Application of hepcidin expression quantity in larimichthys polyactis liver as larimichthys polyactis visceral white-spot disease resistance evaluation index and construction method

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of hepcidin expression quantity in larimichthys crocea liver as larimichthys crocea visceral white-spot disease resistance evaluation index and a construction method. The hepcidin expression quantity in the larimichthys crocea liver is applied as the larimichthys crocea visceral white-spot disease resistance evaluation index. The construction method of the resistance evaluation index comprises the following steps: taking healthy small yellow croaker intraperitoneal injection pseudomonas proteinus strain bacterial liquid, and determining a half lethal dose in 96 hours; the method comprises the following steps: injecting a half lethal dose of bacterial liquid of pseudomonas proteinus strains into the abdominal cavity of healthy small yellow croaker for 96 hours, and after infection, taking different tissues to carry out hepcidin gene expression fluorescent quantitative PCR analysis; a regression model of gene expression quantity and bacterium loading quantity is established through fluorescence quantification, and the relationship between hepcidin expression quantity and disease resistance is constructed. Accurate disease-resistant phenotype information is provided for development of breeding of visceral white-spot disease-resistant improved varieties of the small yellow croakers, the accuracy of disease-resistant breeding is promoted, early detection of diseases is realized, and prevention and treatment of the diseases are effectively guided.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to hepcidin Application and construction method of expression level as an evaluation index for resistance to visceral white spot disease in small yellow croaker. Background Art

[0002] Small yellow croaker ( Larimichthys polyactis ) is an important economic fish species in my country's coastal waters, with extremely high market value and ecological significance. The small yellow croaker aquaculture industry has developed rapidly and has been cultivated in large quantities in coastal areas such as Zhejiang, Jiangsu, Tianjin, and Hebei. As the scale of aquaculture continues to expand, disease problems have become increasingly prominent, among which the disease caused by Pseudomonas aeruginosa ( Pseudomonas plecoglossicida ) is one of the major bacterial diseases that seriously endangers the small yellow croaker aquaculture industry. Typical symptoms of diseased fish include the appearance of a large number of white nodules (white spots) on the surface of internal organs (such as the liver, spleen, and kidneys), accompanied by anorexia, darkening of body color, abnormal swimming, etc. The infection process is characterized by an acute outbreak after an asymptomatic latent period, which can lead to an extremely high mortality rate of more than 80% within a few days, often causing significant economic losses. Therefore, the breeding of small yellow croaker resistant to visceral white spot disease is of vital importance to the healthy development of the small yellow croaker aquaculture industry. However, due to the lack of an accurate evaluation method for fish resistance, the accuracy of breeding disease-resistant varieties is low, and there is an urgent need to develop indicators that can effectively evaluate the resistance of small yellow croaker.

[0003] Patent CN112656854B provides a traditional Chinese medicine composition for preventing and treating fish visceral white spot disease, as well as its preparation method and application. This patented composition effectively eliminates symptoms of congestion, bleeding, and ascites in diseased fish, promotes liver metabolism, and reduces the formation of white spots on internal organs such as the spleen, kidneys, and liver. It features rapid onset, safety, non-toxicity, and stable efficacy. Patent CN103877524A provides a compound Chinese herbal medicine for treating white spot disease in large yellow croaker and its preparation process. This patented composition utilizes a rational combination of seven traditional Chinese herbs, followed by high-pressure decoction, dual-action vacuum concentration, and drying spraying, significantly improving efficacy and palatability. The compound herbal medicine significantly reduced the number of large yellow croaker fish with white spot disease.

[0004] Currently, the treatment for white spot disease in yellow croaker on the market generally uses mercurochrome combined with a heating rod, or fish medicines based on traditional Chinese medicine, such as "Wu Huang Powder." There is no research on the yellow croaker's resistance to white spot disease, and even less research on the screening and cultivation of yellow croaker resistant to white spot disease. Therefore, this paper further investigates the application and construction of an evaluation index for visceral white spot disease resistance in small yellow croaker, focusing on hepcidin expression in the liver. Summary of the Invention

[0005] In view of the problems existing in the prior art, the object of the present invention is to design and provide a method for hepcidin Technical solutions for the application and construction of expression level as an evaluation index for resistance to visceral white spot disease in small yellow croaker.

