Corynebacterium glutamicum engineering strain for producing L-glutamine as well as construction method and application of corynebacterium glutamicum engineering strain

Abstract

The invention discloses a corynebacterium glutamicum engineering strain produced by L-glutamine as well as a construction method and application of the corynebacterium glutamicum engineering strain. The corynebacterium glutamicum engineering strain is prepared by integrating a glutamine synthase encoding gene glnA which is sourced from saccharomyces cerevisiae and has a tyrosine residue mutation at the 99th site on the surface and an sRNA-MicC-EcHfq regulation module of a targeted adenylyltransferase gene glnE into a vector plasmid; the method comprises the following steps: constructing a recombinant plasmid for removing adenosine acylation of glutamine synthase; and transferring the recombinant plasmid into corynebacterium glutamicum of which the odhA gene expression is controlled by a growth stage specific promoter Pcg2705, so as to obtain a corynebacterium glutamicum engineering strain for producing L-glutamine. According to the invention, through multi-gene synergistic modification and space-time metabolic flux optimization, the problem of'growth-synthesis' tradeoff in the prior art is solved, the fermentation efficiency is improved, the fermentation process is simple, and the application prospect is good.

Description

Technical Field

[0001] The present invention belongs to the field of synthetic biology and metabolic engineering, and more specifically relates to an L-glutamine-producing Corynebacterium glutamicum engineered strain, a construction method and an application thereof. Technical Background

[0002] L-glutamine, referred to as L-Gln, is a neutral amino acid that is abundant in the human body. Its chemical formula is C5H 10 N2O3. Its physicochemical properties are relatively stable, and it is a white crystalline powder with high solubility in water. L-glutamine is an important intermediate in the synthesis of various essential amino acids, playing a key role in nitrogen metabolism and biosynthesis. It has extensive research and application value in protein synthesis, immune regulation, intestinal health, and antioxidant activities. Currently, the industrial synthesis of L-glutamine primarily involves chemical methods, but these methods are complex and involve highly toxic reagents, making them unsuitable for sustainable L-glutamine production. Alternatively, microbial methods for L-glutamine synthesis are low-cost, non-toxic, and pollution-free, and are increasingly becoming the mainstream method for industrial L-glutamine synthesis.

[0003] Current industrial production of L-glutamine relies primarily on microbial fermentation, but this faces challenges such as irrational metabolic flux distribution, insufficient activity of key enzymes, and active product degradation pathways. Traditional approaches aim to increase yield through static gene knockout (such as complete knockout of odhA) or single enzyme optimization, but these often result in growth restriction or metabolic imbalance. For example, knockout of adenylyltransferase (glnE) impairs other cellular nitrogen metabolism functions, while complete inactivation of α-ketoglutarate dehydrogenase (ODHC) disrupts energy supply to the tricarboxylic acid (TCA) cycle. Dynamic metabolic regulation technologies offer a new approach to addressing these challenges. Growth-stage-specific promoters can dynamically regulate gene expression based on cell growth status, avoiding the drawbacks of traditional static regulation. Furthermore, small RNA (sRNA)-mediated gene silencing can precisely inhibit target gene translation without altering the genome, enabling fine-grained regulation of metabolic flux. Summary of the Invention

[0004] The purpose of the present invention is to provide an L-glutamine-producing Corynebacterium glutamicum engineered strain and its construction method and application, which solves the "growth-synthesis" trade-off problem existing in the microbial fermentation production of L-glutamine in the prior art through multi-gene collaborative modification and spatiotemporal metabolic flow optimization, thereby improving industrial fermentation efficiency.

[0005] In order to solve the above problems, the present invention adopts the following technical solutions:

[0006] According to a first aspect of the present invention, a method for constructing an engineered strain of Corynebacterium glutamicum that produces high L-glutamine production using sRNA interference, site-directed mutagenesis, and a dynamic promoter is provided. The method comprises integrating the glutamine synthase encoding gene glnA, derived from Saccharomyces cerevisiae and containing a mutation in the tyrosine residue at surface position 99, and the sRNA-MicC-EcHfq regulatory module targeting the adenylyltransferase gene glnE into a vector plasmid to construct a plasmid capable of de-adenylylating glutamine synthase. Furthermore, the plasmid is transferred into Corynebacterium glutamicum in which the α-ketoglutarate dehydrogenase E1 subunit gene odhA is expressed by the growth-phase-specific promoter Pcg2705, thereby obtaining an engineered strain of Corynebacterium glutamicum that produces L-glutamine and is regulated by the sRNA interference, site-directed mutagenesis, and dynamic promoter.

