Application of caffeic acid-O-methyltransferase in regulating and controlling salt tolerance of rice

Abstract

The invention discloses an application of caffeic acid-O-methyltransferase in regulation and control of salt tolerance of rice. The overexpressed OsCOMT gene disclosed by the invention can remarkably improve the melatonin content and antioxidant level of rice seedlings, so that the tolerance of plants to salt stress is enhanced, and the plants can maintain normal growth under the condition of salt stress; the deletion of the gene OsCOMT leads to the increase of the sensitivity of seedling-stage rice to salt stress, and exogenous melatonin can recover the salt-sensitive phenotype of a mutant-knocked-out plant and improve the photosynthetic rate of the mutant-knocked-out plant. The OsCOMT gene and the encoding protein thereof have important theoretical and practical significance on research of a plant stress tolerance mechanism and improvement of stress tolerance and related traits of plants, can play an important role in plant stress tolerance gene engineering improvement, and are wide in application prospect.

Description

TECHNICAL FIELD

[0001] The application relates to application of a caffeic acid-O-methyltransferase in regulating salt tolerance of rice and belongs to the technical field of biological genes. BACKGROUND

[0002] Rice is one of the most important food crops in China. Under the background of the shortage of arable land resources and the aggravation of salinization, it has become an urgent task to breed high-quality rice varieties with strong salt tolerance. Excessive soil salt will seriously inhibit the growth and development of rice, cause the water absorption of the root system to be blocked, the activity of enzymes to be reduced, the synthesis of chlorophyll to be blocked, and the photosynthetic efficiency to be decreased, and finally cause the yield of rice to be reduced. Researches show that moderate salt stress can make the yield of rice be reduced by 30-50%. Therefore, in order to alleviate the stress of salt on plants, it is necessary to put forward a method for improving the stress resistance and related traits of plants.

[0003] Plants alleviate salt stress by producing plant hormones such as ethylene, jasmonic acid, gibberellin and abscisic acid and other important signal molecules (such as nitric oxide, hydrogen sulfide and calcium). Researchers try to use different biological substances (including some biomolecules, plant extracts or soil microorganisms) to reduce the harmful effects of salt stress. Melatonin (MT) has the chemical formula C 13 H 16N2O2, belonging to the indole heterocyclic compounds, its chemical name is N-acetyl-5-methoxy tryptamine, also known as pineal, melatonin, melanin. According to the existing research, melatonin exists in all organisms. As an antioxidant, melatonin has a wide range of effects on various stages of plant growth and development, such as germination, root extension, and promotion of photosynthesis and delay of leaf senescence. Melatonin can be induced to accumulate under various stress environments, and the increase of its content can alleviate the damage caused by oxidative stress to plants. Melatonin and IAA have the same biosynthetic precursor, so they have the same effect on plant growth and development, and can reduce the release of active oxygen by activating antioxidant enzyme activity, and still maintain photosynthetic activity under salt stress. The synthesis of melatonin in plants is a four-step reaction catalyzed by six enzymes with tryptophan as the precursor. Caffeic acid O-methyltransferase (COMT) is the rate-limiting enzyme of the last step of the melatonin synthesis pathway in plants. Studies have shown that after overexpression of the COMT gene (TaCOMT) in wheat, the content and resistance of melatonin in transgenic plants are significantly higher than those of wild type; overexpression of SlCOMT1 increases the content of endogenous melatonin in tomato and salt tolerance, and improves the photosynthesis and antioxidant capacity of tomato plants under drought stress, induces the expression of stress-related signal genes, and improves the drought resistance of tomato. The role of OsCOMT (Oryzasativa Caffeic acid O-methyltransferase) in the regulation of salt tolerance in rice has not been further studied. SUMMARY

[0004] The technical problem solved by the present application is to provide an application of caffeic acid O-methyltransferase in regulating salt tolerance of rice.

[0005] Technical scheme: In order to solve the above technical problems, the present application provides an application of caffeic acid O-methyltransferase with an amino acid sequence as shown in SEQ ID NO. 1 in regulating salt stress tolerance of rice.

[0006] The present application also provides an application of a gene encoding the caffeic acid O-methyltransferase in regulating salt stress tolerance of rice.

[0007] The present application also provides an application of a caffeic acid O-methyltransferase gene or its overexpression vector in improving salt stress tolerance of rice, and the nucleotide sequence of the caffeic acid O-methyltransferase gene is as shown in SEQ ID NO. 2.

