Molecular marker for identifying dalbergia odorifera and application thereof

Abstract

The invention discloses a molecular marker capable of being used for identifying dalbergia odorifera (Dalbergia odorifera). The molecular marker is composed of two unique DNA (Deoxyribose Nucleic Acid) sequences. Meanwhile, the invention also provides a method for identifying dalbergia odorifera by using the molecular marker, and the method comprises the following specific steps: extracting total DNA (Deoxyribonucleic Acid) of a sample to be detected, then carrying out high-throughput sequencing operation, comparing the obtained sequencing reads with the molecular marker, and if the sequencing reads can completely cover the molecular marker, identifying the dalbergia odorifera by using the molecular marker. And determining that the to-be-detected sample belongs to the dalbergia odorifera.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a molecular marker related to Dalbergia odorifera and an application of the molecular marker. Background Art

[0002] Dalbergia odorifera, also commonly known as Hainan Huanghuali, shares striking similarities with its fellow Vietnamese species, Dalbergia tonkinensis, in morphological features such as flowers, fruits, and leaves, leading some scholars to propose merging the two species. Furthermore, their wood's color, structure, density, and internal components are highly similar, making accurate differentiation difficult using traditional wood identification techniques. Furthermore, young Dalbergia odorifera can be challenging to distinguish from other species in the same genus.

[0003] Currently, the main methods used to identify Dalbergia odorifera include PCR electrophoresis and first-generation sequencing. PCR electrophoresis amplifies specific DNA fragments and then uses electrophoresis separation to detect the presence of the target fragment, thereby achieving species identification. However, this technology has many limitations, such as very high requirements for primer design. If the primers are not designed properly, false positive or false negative test results are likely to occur. In addition, the detection throughput of PCR electrophoresis is low, and only a limited number of samples can be tested in a single experiment, which makes it difficult to meet the needs of large-scale sample testing. First-generation sequencing mainly conducts sequencing analysis on specific gene regions. Although it can provide more accurate identification information to a certain extent, it also faces the problems of low detection throughput and high cost. The process of first-generation sequencing is relatively cumbersome and requires a lot of manpower, material resources and time. It is also not effective for mixed samples or low-content samples, and is prone to missed detection.

[0004] With the continuous advancement of science and technology, high-throughput sequencing technology has gradually emerged. High-throughput sequencing offers significant advantages, including high throughput, rapid sequencing speed, and relatively low cost. It can sequence large numbers of DNA fragments simultaneously, significantly improving detection efficiency. It can process hundreds or even thousands of samples simultaneously, fully meeting the needs of large-scale sample testing. Furthermore, high-throughput sequencing requires a low sample input volume, enabling efficient sequencing of even minute amounts of DNA. This is crucial for testing rare species or in scenarios where sample quantities are limited.

[0005] Given the numerous shortcomings of existing Dalbergia odorifera identification methods, this invention addresses the technical challenge of accurately, efficiently, and cost-effectively identifying Dalbergia odorifera. By screening unique molecular markers from the Dalbergia odorifera genome and aligning sequence reads with these markers using high-throughput sequencing technology, this method achieves precise identification, successfully matching only Dalbergia odorifera, while effectively matching other Dalbergia species. The successful development of this technology will provide a new and reliable method for Dalbergia odorifera identification, effectively resolving the issue of confusion between Dalbergia odorifera and other similar species in the market, protecting the legitimate rights and interests of consumers and maintaining the normal order of the rosewood market. It also has important practical significance for the conservation of rare Dalbergia odorifera species. Summary of the Invention

[0006] To overcome the difficulties of existing Dalbergia odorifera identification technology, the present invention uses a method based on second-generation sequencing to obtain two specific DNA fragments of Dalbergia odorifera. Analysis found that these two DNA fragments do not have high homology with any currently known genome, making them very suitable as reference sequences for identifying Dalbergia odorifera. On this basis, the present invention also uses sequencing data to design a reliable Dalbergia odorifera identification method. The technical solution adopted by the present invention is as follows: In one aspect, the present invention provides a molecular marker for identifying or assisting in the identification of Dalbergia odorifera, wherein the nucleic acid sequence of the molecular marker is shown as SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0007] On the other hand, another object of the present invention is to provide the application of the above molecular markers in the identification or auxiliary identification process of Dalbergia odorifera.