[0007] According to a preferred embodiment of the present invention, the construction method comprises: after the plasmid capable of removing adenylylation of glutamine synthase is transferred into a Corynebacterium glutamicum strain, the gene encoding proB for γ-glutamyl kinase, a key step in proline synthesis, is knocked out; the gene encoding gltB for glutamate synthase in the L-glutamine decomposition pathway is knocked out; and the gene encoding gdh for glutamate dehydrogenase is overexpressed, thereby obtaining an engineered strain of Corynebacterium glutamicum that produces high L-glutamine production by utilizing sRNA interference, site-directed mutagenesis, and dynamic promoter regulation.

[0008] According to a preferred embodiment of the present invention, the construction method comprises the following steps in any order:

[0009] A, glnA (Y99F) and sRNA-MicC-EcHfq (targeting glnE) framework were integrated into the vector plasmid to obtain a plasmid that deadenylated glutamine synthase;

[0010] B. replacing the promoter of the odhA gene in the Corynebacterium glutamicum with the growth stage-specific promoter Pcg2705;

[0011] C. In addition to the proB gene in the Corynebacterium glutamicum, the gdh gene is overexpressed in the vector plasmid;

[0012] D. knocking out the gltB gene of the Corynebacterium glutamicum.

[0013] Furthermore, the nucleotide sequence of the glutamine synthase encoding gene glnA is shown in SEQ ID NO.1.

[0014] Furthermore, the nucleotide sequence of the sRNA targeting the glnE gene is shown in SEQ ID NO.2.

[0015] Furthermore, the nucleotide sequence of the growth stage specific promoter Pcg2705 is shown in SEQ ID NO.3.

[0016] Furthermore, the nucleotide sequence of the γ-glutamyl kinase encoding gene proB is shown in SEQ ID NO.4.

[0017] Furthermore, the nucleotide sequence of the glutamate synthase encoding gene gltB is shown in SEQ ID NO.5.

[0018] Furthermore, the nucleotide sequence of the glutamate dehydrogenase encoding gene gdh is shown in SEQ ID NO.6.

[0019] Furthermore, the Corynebacterium glutamicum chassis is selected from: Corynebacterium glutamicum ATCC13032.

[0020] Furthermore, the vector plasmid is preferably a PEC-XK99E plasmid, but it should be understood that the vector plasmid is not limited to the PEC-XK99E plasmid.

[0021] According to a second aspect of the present invention, there is provided an engineered strain of Corynebacterium glutamicum with high L-glutamine production regulated by sRNA interference-site-directed mutagenesis-dynamic promoter obtained according to the above construction method.

[0022] According to a third aspect of the present invention, there is provided an application of the Corynebacterium glutamicum strain in the field of chemicals, medicines, health products or feed, characterized in that the Corynebacterium glutamicum strain is used to prepare chemicals, medicines, health products or feed containing L-glutamine.

[0023] Furthermore, before fermentation culture, the genetically engineered bacteria are streaked onto a solid culture medium for activation, then inoculated into a seed culture medium to obtain a seed liquid, and then the seed liquid is inoculated into a fermentation culture medium for fermentation culture.

[0024] Furthermore, the application is to activate the genetically engineered bacteria and then culture them in a seed culture medium to obtain a seed liquid, wherein the culture temperature is 30°C, the pH is 7, the dissolved oxygen is controlled to be 30%~40%, and then the seed liquid is inoculated into the fermentation medium at an inoculum amount of 20%~30%.

[0025] Furthermore, the fermentation medium is composed of: 80 g / L glucose, 30 mL / L corn syrup, 40 g / L ammonium sulfate, 2.5 g / L potassium dihydrogen phosphate, 2 g / L urea, 2 g / L magnesium sulfate heptahydrate, and 5 mL / L trace element solution, and the pH is adjusted to 7.