[0008] The overexpression vector is obtained by constructing the caffeic acid O-methyltransferase gene into the vector pCAMBIA1390.

[0009] The application also provides application of the recombinant bacteria containing the caffeic acid-O-methyltransferase gene or the super-expression vector thereof in improving salt stress tolerance of rice, wherein the nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown as SEQ ID NO. 2.

[0010] The application also provides a method for improving salt stress tolerance of rice, comprising over-expressing or up-regulating expression or activity of the caffeic acid-O-methyltransferase of rice, wherein the amino acid sequence of the caffeic acid-O-methyltransferase is shown as SEQ ID NO. 1.

[0011] The over-expressing or up-regulating expression or activity of the caffeic acid-O-methyltransferase of rice comprises: over-expressing the caffeic acid-O-methyltransferase gene in the genome of rice; or introducing an up-regulator of transcription, polypeptide expression or polypeptide activity of the caffeic acid-O-methyltransferase gene into rice; or hybridizing the rice variety over-expressing the caffeic acid-O-methyltransferase gene with the common rice variety, wherein the nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown as SEQ ID NO. 2.

[0012] The application also provides a method for verifying the salt stress tolerance of the rice obtained by the method, comprising the following steps:

[0013] (1) taking the wild-type rice of the same growth period as a control group, germinating the seeds of the rice obtained by the method by water soaking culture, and then performing resistance screening by using hygromycin, and then transplanting the seedlings to soil for soil culture after germination;

[0014] (2) performing salt stress and melatonin treatment on the soil culture seedlings, and measuring endogenous melatonin content, chlorophyll, chlorophyll fluorescence, soluble sugar content, root activity, proline content, active oxygen and peroxide related enzymes, etc.;

[0015] (3) when the method can significantly improve the melatonin content and antioxidant level of the rice seedlings, thereby enhancing the salt stress tolerance of the plants, it is indicated that the salt stress tolerance of the plants is enhanced.

[0016] The peroxide related enzymes comprise one or more of malondialdehyde (MDA), hydrogen peroxide (H2O2), ascorbate peroxidase (APX), superoxide dismutase (SOD), peroxidase (POD) or catalase (CAT).

[0017] The application also provides a method for obtaining salt stress tolerant rice, comprising infecting the wild-type rice with the recombinant bacteria containing the caffeic acid-O-methyltransferase gene, wherein the sequence of the caffeic acid-O-methyltransferase gene is shown as SEQ ID NO. 2.

[0018] The application also provides application of the caffeic acid-O-methyltransferase gene or a silencing vector or a knockout vector thereof in improving salt sensitivity of rice, wherein the nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown as SEQ ID NO. 2.

[0019] The knockout vector comprises the caffeic acid-O-methyltransferase gene constructed into the vector pCas9.

[0020] The application also provides application of melatonin in improving salt stress tolerance of rice after knockout of the caffeic acid-O-methyltransferase gene.

[0021] Advantages: Compared with the prior art, the application has the following remarkable advantages: the application obtains the experimental phenotype of the overexpression gene OsCOMT rice strain and the gene knockout strain: overexpression of the OsCOMT gene can significantly increase the melatonin content and the antioxidant level of rice seedlings, thereby enhancing the tolerance of the plant to salt stress and enabling the plant to maintain normal growth under salt stress; deletion of the gene OsCOMT leads to increased sensitivity of the rice to salt stress at the seedling stage; and the exogenous melatonin can restore the salt sensitivity phenotype of the knockout mutant plant and improve the photosynthetic rate of the plant. The protein and the coding gene thereof have important theoretical and practical significance for the research on plant stress tolerance mechanisms and the improvement of plant stress tolerance and related traits, and will play an important role in plant stress tolerance genetic engineering improvement and have a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 a is phenotype analysis of the above-ground parts of the OsCOMT transgenic plant and the control plant after different treatments for 7 days; and b is phenotype analysis of the roots of the OsCOMT transgenic plant and the control plant after different treatments for 7 days;

[0023] Figure 2 Survival rate of the OsCOMT transgenic plant and the control plant after different treatments for 7 days;

[0024] Figure 3 Endogenous melatonin content of the OsCOMT transgenic plant and the control plant after different treatments for 7 days;

[0025] Figure 4 Physiological index analysis of the OsCOMT transgenic plant and the control plant after different treatments for 7 days: a is chlorophyll content; b is maximum photochemical efficiency of PSH; c is soluble sugar content; and d is tetrazole reduction intensity;

[0026] Figure 5 Peroxidase-related enzyme activity analysis of the OsCOMT transgenic plant and the control plant after different treatments for 7 days: a is O 2-Rate of production; b is the content of malondialdehyde; c is the content of proline; d is the activity of superoxide dismutase; e is the activity of peroxidase; d is the activity of catalase. DETAILED DESCRIPTION

[0027] The technical solutions of the present application are further described below in combination with the drawings.

