aurantium, characterized in that: The following steps are involved: (1) Extract DNA from the sample to be tested; (2) using the extracted DNA as a template, and performing PCR amplification using the primer pair combination described in claim 1; (3) The PCR products were subjected to gel electrophoresis, and the Rutaceae plants Yichang orange, sour orange, and sweet orange were distinguished based on the specific bands.

3. The method for identifying the original plant of Citrus aurantium according to claim 2, wherein: The PCR amplification reaction system is: 10 μL 2×Phanta Max Buffer, 0.4 μL dNTP Mix, 0.4 μL Phanta Max Super-Fidelity DNA Polymerase, 0.8 μL forward primer, 0.8 μL reverse primer, 1 μL DNA template, and 6.6 μL ddH2O.

4. The method for identifying the original plant of Citrus aurantium according to claim 2, wherein: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles; and extension at 72°C for 10 min.

5. The method for identifying the original plant of Citrus aurantium according to claim 2, wherein: Using YCC-F / R as primers, if gel electrophoresis produces a single band of 1000bp, it is identified as Yichang orange. If gel electrophoresis produces double bands of 1000bp and 1200bp, it is identified as sour orange or sweet orange, thereby realizing the germplasm differentiation between Yichang orange and sour orange, and between Yichang orange and sweet orange. Using SC-F / R as primers, if gel electrophoresis produces a single band of 1300bp, it is identified as sour orange. If gel electrophoresis produces double bands of 1200bp and 1300bp, it is identified as sweet orange, thereby realizing the germplasm differentiation between sour orange and sweet orange.

6. A molecular marker kit for identifying the original plant of Citrus aurantium, comprising the primer pair combination according to claim 1.

Images