[0026] Furthermore, the fermentation conditions are as follows: fermentation at 30°C, maintaining the dissolved oxygen at 30%-40% by adjusting the speed of the associated stirring blade, adjusting the pH at 6.2-6.5 by automatically adding ammonia water, maintaining the residual sugar concentration at 1-5 g / L by automatically adding 800 g / L of glucose solution, and the fermentation cycle is 72-90 h.

[0027] The main inventive aspect of the present invention lies in integrating the glutamine synthase-encoding gene glnA, derived from Saccharomyces cerevisiae and containing a mutation in the tyrosine residue at position 99, and the sRNA-MicC-EcHfq regulatory module targeting the adenylyltransferase gene glnE into a vector plasmid, which is then transformed into a Corynebacterium glutamicum chassis strain to obtain a strain that eliminates glutamine synthase adenylylation through multiple strategies. Furthermore, the present invention utilizes the growth-phase-specific promoter Pcg2705 to control the expression of the α-ketoglutarate dehydrogenase E1 subunit gene odhA, thereby optimizing the cell growth-production balance, further blocking the competing pathways of proline synthesis and L-glutamine degradation, and overexpressing glutamate dehydrogenase to increase precursor supply. This results in an engineered L-glutamine-producing Corynebacterium glutamicum strain controlled by sRNA interference, site-directed mutagenesis, and a dynamic promoter.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention provides an engineered L-glutamine-producing Corynebacterium glutamicum strain regulated by sRNA interference-site-directed mutagenesis-dynamic promoter. The modified recombinant Corynebacterium glutamicum can produce L-glutamine using glucose on the basis of rational energy distribution. The modified strain with the best performance achieved an L-glutamine level of 31.85 g / L in shake flask fermentation, and an L-glutamine titer of 58.96 g / L after 55 hours of fed-batch fermentation in a 5L fermentor.

[0030] In summary, the present invention provides an L-glutamine-producing Corynebacterium glutamicum engineered strain regulated by sRNA interference-site-directed mutagenesis-dynamic promoter, as well as its construction method and application. Through multi-gene collaborative modification and spatiotemporal metabolic flow optimization, it solves the difficult problem of the "growth-synthesis" trade-off in the existing technology, improves fermentation efficiency, simplifies the fermentation process, and has good prospects for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The plasmid map of the gRNA plasmid pJYS3-ΔcrtYF is shown;

[0032] Figure 2The plasmid map of PEC-glnA(Y99F)-gdh-sRNA-MicC-Hfq carrying the glnA expression cassette derived from Saccharomyces cerevisiae and mutated at position 99, the sRNA-MicC-Hfq expression cassette targeting the glnE gene, and the gdh expression cassette is shown;

[0033] Figure 3 A schematic diagram showing the mechanism of action of the RNA-MicC-EcHfq module is shown;

[0034] Figure 4 The fermentation process curve of the L-glutamine Escherichia coli engineered strain CG04 in the upper tank is shown. DETAILED DESCRIPTION

[0035] In order to better understand the content of the present invention, the following is further described in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0036] Experimental procedures in the following examples, where specific conditions are not specified, were generally performed according to conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). Primers were synthesized by Shanghai Qingke Biotechnology Co., Ltd.

[0037] For better understanding content of the present invention, take Corynebacterium glutamicum ATCC13032 bacterial strain as starting bacterial strain and be further described for specific embodiment.Should be appreciated that following examples are only used to illustrate the present invention and are not intended to limit the scope of the invention.Those skilled in the art can carry out various modifications and replacements to the present invention without departing from the purpose and spirit of the present invention.

[0038] Example 1 Construction of a plasmid capable of deadenylation of glutamine synthase

[0039] The glnA gene fragment was amplified by PCR using the yeast culture medium of S. cerevisiae BY4741 as a template using primers glnA-1 / glnA-2. The PEC backbone was amplified by PCR using the PEC-XK99E plasmid (a universal shuttle plasmid for Corynebacterium glutamicum, purchased from Shanghai Qincheng Biotechnology Co., Ltd.) as a template using PV-1 / PV-2. The plasmid backbone fragment PEC-V and the glnA fragment were seamlessly cloned and transformed to obtain the PEC-glnA plasmid.