[0006] The present invention is achieved by adopting the following technical solutions: The present invention provides a method for treating a small yellow croaker liver hepcidin Application of expression level as an evaluation index for resistance to visceral white spot disease in small yellow croaker.

[0007] Another aspect of the present invention provides a method for treating a small yellow croaker liver hepcidin A method for constructing expression level as an evaluation index for resistance to visceral white spot disease in small yellow croaker comprises the following steps: 1) Intraperitoneally inject healthy yellow croaker with a strain of Pseudomonas aeruginosa, the pathogen of white spot disease in the viscera of yellow croaker, and determine the median lethal dose (LD50) within 96 hours. 2) A healthy yellow croaker was intraperitoneally injected with a 96-hour half-lethal dose of the bacterial solution of the pathogen of white spot disease in the viscera of yellow croaker Pseudomonas aeruginosa. After infection, different tissues were collected for hepcidin Fluorescence quantitative PCR analysis of gene expression to identify appropriate tissues for disease resistance phenotype research; 3) Establish a regression model between gene expression and bacterial load through fluorescence quantification, and construct hepcidin Relationship between expression level and disease resistance.

[0008] Furthermore, the 96h half lethal dose in step 1) is 0.5~2.5×10 3 CFU / ml.

[0009] Furthermore, the nucleotide sequence of the specific primer F1 used in the fluorescent quantitative PCR analysis in step 2) is shown as SEQ ID NO.1, and the nucleotide sequence of the primer R1 is shown as SEQ ID NO.2.

[0010] Furthermore, in step 2), the liver is determined as the object of disease resistance phenotype research.

[0011] Furthermore, the nucleotide sequence of the specific primer F2 used in the bacterial load determination in step 3) is shown in SEQ ID NO. 3, and the nucleotide sequence of the primer R2 is shown in SEQ ID NO. 4.

[0012] Furthermore, in step 3), the linear relationship between hepcidin expression and disease resistance is: Y=-0.01152*X+27.50, P<0.05, where X is the relative expression level of the hepcidin gene and Y is the relative bacterial load in the tissue.

[0013] The beneficial effects of the present invention are: (1) The present invention is determined by hepcidin The expression level can effectively evaluate the resistance of small yellow croaker to Pseudomonas aeruginosa disease, providing accurate disease-resistant phenotypic information for the breeding of small yellow croaker resistant to visceral white spot disease. It will greatly promote the accuracy of disease-resistant breeding, and can also realize early detection of diseases and effectively guide disease prevention and treatment.

[0014] (2) The present invention is simple to operate, is easy to apply in industrial production, has low cost and wide application range. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 injection of different concentrations (2.5×10 2 -2.5×10 8 Survival curve of small yellow croaker under the influence of Pseudomonas aeruginosa XSLPP-1 strain (CFU / mL).

[0016] Figure 2 The coding sequence and predicted amino acid sequence of the antimicrobial peptide hepcidin. The red letters indicate the signal peptide region, and the black underline indicates the conserved structural region.

[0017] Figure 3 Changes in the induced expression of hepcidin antimicrobial peptide in four tissues of small yellow croaker after infection with Pseudomonas aeruginosa; Note: Figure 3 A in the figure represents the gene expression level of hepcidin in the liver of small yellow croaker. Figure 3 B in the figure is the gene expression level of hepcidin in spleen of small yellow croaker. Figure 3 C in the figure is the gene expression level of hepcidin in the head kidney of small yellow croaker. Figure 3 D in the figure represents the gene expression level of hepcidin in the intestine of small yellow croaker. Different lowercase letters above the error bar indicate that the expression levels at different time periods after infection are statistically significant ( P <0.05).