[0008] On the other hand, the present invention provides a method for identifying or assisting in the identification of Dalbergia odorifera, characterized in that the method comprises the following steps: 1) collecting a tissue to be tested as a sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) assembling the sequencing data and comparing the assembled contigs with the aforementioned molecular markers; 5) judging whether the sample to be tested is Dalbergia odorifera based on the comparison results; if the assembled contigs include a contig consistent with the molecular marker sequence, the species of the sample to be tested is judged to be Dalbergia odorifera.

[0009] On the other hand, the present invention provides a method for identifying or assisting in the identification of Dalbergia odorifera, characterized in that the method comprises the following steps: 1) collecting a tissue to be tested as a sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) using Geneious software, according to the default parameters of the software, to compare the above sequencing reads with the DNA molecular markers described in the present application; 5) judging whether the sample to be tested contains Dalbergia odorifera based on the coverage of the sequencing reads on the DNA molecular markers; if the sequencing reads can completely cover the molecular markers and can generate a consistent sequence that is completely consistent with the DNA molecular markers, it is determined that the species of the sample to be tested contains Dalbergia odorifera.

[0010] In one embodiment, in step 4), sequencing reads of multiple samples are mixed and grouped.

[0011] In one embodiment, if the sequencing reads of multiple samples are mixed and grouped in the above step 4), the method further includes step 6): further dividing the samples containing Dalbergia odorifera into two groups, mixing the sequencing reads of the two groups of samples respectively, and repeating the operation of the above step 5) until a sample containing only Dalbergia odorifera is identified.

[0012] In one embodiment, the high-throughput sequencing in step 2) is second-generation sequencing or third-generation sequencing.

[0013] In one embodiment, in step 3), reads are aligned using any version of Geneious, Bowtie, Tophat, or HISAT.

[0014] In one embodiment, SEQ ID NO: 1 or SEQ ID NO: 2 can be used alone to identify Dalbergia odorifera.

[0015] In one embodiment, SEQ ID NO: 1 and SEQ ID NO: 2 can be used in combination to identify Dalbergia odorifera.

[0016] The present invention has the following beneficial effects: First, the present invention obtains and discloses for the first time two unique fragments in the Dalbergia odorifera genome. After analysis and verification, these two fragments do not have a high degree of homology with any other existing genomes, and are very suitable as reference sequences for identifying Dalbergia odorifera. Second, the present invention can identify mixed samples. For example, tissue samples can be directly collected and total DNA can be extracted. The DNA information of the sample can be obtained through high-throughput sequencing, and then this information is compared with the reference sequence to determine whether the sample contains Dalbergia odorifera. Third, the direct use of high-throughput sequencing technology can achieve high-throughput detection, and there is no need for primer design, which avoids the difficulties that may be encountered in the primer design process. It is simple to operate and has a high detection sensitivity. Fourth, the present invention also provides two specific molecular markers. These two markers can be used alone or in combination. The combined use can further improve the accuracy of Dalbergia odorifera identification. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0018] Figure 1 This is the comparison result of the molecular marker SEQ ID NO.1 of Dalbergia odorifera in the nr / nt database of NCBI.

[0019] Figure 2 This is the comparison result of the molecular marker SEQ ID NO.2 of Dalbergia odorifera in the nr / nt database of NCBI.

[0020] Figure 3 This is the result of alignment of the sequencing reads of sample No. 1 in Table 1 with the molecular marker SEQ ID NO. 1 of Dalbergia odorifera.

[0021] Figure 4 This is the result of alignment of the sequencing reads of sample No. 2 in Table 1 with the molecular marker SEQ ID NO. 1 of Dalbergia odorifera.