[0040] The constructed plasmid PEC-glnA was used as a template and primers Y99F-1 / Y99F-2 were used to amplify the plasmid fragment by PCR. The plasmid backbone fragment PEC-glnA(Y99F) was seamlessly cloned and transformed to obtain the PEC-glnA(Y99F) plasmid.

[0041] Using E. coli MG1655 culture medium as a template, primers MicC-1 / MicC-2 were used to amplify sRNA and MicC fragments by PCR. A 24 bp sRNA fragment was introduced by primer MicC-1 to amplify the fragment sRNA-MicC. Primers Hfq-1 / Hfq-2 were used to amplify the Hfq fragment by PCR. Using the PEC-glnA(Y99F) plasmid as a template, the PEC-glnA(Y99F) backbone was amplified by PCR using PglnA-V-1 / PglnA-V-2. Seamless cloning and transformation experiments were performed on the plasmid backbone fragments PEC-glnA(Y99F), sRNA-MicC, and Hfq, and finally the PEC-glnA(Y99F)-sRNA-MicC-Hfq plasmid was obtained.

[0042] Among them, the mechanism of action of RNA-MicC-EcHfq module is as follows Figure 3 As shown in the figure, RNA Predator analysis was used to select sRNAs that bind to the glnE gene and are less likely to cause off-target effects. Following plasmid expression, the sRNA is co-transcribed with the downstream E. coli-derived MicC scaffold. The resulting sRNA-MicC binds to the glnE gene at one end, while the other end (MicC) binds to Hfq (an RNA-binding protein that promotes complementary pairing between the sRNA and the target mRNA), ultimately recruiting RNase to degrade the target mRNA.

[0043] Example 2 CG-01: Construction of proB knockout strain

[0044] (1) Construction of proB upstream and downstream homology arms and integration fragments

[0045] The genome of wild-type Corynebacterium glutamicum ATCC13032 was used as a template, and primers proB-1 / proB-2 and proB-3 / proB-4 were used to amplify the upstream and downstream homology arms of proB, respectively. Then, overlapping PCR was used to obtain the fusion fragment proB-Donor of the upstream and downstream homology arms of proB.

[0046] (2) Construction of proB-pJYS3 plasmid

[0047] The middle 500 bp of the proB gene sequence was selected, sgRNA was selected, and primers pJYS3F-proB were designed. The plasmid pJYS3-ΔcrtYF (the plasmid map is shown in Figure 2) was used to generate the sgRNA. Figure 1 ) as a template, PCR was performed using primers pJYS3F-proB and pJYS3-R, followed by gel recovery and T4 ligation, and transformation to E. coli DH5α. The correct proB-pJYS3 plasmid was screened.

[0048] (3) Construction of proB gene knockout strain

[0049] The fusion fragment proB-Donor and the recombinant plasmid proB-pJYS3 were electroporated into competent cells of Corynebacterium glutamicum ATCC13032. After screening, the recombinant strain C. glutamicumΔproB was obtained. The plasmid PEC-glnA(Y99F)-sRNA-MicC-Hfq was then introduced and named CG01.

[0050] Example 3 CG02-02: Construction of odhA dynamic expression strain

[0051] (1) Construction of upstream and downstream homology arms and integration fragments of odhA

[0052] Using the wild-type Corynebacterium glutamicum ATCC13032 genome as a template, the upstream and downstream homology arms of odhA were amplified using primers odhA-1 / odhA-2 and odhA-3 / odhA-4, respectively, and the promoter Pcg2705 was also combined in the primers. Then, overlapping PCR was used to obtain the fusion fragment odhA upstream and downstream homology arms odhA-Donor.

[0053] (2) Construction of odhA-pJYS3 plasmid

[0054] An approximately 300bp base sequence near the odhA promoter sequence was selected, sgRNA was chosen, and primer pJYS3F-odhA was designed. Using the pJYS3-ΔcrtYF plasmid as a template, PCR was performed using primers pJYS3F-odhA and pJYS3-R. Gel recovery and T4 ligation were then performed, and E. coli DH5α was transformed to obtain the correct odhA-pJYS3 plasmid.