[0018] Figure 4 Correlation analysis between bacterial load and antimicrobial peptide expression level; Note: Figure 4 Figure A shows the expression of antimicrobial peptide genes in the livers of the control (C), low bacterial load (L) and high bacterial load (H) groups after infection with Pseudomonas aeruginosa. Figure 4 B in hepcidin Correlation analysis between gene expression and bacterial load. DETAILED DESCRIPTION

[0019] The present invention will be further described below with reference to specific embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below generally represent only a portion of the present invention, rather than all of the embodiments. Therefore, all other embodiments derived by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

[0020] Example 1: Bacterial culture The pathogen of visceral white spot disease in small yellow croaker, Pseudomonas aeruginosa, was isolated from small yellow croaker with typical visceral white spot disease in cages in Xiangshan, Ningbo, and stored in an ultra-low temperature freezer at the Institute of Hydrobiology, Zhejiang Academy of Agricultural Sciences. A small amount of the strain stored at -80°C was streaked onto trypticase soy agar and incubated upside down at 28°C for 24 hours. A single colony was selected and inoculated into 10 mL of trypticase soy agar and cultured at 28°C with shaking at 200 rpm for 24 hours. This was the primary culture. A 1% inoculum of the primary culture was inoculated into 100 mL of trypticase soy agar and cultured at 28°C with shaking at 200 rpm for 24 hours. This was the secondary culture.

[0021] Example 2: Determination of half-lethal concentration and artificial infection Use a pipette to draw 2mL of secondary bacterial solution into an EP tube, centrifuge at 3000rpm for 3min, remove the supernatant, and resuspend in sterile PBS. Then dilute the resuspended secondary bacterial solution to an appropriate concentration and measure the OD of the bacterial solution. 600 Value (OD 600 =1, bacterial concentration = 3×10 8 CFU / mL).

[0022] 480 healthy small yellow croakers (22.95 ± 5.09 g, 11.26 ± 1.08 cm) were randomly divided into 8 groups, 7 of which were experimental treatment groups and 1 was a control group. Each group had 3 replicates, and each replicate contained 20 fish. The fish were temporarily kept in a 500-liter culture tank. The 7 experimental groups were injected intraperitoneally with a volume of 0.5 ml and a concentration of 2.5 × 10 2 -2.5×10 8 CFU / mL of bacterial solution. The control group was injected with 0.5ml of sterile PBS at the same time. The death rate was observed and recorded every day during the infection period. The survival of small yellow croaker after injection of different concentrations of bacterial solution was analyzed ( Figure 1 ), and found that the mortality rate was dose-dependent. After Probit regression analysis of the experimental data, the regression equation was: y=0.894log 10 (x)-2.423( P<0.001), where x is the amount of pathogens and y is the Probit transformation value corresponding to the survival rate. The 96h half-lethal concentration was determined to be 1×10 3 CFU / ml.

[0023] Example 3: Sample collection at different time points after artificial infection of small yellow croaker 360 healthy small yellow croaker (21.81 ± 6.11 g, 10.84 ± 1.01 cm) were randomly divided into experimental and control groups, with three replicates of 60 fish per replicate. The fish were housed in 1-ton aquaculture tanks. The experimental group received an intraperitoneal injection of a half-lethal dose of the bacterium 96 hours after infection, while the control group received an equal volume of sterile PBS. At 0, 6, 12, 24, 48, 72, and 96 hours post-infection, 12 fish from each group were randomly selected for dissection. The liver, spleen, head kidney, and intestine were collected and stored at -80°C for future use.

[0024] Example 4: Cloning of the antimicrobial peptide hepcidin gene sequence Total RNA was extracted from tissues using standard methods, and the integrity of the RNA was verified by 1.2% agarose gel electrophoresis. The concentration and quality of the total RNA were measured using a Nanodrop One spectrophotometer. The RNA was then reverse transcribed using standard procedures, and the resulting cDNA was stored at -80°C until use. hepcidin The full-length open reading frame (ORF) of the gene was amplified by PCR using specific primers (upstream primer sequence 5'-3': TGTCCCAGCCAATGAAGAGCAA; downstream primer sequence 5'-3': AAGATGCCGTATTACATGCGTGAG).