[0022] Figure 5 This is the result of alignment of the sequencing reads of sample No. 3 in Table 1 with the molecular marker SEQ ID NO. 1 of Dalbergia odorifera.

[0023] Figure 6 This is the result of alignment of the sequencing reads of sample No. 1 in Table 1 with the molecular marker SEQ ID NO. 2 of Dalbergia odorifera.

[0024] Figure 7 This is the result of alignment of the sequencing reads of sample No. 2 in Table 1 with the molecular marker SEQ ID NO. 2 of Dalbergia odorifera.

[0025] Figure 8 This is the result of alignment of the sequencing reads of sample No. 3 in Table 1 with the molecular marker SEQ ID NO. 2 of Dalbergia odorifera.

[0026] Figure 9 The results are obtained by mixing sequencing reads of samples without Dalbergia odorifera and then aligning them with the molecular marker SEQ ID NO.1 of Dalbergia odorifera.

[0027] Figure 10 This is the result of mixing sequencing reads of samples without Dalbergia odorifera and aligning them with the molecular marker SEQ ID NO.2 of Dalbergia odorifera. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and beneficial technical effects of the present invention clearer and more specific, the present invention is further described in detail below with reference to specific embodiments. It should be noted that the embodiments described in this specification are only used to explain the present invention and are not intended to limit the present invention. The parameters, proportions, etc. in the embodiments can be adjusted according to actual conditions without having a substantial impact on the final results.

[0029] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0030] Example 1 Molecular markers of Dalbergia odorifera The present invention determines the molecular marker standard detection sequence for the identification of Dalbergia odorifera through sequencing assembly and comparative analysis. The specific sequence is as follows: SEQ ID NO.1:5’-CTGGTGCGAGGAAGAAAGGGGAACCGGCGCGGTGGTTTGGGTGTCGGCGGCGGAGGTCTGGGTCGCGCGGAGAGAGGAGGTGATGGTGGTGGTTGACTTCTCACGGTTACGCGACTGCGAGGTGGGGTGGAGGTCAAGGCGGTTGTGATTGGCGGCGGATGAGTGTTTTCAGGTGGGGGTAGTGTAGTGGCGCGACTTGGCTATGGATGGCTGGAGTGGCGCGTTGCTGTTGAGGTTCCTGGCTGTAGCCGGCGGCGATTGGCGGTCCGATTCGCGATGGGTCACGGCTGGCTGCTAGCGCTGCTCCAAGCACGGCTCCGCAGTGGTTTTCGGAGGGGAAAGCTGCGGATTTGTAAACAGCGAAGAGGGGCATGGACCTGGACAGCAGAAAGGGAGGCTGAGCTTGTGGCGGTGCGGCTGTGGGGGGTGTGGATCGCAAGCACAGGGGCGGCGCGATTGGGGGCTGGTCACGAGGTGGATGTCCGCGGTGGTTTGAAGGAGCACGGGCGCACGAAGGGGAGTCCAGGGGCGGAGGTCTGGTGCTTTGAGGTTGCTGCTTCCTTTTTTATTTTTGTCTTTAAATTCTGGTTGGTTATAAGGTTTTGGTTGTGGCTTCCATTCATGCTCTATTTGAAATTGTTCATGGGTTTGAGAGTACTGAGTGGTTGATATTGATTGTATTTTTCCAGGTGATGATGGTGTGCTGATTGTGGTTTGAATGGTGATTCTAATGGTTGGTGATGGGATGGTGATGGAGGAAGTTCTTGGTTAGTTTAGGATGATGGTGGAGGAGAATGATTTTGGTGGTGATGATGAGTTGAACCCAGAACTCCCTGGGCCGTGAAGATGGTTTTTTTGAACCCAGAACCCCCCTTCTCTGTGATGGTTCCTTTCTCTATTTGTATTGCCTTTGATCTTTGTAATTTGCATTTGTTCCCATGCTGTCTGCAACC -3’(SEQ ID NO:1);SEQ ID NO.2:5'-GTTCGAGCACCAGAACCACTTGCCCAGCTGTCGCGTTGAAGCTCCAGCGAACCAGCCAGTGCTGATCTCCAGTCGTGCGCATCTCTGCACAGCAGCAGCTCCACCTCACCGGAAAACCAGTCTCTATGCCCCACGAAAACAGCAGCAACAGTTCCACTAAGCATCGCTGCTAAAACTGGATCTGAAAAATCCAAGTTTGGAGCTCAACCAAGCC ATGTAAATTGTTCAGCCACACAGCACTTTGCTCACGCCCTCATCACAGAGACCAACATCCTCAAATCACCGCCCAAATCACTGCCTGGTTCTTCCCTTTTGTGCGTGTACCATTCCTCCTTATAGCCACTGTGAAATCAACCTTACCATTTGCTGGAAAGCATCGCCAGGAACATAGCAATCTCCAGCCACGGTTCTTTCCTTTTCCTTCTTCTCCGT -3'(SEQ ID NO:2);. The molecular markers described in the present invention were submitted to the NCBI database for online blast comparison, with the nr / nt database selected, no species restriction, and the More dissimilar sequences parameter selected. Figure 2 As shown, the comparison results show that the molecular markers described in the present invention have no homologous sequences included in the nr / nt database of NCBI.