[0055] (3) Construction of odhA dynamic expression strain

[0056] The fusion fragment odhA-Donor and the recombinant plasmid odhA-pJYS3 were electroporated into C. glutamicumΔproB competent cells. After screening, the recombinant strain C. glutamicumΔproB-odhA (cg2705) was obtained. The plasmid PEC-glnA(Y99F)-sRNA-MicC-Hfq was then introduced and named CG02.

[0057] Example 4 CG-03: Construction of gdh-enhanced strain

[0058] Using the wild-type Corynebacterium glutamicum ATCC13032 genome as a template, primers gdh-1 / gdh-2 were used to PCR amplify the gdh gene fragment; primers tac-1 / tac-2 were used to amplify the Ptac promoter, and then the gdh gene expression cassette was obtained by overlapping PCR; primers gdh-V1 / gdh-V2 were then used to PCR amplify the PEC-glnA(Y99F)-sRNA-MicC-Hfq plasmid constructed previously; seamless cloning reactions and transformation experiments were performed on the plasmid backbone fragment PEC-V and the gdh gene expression cassette. The successfully constructed plasmid PEC-glnA(Y99F)-gdh-sRNA-MicC-Hfq was screened out (its plasmid map is shown in Figure 2 The recombinant strain C. glutamicumΔproB-odhA(cg2705) was electroporated to obtain the recombinant strain C. glutamicumΔproB-odhA(cg2705)-glnA(Y99F)-gdh-sRNA-MicC-Hfq, which was named CG03.

[0059] Example 5 CG04: Construction of gltB knockout strain

[0060] (1) Construction of upstream and downstream homology arms and integration fragments of gltB

[0061] Using the wild-type Corynebacterium glutamicum ATCC13032 genome as a template, the upstream and downstream homology arms of gltB were amplified using primers gltB-1 / gltB-2 and gltB-3 / gltB-4, respectively. Then, overlapping PCR was used to obtain the fusion fragment gltB-Donor.

[0062] (2) Construction of gltB-pJYS3 plasmid

[0063] The middle 500 bp base sequence of the gltB gene was selected, sgRNA was selected and primer pJYS3F-gltB was designed. The pJYS3-ΔcrtYF plasmid was used as a template, and PCR was performed using primers pJYS3F-gltB and pJYS3-R. Then, gel recovery and T4 ligation were performed, and E. coli DH5α was transformed to obtain the correct gltB-pJYS3 plasmid.

[0064] (3) Construction of gltB gene knockout strain

[0065] The fusion fragment gltB-Donor and the recombinant plasmid gltB-pJYS3 were electroporated into C. glutamicumΔproB-odhA(cg2705) competent cells. After screening, the recombinant strain C. glutamicumΔproB-odhA(cg2705)-ΔgltB was obtained. The plasmid PEC-glnA(Y99F)-gdh-sRNA-MicC-Hfq was then introduced into it and named CG04.

[0066] Example 6 L-glutamine genetically engineered bacteria shake flask fermentation

[0067] (1) Seed culture

[0068] Inoculate ATCC13032, L-glutamine-producing strains CG01, CG02, CG03, and CG04 onto LBB solid medium without antibiotics or with kanamycin, respectively, and incubate at 30°C for 24 hours. Then, select a single colony and inoculate it into 10 mL of seed medium, which is then incubated overnight at 30°C in a shaker.

[0069] (2) Fermentation culture

[0070] The inoculum volume was transferred to 30 mL shake flask fermentation medium at 10% and cultured in a shaker at 30°C and 220 rpm for 60 h.

[0071] (3) Detection of L-glutamine in fermentation broth

[0072] After fermentation, the fermentation broth was thoroughly shaken and 1 mL of fermentation broth was transferred from each bottle to an EP tube. The supernatant was centrifuged at 12,000 rpm for 5 min and filtered through a 0.22 μm aqueous filter. L-glutamine content was determined by high-performance liquid chromatography (HPLC) using the following conditions: Agilent Phenomenex Luna C18 SB-aq column; mobile phase: 6.8 g / L potassium dihydrogen phosphate (KH2PO4) solution and acetonitrile in a volume ratio of 81:19; column temperature: 40 oC; flow rate: 0.8 mL / min; detection time: 6-10 min; UV detection wavelength: 338 nm; injection volume: 10 μL.