[0028] The following describes the specific implementation of the method by taking the conventional rice variety "Zhonghua 11" (seeds stored by the experiment) as an example.

[0029] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0030] (I) Construction of rice overexpression material

[0031] 1. Construction of OsCOMT overexpression vector pCAMBIA1390-OsCOMT

[0032] The amino acid sequence of caffeic acid-O-methyltransferase is shown in SEQ ID NO. 1:

[0033] MGSTAADMAAAADEEACMYALQLASSSILPMTLKNAIELGLLETLQSAAVAGGGGKAALLTPAEVADKLPSKANPAAADMVDRMLRLLASYNVVRCEMEEGADGKLSRRYAAAPVCKWLTPNEDGVSMAALALMNQDKVLMESWYYLKDAVLDGGIPFNKAYGMTAFEYHGTDARFNRVFNEGMKNHSVIITKKLLDLYTGFDAASTVVDVGGGVGATVAAVVSRHPHIRGINYDLPHVISEAPPFPGVEHVGGDMFASVPRGGDAILMKWILHDWSDEHCARLLKNCYDALPEHGKVVVVECVLPESSDATAREQGVFHVDMIMLAHNPGGKERYEREFRELARAAGFTGFKATYIYANAWAIEFTK

[0034] The CDS sequence of caffeic acid-O-methyltransferase gene is shown in SEQ ID NO. 2:

[0035] ATGGGTTCTACAGCCGCCGA

[0036] The 5' end primer was designed from the coding start site ATG of the OsCOMT gene (chromosome 8, CDS coordinates: 3340959-3337751, LOC_Os08g06100), and the 3' end primer was designed before the stop codon:

[0037] Primer 1: SEQ ID NO. 3: 5'-aaaCCATGGTTCTACAGCCGCCGA-3';

[0038] Primer 2: SEQ ID NO. 4: 5'-aaaACTAGT CTACTTGGTGAACTCGATGG -3';

[0039] The CCATGG sequence in primer 1 is the restriction enzyme Kpn I cleavage site, and the underlined sequence ATGGGTTCTACAGCCGCCGA is the coding sequence of the OsCOMT gene; the ACTAGT sequence in primer 2 is the restriction enzyme Spe I cleavage site, and the underlined sequence CTACTTGGTGAACTCGATGG is the coding sequence of the OsCOMT gene. The above primers were synthesized by Beijing Genesee Biotech Co., Ltd.

[0040] The cDNA of the japonica rice (Oryza sativa cv. Zhonghua 11) was used as a template, and the specific primers were used for PCR amplification (system: 10 μL 2x Phanta Max Buffer + 1 μL dNTP Mix + 1 μL DNA polymerase provided by Nanjing Novogene Bioinformatics Technology Co., Ltd. + 5 μL free-RNase H2O + 2 μL forward and reverse primers + 1 μL DNA template, program: 95°C for 5 min, 1 cycle; 95°C for 45 s, 58°C for 1 min, 72°C for 1.5 min, 45 cycles; 72°C for 10 min, 1 cycle), and the PCR amplification product was recovered. The restriction enzymes Nco I and Bgl II were used for double enzyme digestion (Takara Company restriction enzyme conventional use system), and the enzyme digestion product was recovered. The restriction enzymes Kpn I and Spe I were used for double enzyme digestion of the vector pCAMBIA1390, and the skeleton vector was recovered. The enzyme digestion product and the skeleton vector were connected, and then sequencing was performed. The sequencing results showed that the pCAMBIA1390-OsCOMT vector was obtained.

[0041] (II) Obtaining of the OsCOMT transgenic plant

[0042] The recombinant expression vector pCAMBIA1390-OsCOMT was introduced into Agrobacterium EHA105 by electroporation to obtain the recombinant Agrobacterium.