[0025] PCR products were purified using the SanPrep Column DNA Gel Extraction Kit (Shanghai Biotech) and cloned into the pESI-TA / Blunt vector using the Hieff Clone® Universal Zero TOPO TA / Blunt Cloning Kit (Shanghai Yisheng). The recombinant plasmids were then transformed into DH5α chemically competent cells (Shanghai Yisheng). Positive clones were verified by Sanger sequencing at Shanghai Biotech Co., Ltd. The NCBI ORF Finder program (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html) was used for analysis. Lp_piscidin 、 Lp_hepcidin and Lp_NK-lysinThe ORF was subsequently translated into amino acid sequence using DNAMAN 9.0. The isoelectric point (pI) and molecular weight (MW) were predicted using ProtParam (http: / / web.expasy.org / protparam / ). The signal peptide cleavage site was determined using SignalP 5.0 (https: / / services.healthtech.dtu.dk / services / SingnalP-5.0 / ). Conserved domains were further annotated using CD-search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) using the default threshold.

[0026] The clone was obtained hepcidin The coding sequence of NCBI is PV297803. The gene contains a 258 bp open reading frame encoding an 85 amino acid polypeptide with a predicted molecular weight of 9.65 kDa and a theoretical isoelectric point of 7.43. It contains a 24 amino acid signal peptide and a 63 amino acid mature hepcidin domain ( Figure 2 ).

[0027] Example 5: Fluorescence quantitative PCR (qPCR) analysis of gene expression according to hepcidin and β-actin The CDS sequence was expressed, and Primer Premier 6.0 was used to design qPCR-specific primer sequences (upstream primer sequence F1: SEQ ID NO. 1: AGCCAATGAAGGCAAGAGC, downstream primer sequence R1: SEQ ID NO. 2: TCATTCTAGGACAGCAACGGC).

[0028] In this example, qPCR was performed using QIAquant 96 2plex (QIAGEN, Germany) and Hieff UNICON® qPCRSYBR Green Master Mix (Yisheng, Shanghai). The reaction system was 20 μL (cDNA 1.0 μL, forward primer 0.5 μL, reverse primer 0.5 μL, Mix 10.0 μL, ddH2O 8.0 μL). The reaction procedure was as follows: initial denaturation at 94°C for 30 s; denaturation at 94°C for 5 s, denaturation at 60°C for 30 s, and denaturation at 72°C for 10 s, for a total of 40 cycles. -ΔΔCt The relative expression levels of these genes were calculated using β- actin The gene expression was normalized as an internal reference to analyze the expression of Pseudomonas aeruginosa after infection. hepcidinThe temporal expression characteristics of the small yellow croaker liver, spleen, head kidney and intestine were analyzed. hepcidin The expression level in the liver showed an overall increasing trend with the extension of infection time, among which it was significantly high from 48h to 96h after infection ( P <0.05; Figure 3 A in the figure); in the spleen, the expression trend was first increased and then decreased, with the highest expression at 12 h after infection, and then gradually decreased until 96 h when its expression level was not significantly different from that at the early stage of infection ( P <0.05), down-regulated at 96 h after infection ( Figure 3 B in the head and kidney tissues); gene expression levels increased significantly at 6 h after infection ( P <0.05), and then maintained a high expression, and dropped to the initial infection level at 96 h after infection ( Figure 3 C in the figure); Gene expression in the intestine also gradually increased with the extension of infection time and reached a peak at 48 hours after infection ( P <0.05; Figure 3 D in the figure), and then rapidly decreased to a level with no significant difference from the initial infection stage. hepcidin After Pseudomonas aeruginosa infection, significant differential expression occurred in the four tissues of small yellow croaker. Comparison of the gene expression change trends in the four tissues showed that the gene expression in the liver tissue showed a gradually increasing trend, which is more suitable for evaluating the disease resistance phenotype.

[0029] Example 6: hepcidin Correlation analysis between gene expression and bacterial load To further clarify the hepcidin To investigate the correlation between expression levels and resistance to visceral white spot disease, 200 healthy small yellow croaker (28.55 ± 7.73 g, 11.73 ± 1.08 cm) from a single family were intraperitoneally injected with a sublethal dose of Pseudomonas aeruginosa. A control group was injected with the same volume of sterile PBS. Fish were closely monitored during infection, with mortality determined by whether the fish lay still at the bottom of the tank or floated on the surface, unresponsive to touch. Dead individuals were promptly removed, the time of death recorded, and liver tissue was rapidly dissected and stored at -80°C for determination of bacterial load and gene expression.