[0073] The L-glutamine production of the strains is shown in Table 1 below.

[0074] Table 1

[0075] Strain L-Glutamine production (g / L) ATCC13032 4.7 CG01 19.06 CG02 24.37 CG03 28.29 CG04 31.85

[0076] in:

[0077] Shake flask fermentation medium composition (1 L): 80 g glucose, 30 mL corn syrup, 40 g ammonium sulfate, 2.5 g potassium dihydrogen phosphate, 2 g urea, 2 g magnesium sulfate heptahydrate, 5 mL trace element solution, adjusted to pH 7. Autoclave at 115°C for 15 min (glucose and magnesium sulfate heptahydrate solution are sterilized separately).

[0078] Microionic solution (1 L): 2.0 g magnesium sulfate heptahydrate, 10 mg zinc sulfate, 20 mg ferrous sulfate, 10 mg manganese sulfate, 10 mL 35% HCl.

[0079] Example 7 Fermentation of L-glutamine genetically engineered bacteria CG04 in a 5 L fermenter

[0080] (1) Fermentation tank preparation

[0081] First, install the pH electrode and perform electrode calibration (calibrate to 6.8 first, then calibrate to 4.0). Clean the fermenter, pour in the prepared culture medium, add 1 mL of defoamer, and sterilize the fermenter at 115 °C for 20 min. After completion, install the fermenter on the fermentation operating table, connect the stirring paddle, and set the initial speed to 300 rpm / min; connect the pH electrode and ammonia water, and adjust the pH to 7.0 when the temperature drops to 30 °C; install the dissolved oxygen electrode, turn on the circulating water, and set the temperature to 30 °C; install the ventilation device, and set the initial ventilation volume to 1 vvm.

[0082] (2) Seed cultivation

[0083] Streak the CG04 bacterial liquid onto a Kan plate and place it in a 30 °C incubator for overnight culture. The next day, pick a single colony from the plate and inoculate it into a 100 mL shake flask containing 10 mL seed culture medium. Place it in a shaker at 30 °C and 220 rpm for 12 h to obtain the first-level seed. Then, inoculate 10% of the first-level seed into a 1 L baffled shake flask containing 100 mL fermentation medium and place it in a shaker at 30 °C and 220 rpm to OD 600 When it is 15-20, you will get the second level seed.

[0084] Fermentation tank fermentation

[0085] After igniting the inoculation port, antibiotics, glucose, magnesium sulfate solution, and bacterial strains were quickly introduced. After fermentation began, the dissolved oxygen electrode was calibrated to 100%, the dissolved oxygen was set to 30%, and stirring was combined. Automatic ammonia was added to adjust the pH to 7.0. When the glucose in the tank was depleted, an automatic glucose feed was set to maintain a residual sugar concentration of approximately 1-5 g / L. When the stirring speed exceeded 750 rpm / min, the ventilation rate was adjusted to maximum ventilation, and ammonia was added to adjust the pH to 6.5. The fermentation cycle was 72 hours.

[0086] Detection of L-glutamine in fermentation broth

[0087] After fermentation, the fermentation broth was thoroughly shaken and 1 mL of fermentation broth was transferred from each bottle to an EP tube. The supernatant was centrifuged at 12,000 rpm for 5 min and filtered through a 0.22 μm aqueous filter. L-glutamine content was determined by high-performance liquid chromatography (HPLC) using the following conditions: Agilent Phenomenex Luna C18 SB-aq column; mobile phase: 6.8 g / L potassium dihydrogen phosphate (KH2PO4) solution and acetonitrile in a volume ratio of 81:19; column temperature: 40 o C; flow rate: 0.8 mL / min; detection time: 6-10 min; UV detection wavelength: 338 nm; injection volume: 10 μL;

[0088] The results are as follows Figure 4 As shown in the figure, the CG04 strain reached the highest yield of 58.96 g / L at 55 h of fermentation.