[0043] Recombinant Agrobacterium containing pCAMBIA1390-OsCOMT was infiltrated into callus of japonica rice (Oryza sativa cv. Zhonghua 11); the infiltrated callus was absorbed on sterile filter paper and then transferred to differentiation medium (N6 medium-solarbio catalog number: LA6910) containing 200 μM / L acetosyringone (solarbio catalog number: A8110) for 4 d of dark culture at 24℃; the washed callus was transferred to differentiation medium containing 60 mg / L hygromycin for resistance screening; the selected resistant callus was transferred to differentiation medium for 7 d of light culture; when the seedlings grew to 4 cm, they were transferred to test tubes containing MS medium (solarbio catalog number: M8520) for 2-3 weeks of growth, and the well-grown seedlings were transplanted to a greenhouse (T0 generation) after 2-3 d of acclimation.

[0044] (Three) Identification of OsCOMT Transgenic Plants

[0045] Two-week-old wild-type rice (Oryza sativa cv. Zhonghua 11) and T1 generation rice seedlings were taken respectively, mRNA was extracted for reverse transcription (Beijing Tiangeng Biochemical Technology Co., Ltd.-Reverse Transcription Kit, catalog number FP314-01), and after obtaining cDNA, the expression level of OsCOMT in rice was analyzed by fluorescence quantitative PCR technology, and the results showed that the expression amount of OsCOMT gene in the two overexpression lines was more than that of wild-type rice. Among them, fluorescence quantitative PCR (system: 5 μL SYBR + 1 μL cDNA + 2 μL free-RNase H2O + 2 μL forward and reverse primers, program: 95℃ for 30 s, 1 cycle; 95℃ for 30 s, 60℃ for 30 s, 45 cycles; upstream primer: SEQ ID NO. 5: 5'-CTTCAACCGCGTCTTCAACG-3'; downstream primer: SEQ ID NO. 6: 5'-TGGGGGAGGTCGTAGTTGAT-3').

[0046] (Two) Construction of CRISPR / Cas 9 Mutant Material

[0047] The rice mutant material was constructed by the CRISPR / Cas 9 method, and the specific steps were as follows: according to the full-length cDNA sequence of rice gene OsCOMT, the primers were designed by using the CRISPR-P online website (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR).

[0048] Primer 3: SEQ ID NO. 7: 5'-AGATGATCCGTGGCAGCTGCCGTCCAAGGCGAACCCCCGGTTTTAGAGCTATGC-3';

[0049] Primer 4: SEQ ID NO. 8: 5'-GCATAGCTCTAAAACCGGGGGTTCGCCTTGGACGGCAGCTGCCACGGATCATCT-3';

[0050] The above primers were synthesized by Beijing Genki Biological Technology Co., Ltd. and the cDNA of a japonica rice variety (Oryza sativacv. Zhonghua 11) was used as a template for PCR amplification with the specific primers described above (system: 10 μL 2x Phanta Max Buffer + 1 μL dNTP Mix + 1 μL DNA polymerase - provided by Nanjing Novogene Bioinformatics Technology Co., Ltd. + 5 μL free-RNase H2O + 2 μL forward and reverse primers + 1 μL DNA template, program: 95°C for 5 min, 1 cycle; 95°C for 45 s, 55°C for 1 min, 72°C for 1.5 min, 45 cycles; 72°C for 1 min, 1 cycle). The PCR amplification product was recovered and ligated with the pCas9 vector digested with Aar I restriction endonuclease (purchased from Takara) using an In-Fusion ligation kit (purchased from Takara) to obtain the knockout vector pCas9-OsCOMT. After sequencing with LRdetect primers to confirm the correct fragment, the plasmid was returned and transformed into Zhonghua 11 by Agrobacterium-mediated method. Homozygous transformants (KO-1A base insertion, KO-2 TT base insertion) were selected by sequencing and used for functional analysis of OsCOMT deficiency.

[0051] (III) Salt tolerance analysis of OsCOMT transgenic plants

[0052] T1 generation transgenic rice seeds of OsCOMT were harvested, and two overexpression lines (OX-1, OX-2) and two knockout lines (KO-1, KO-2) were selected for seedling stage simulated salt stress treatment.

[0053] Rice seeds were sterilized with 3% hydrogen peroxide for 15 min and then washed with deionized water. The seeds were soaked in the dark at 28°C for 48 h. Then, the seeds were germinated at 37°C in the dark for 12 h and then sown on 96-well plates. After sowing, the plates were placed in a black hydroponic box and cultured at 28°C / 26°C with light for 14 h, dark for 10 h, and humidity of 80%. After one week of planting, uniform seedlings were selected for subsequent experiments.