[0030] Method for determination of bacterial load in tissues: Bacterial DNA in tissues was determined by EZNNA. ® DNA was extracted using a Bacterial DNA Kit (Omega Bio-Tek, Norcross, GA, USA), and DNA integrity was verified by 1.0% agarose gel electrophoresis. DNA concentration and quality were measured using a Nanodrop One spectrophotometer. DNA gyrase subunit B of Pseudomonas aeruginosa was used ( gyrB ) gene (F2: SEQ ID NO. 3: GGTACTCACCTGGTTGGCTT, R2: SEQ ID NO. 4: GCTTGTCCTTGGTCTGGGAG), and tissue bacterial loads were determined by qPCR. The qPCR reaction system consisted of 20 μL (1.0 μL DNA, 0.5 μL forward primer, 0.5 μL reverse primer, 10.0 μL SYBR Green Master Mix, 8.0 μL ddH2O) using the following protocol: initial denaturation at 94°C for 30 seconds, followed by 40 cycles of denaturation at 94°C for 5 seconds, 60°C for 30 seconds, and 72°C for 10 seconds.

[0031] The samples were divided into high bacterial load (H) group and low bacterial load (L) group according to the bacterial load. (1) Comparative analysis showed that the L group hepcidin The expression was significantly higher than that of the control group (C) ( P <0.01) and group H ( P <0.05; Figure 4 A in (2) The results of correlation analysis showed that the bacterial load and Lp_hepcidin The expression of α-HgCl2 was significantly negatively correlated, and the correlation curve was Y=-0.01152*X+27.50 ( P <0.05; Figure 4 In B), X is the relative expression of hepcidin gene, and Y is the relative bacterial load in tissue. Lp_hepcidin The expression level of can be used as an evaluation index to reflect the resistance of small yellow croaker to visceral white spot disease.

[0032] Sequence Listing .

Claims

1. Small yellow croaker liver hepcidin Application of expression level as an evaluation index for resistance to visceral white spot disease in small yellow croaker.

2. Small yellow croaker liver hepcidin A method for constructing expression level as an evaluation index for resistance to visceral white spot disease in small yellow croaker is characterized in that: The following steps are involved: 1) Intraperitoneally inject a Pseudomonas aeruginosa strain into healthy small yellow croaker to determine the median lethal dose (LD50) within 96 hours. 2) A healthy small yellow croaker was intraperitoneally injected with a 96-hour half-lethal dose of a strain of Pseudomonas aeruginosa. After infection, different tissues were collected for analysis. hepcidin Fluorescence quantitative PCR analysis of gene expression to identify appropriate tissues for disease resistance phenotype research; 3) Establish a regression model between gene expression and bacterial load through fluorescence quantification, and construct hepcidin Relationship between expression level and disease resistance.

3. The construction method according to claim 2, wherein: The 96h half lethal dose in step 1) is 0.5~2.5×10 3 CFU / ml.

4. The construction method according to claim 2, wherein: The nucleotide sequence of the specific primer F1 used in the fluorescent quantitative PCR analysis in step 2) is shown in SEQ ID NO.1, and the nucleotide sequence of the primer R1 is shown in SEQ ID NO.

2.

5. The construction method according to claim 2, wherein: In step 2), the liver is identified as the research subject for the disease resistance phenotype.

6. The construction method according to claim 2, wherein: The nucleotide sequence of the specific primer F2 used in the bacterial load determination in step 3) is shown in SEQ ID NO.3, and the nucleotide sequence of the primer R2 is shown in SEQ ID NO.

4.

7. The construction method according to claim 2, wherein: The linear relationship between hepcidin expression and disease resistance in step 3) is: Y=-0.01152*X+27.50, P<0.05, where X is the relative expression level of the hepcidin gene and Y is the relative bacterial load in the tissue.

Images