[0089] 5 L fermentor medium (2.5 L): 30.0 g glucose, 30 mL corn syrup, 6.0 g urea, 2.0 g magnesium sulfate heptahydrate, 0.5 g potassium dihydrogen phosphate, 5 mL trace elements, initial pH adjusted to 7.

[0090] Glucose and magnesium sulfate heptahydrate were sterilized separately at 115 °C for 20 min;

[0091] Feed I: 800 g / L glucose;

[0092] Feed II: ammonia 100%;

[0093] Feed III: ammonium sulfate (300 g ammonium sulfate dissolved in 600 mL water).

[0094] The gene sequences used in the embodiments of the present invention are shown in SEQ ID NO. 1-6.

[0095] The primer sequences used in the examples of the present invention are shown in Table 2 below.

[0096] Table 2

[0097] Name Sequence glnA-1 ATTCGAGCAAAGGACCCCTTTCATGGCTGAAGCAAGCATCGAAAAG glnA-2 AGAGGATCCCCGGGTACCGATTATGAAGATTCTCTTTCAAATTCCTTCGTCATGT P-V-1 TCGGTACCCGGGGATCCT P-V-2 GAAAGGGGTCCTTTGCTCGAATTC Y99F-1 GCATGTTTCAACAATGACGGTACTCCA Y99F-2 GAGTACCGTCATTGTTGAAACATGCGG MicC-1 GATAACAAATGTCAGGACCGTTAAGAAGTGAATTTCTGTTGGGCCATTGCATTG MicC-2 GAGCCTTTCGTTTTATTTGAAAAAAAGCCCGGACGACTGT Hfq-1 ACAATTGCGGCCGCAAAGGAGAGGTTGCATGGCTAAGGGGCAATCTTTACAAGA Hfq-2 GATGCCTGGCAGTTTATGGCGTTATTCGGTTTCTTCGCTGTCCTG PglnA-V-1 GATGGCCTTTTTTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAATT PglnA-V-2 CGTGCCGGATACCGAAGAGTTTGTAGAAACGCAAAAAGGCCAT proB-1 AGCTAGCTGTCAATCTAGCCGTTTGCCCAACGTGCCTTCT proB-2 CGCTGGGAAGGATAAAACCGAGGGCAACCACCGGTGTGAATTT proB-3 AAATTCACACCGGTGGTTGCCCTCGGTTTTATCCTTCCCAGCGT proB-4 TTGTATCTATCAGTGAAGCATCAAGCTTCCCATCAGCCGGCAAAT pJYS3-R TGAGAAGGCACGTTGGGCAAACG pJYS3F-proB GATTTGCCGGCTGATGGGAAGCTTGATGCTTCACTGATAGATACAAGAGCCA odhA-1 CTGAGCTAGCTGTCAATCTAGCCGTGTTCTTATCAACACCGGTGTTTGG odhA-2 GTGAGCAGCGCTAGTACTTTCGG odhA-3 TCAGGCCATTAAATGCCACATGCG odhA-4 GTATCTATCAGTGAAGCATCAAGATGCACCGCATGGAAGAC pJYS3F-odhA TACAGTGGATAAAACAAAGCTCAAATCTACAACAGTAGAAATTCGGATCCATTATACCT gdh-1 TTGCGGCCGCAAAGGAGAGGTTGCATGACAGTTGATGAGCAGGTCTCT gdh-2 GGATCCCCGGGTACCGATTAGATGACGCCCTGTGCCAG tac-1 GGCGATGTGGTGATTTTGGACG tac-2 GCAACCTCTCCTTTGCGGC gdh-V1 ATGCTGGCACAGGGCGTCATCTAATCGGTACCCGGGGATCCTC gdh-V1 TCGCCAGCTTTATGAAGATTCTCTTTCAAATTCCTTCGTCATGT gltB-1 GACTGAGCTAGCTGTCAATCTAGCCCAGCGTGGGTCGAATGAGAATACG gltB-2 TCTTCTTCAGTGATTCGCGGGATACCTCACTTTAATCCTGT gltB-3 ATTAAAGTGAGGTATCCCGCGAATCACTGAAGAAGATGTGGATTTGTTGC gltB-4 ATCTATCAGTGAAGCATCAAGCGCCACTTGTATTCACCACC pJYS3F-gltB GGTGAATACAAGTGGCGCTTGATGCTTCACTGATAGATACAAGAGCC

[0098] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. Various modifications are possible. In other words, any simple, equivalent changes and modifications made in accordance with the claims and description of the present invention are within the scope of protection of the patent claims. Anything not fully described in this invention constitutes conventional technology.