[0054] When the seedlings reached the three-leaf stage, they were divided into three groups and treated three times: the first group was NOR (using 500× Hoagland nutrient solution, purchased from Beijing Coolaibo Technology Co., Ltd.), the second group was NA (500× Hoagland nutrient solution + 150mM NaCl), and the third group was MT (500× Hoagland nutrient solution + 150mM NaCl + 200μM Melatonin). The treatments were repeated three times. After 7 days of treatment, the survival rate was calculated and photos were taken. At the same time, the chlorophyll content, maximum photochemical efficiency of PSH, soluble sugar content, and tetrazolium reduction intensity of the leaves were measured using conventional methods, and the leaf O was further analyzed. 2- production rate, proline content, malondialdehyde content, superoxide dismutase activity, peroxidase activity, and catalase activity.

[0055] Depend on Figure 1 As shown in Figure 2, under normal growth conditions, there was no significant difference between OsCOMT-OX and OsCOMT-KO lines compared with WT. After 7 days of salt treatment in the second group, seedling growth was inhibited and leaves withered. The knockout lines were more sensitive to salt stress than the wild type. The survival rate and endogenous melatonin content of different lines were calculated. Figures 2-3 As shown in the results, the survival rates and melatonin content of the two OsCOMT-OX lines under salt stress were significantly higher than those of the wild type, while those of the two knockout lines were significantly lower than those of the wild type. This indicates that after exogenous melatonin application, the knockout lines recovered their salt-sensitive phenotype. Meanwhile, their endogenous melatonin content and survival rates were close to those of the wild type line under salt stress, indicating that OsCOMT positively regulates salt tolerance in rice seedlings through the synthesis of endogenous melatonin.

[0056] like Figures 4-5 As shown, OsCOMT can increase rice chlorophyll content, enhance photosynthesis, promote adventitious root elongation and improve root activity, and enhance peroxide production to alleviate salt stress damage. Exogenous application of melatonin further increased the photosynthetic rate of the knockout strain, indicating that OsCOMT can improve rice seedlings' tolerance to salt stress.

Claims

1. Application of caffeic acid-O-methyltransferase having an amino acid sequence as shown in SEQ ID NO. 1 in regulating the salt stress tolerance of rice.

2. Use of the gene encoding the caffeic acid-O-methyltransferase according to claim 1 in regulating the salt stress tolerance of rice.

3. Use of a caffeic acid-O-methyltransferase gene or its overexpression vector in improving salt stress tolerance in rice, characterized in that: The nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown in SEQ ID NO.

2.

4. The application according to claim 3, characterized in that The overexpression vector is obtained by constructing the caffeic acid-O-methyltransferase gene into the vector pCAMBIA1390.

5. Use of a recombinant bacterium containing a caffeic acid-O-methyltransferase gene or an overexpression vector thereof in improving the salt stress tolerance of rice, characterized in that: The nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown in SEQ ID NO.

2.

6. A method for improving rice tolerance to salt stress, characterized in that: The method comprises overexpressing or upregulating the expression or activity of rice caffeic acid-O-methyltransferase, wherein the amino acid sequence of the caffeic acid-O-methyltransferase is shown in SEQ ID NO.

1.

7. The method according to claim 6, characterized in that The overexpression or upregulation of the expression or activity of rice caffeic acid-O-methyltransferase comprises: overexpressing a caffeic acid-O-methyltransferase gene in the rice genome; or introducing into rice an upregulator that upregulates caffeic acid-O-methyltransferase gene transcription, polypeptide expression, or polypeptide activity; or hybridizing a rice variety that overexpresses the caffeic acid-O-methyltransferase gene with a common rice variety; the nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown in SEQ ID NO.

2.

8. A method for obtaining salt stress-tolerant rice using the caffeic acid-O-methyltransferase gene, characterized in that: Wild-type rice is infected with a recombinant bacterium containing a caffeic acid-O-methyltransferase gene; the sequence of the caffeic acid-O-methyltransferase gene is shown in SEQ ID NO.

2.

9. Use of a caffeic acid-O-methyltransferase gene or a silencing vector or knockout vector thereof in improving the salt sensitivity of rice, characterized in that: The nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown in SEQ ID NO.

2.

10. Use of melatonin in improving salt stress tolerance of rice after knockout of caffeic acid-O-methyltransferase gene, characterized in that: The nucleotide sequence of the caffeic acid-O-methyltransferase gene is shown in SEQ ID NO.2.

Images