Claims

1. A method for constructing an L-glutamine-producing Corynebacterium glutamicum engineered strain using sRNA interference-site-directed mutagenesis-dynamic promoter regulation, characterized in that: The following steps are involved: The glutamine synthase encoding gene from Saccharomyces cerevisiae with a tyrosine residue at position 99 mutated glnA , and targeting the adenylyltransferase gene glnE The sRNA-MicC-EcHfq regulatory module was integrated into the vector plasmid to construct a recombinant plasmid that relieves the adenylylation of glutamine synthase; The recombinant plasmid was transferred into the growth stage specific promoter P cg2705 Control of α-ketoglutarate dehydrogenase E1 subunit gene odhA An L-glutamine-producing Corynebacterium glutamicum engineered strain can be obtained from the expressed Corynebacterium glutamicum.

2. The construction method according to claim 1, wherein The vector plasmid is PEC-XK99E plasmid.

3. The construction method according to claim 1, characterized in that The construction method comprises: after the recombinant plasmid for removing the adenylylation of glutamine synthase is transferred into Corynebacterium glutamicum, the gene encoding γ-glutamyl kinase, a key step in proline synthesis, is further knocked out. proB ; Knockout of the gene encoding glutamate synthase in the L-glutamine decomposition pathway gltB ; and overexpression of the gene encoding glutamate dehydrogenase gdh , a Corynebacterium glutamicum engineered strain with high L-glutamine production can be obtained.

4. The construction method according to claim 3, characterized in that The construction method comprises the following steps in any order: S1. Integration into vector plasmid glnA -Y99F and sRNA-MicC-EcHfq framework to obtain a plasmid that eliminates the adenylylation of glutamine synthase; S2, replace the Corynebacterium glutamicum odhA The promoter of the gene is a growth-stage specific promoter P cg2705 ; S3, knocking out the Corynebacterium glutamicum proB Gene and overexpressed in vector plasmid gdh Gene; S4, knocking out the Corynebacterium glutamicum gltB Gene.

5. The construction method according to claim 1, wherein described glnA The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the targeting glnE The nucleotide sequence of the sRNA of the gene is shown in SEQ ID NO.2, and the P cg2705 The nucleotide sequence is shown in SEQ ID NO.

3.

6. The construction method according to claim 3 or 4, characterized in that described proB The nucleotide sequence of the gene is shown in SEQ ID NO.

4. gltB The nucleotide sequence of the gene is shown in SEQ ID NO.

5. gdh The nucleotide sequence of the gene is shown in SEQ ID NO.

6.

7. The construction method according to claim 1, wherein: The Corynebacterium glutamicum is selected from: Corynebacterium glutamicum ATCC13032.

8. An engineered strain of Corynebacterium glutamicum producing L-glutamine by sRNA interference-site-directed mutagenesis-dynamic promoter regulation, constructed by the construction method according to any one of claims 1 to 7.

9. Use of the engineered strain of Corynebacterium glutamicum according to claim 8 in the fields of chemicals, medicines, health products or feed, characterized in that: The engineered strain of Corynebacterium glutamicum is used to prepare chemicals, medicines, health products or feed containing L-glutamine.

10. The use according to claim 9, characterized in that The application includes: fermenting the engineered strain of Corynebacterium glutamicum in a culture medium containing corn steep liquor, ammonium sulfate, KH2PO4, MgSO4, FeSO4, glucose, and urea, wherein the fermentation conditions are: at a temperature of 30°C, the dissolved oxygen is maintained at 30% by adjusting the speed of an associated stirring blade, the pH is adjusted to 6.5 by automatically adding ammonia water, and the residual sugar concentration is maintained at 1-5 g / L by automatically adding 800 g / L glucose, and the fermentation cycle is 65-72 hours, so as to achieve the production of L-glutamine.

Images