[0031] Example 2 Identification Method of Dalbergia odorifera 1) Collecting the tissue to be tested as the sample to be tested; 2) Extracting total DNA from the sample to be tested; 3) Performing second-generation high-throughput sequencing on the total DNA of each of the above samples to obtain sequencing reads (sequencing depth >30×); 4) Assemble the sequencing data and align the assembled contigs with the aforementioned molecular markers; 5) Determine whether the sample to be tested is Dalbergia odorifera based on the comparison results; if the assembled contigs contain a contig consistent with the molecular marker sequence, then the species of the sample to be tested is determined to be Dalbergia odorifera; otherwise, then the species of the sample to be tested is determined not to be Dalbergia odorifera.

[0032] The test results are shown in the following table: Table 1 Sample test results From the data in Table 1 above, it can be seen that the molecular marker sequence mentioned in the present application exists in samples No. 1 to 3, while the molecular marker sequence is not detected in samples of other Dalbergia species, which indicates that the method provided by the present invention can accurately identify Dalbergia odorifera.

[0033] Example 3 Identification Method 2 of Dalbergia odorifera 1) Collecting a tissue to be tested as a sample to be tested; 2) Extracting total DNA from the sample to be tested; 3) Performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads (sequencing depth>30×); 4) Using Geneious software, according to the default parameters of the software, aligning the above sequencing reads with the DNA molecular markers described in this application; 5) Determining whether the sample to be tested contains Dalbergia odorifera based on the coverage of the sequencing reads on the DNA molecular markers; if the sequencing reads can completely cover the molecular markers and can generate a sequence that is completely consistent with the DNA molecular markers, then it is determined that the species of the sample to be tested contains Dalbergia odorifera; 6) If the sequencing reads of multiple samples are mixed and grouped in the above step 4), then the method further includes step 6): further dividing the sample containing Dalbergia odorifera into two groups, mixing the sequencing reads of the two groups of samples, and repeating the above step 5) until a sample containing Dalbergia odorifera alone is identified.

[0034] The test results are shown in Figures 3 to 8. The samples corresponding to Figures 3 to 8 all contain Dalbergia odorifera. As can be seen from the figures, the sequencing reads fully cover the reference sequences (i.e., the molecular markers SEQ ID NO. 1 and SEQ ID NO. 2 described in this application) and generate consensus sequences that are completely consistent with the molecular marker sequences. The sequencing reads of samples numbered 4 to 33 in Table 1 cannot be effectively aligned with SEQ ID NO. 1 to SEQ ID NO. 2 ( Figures 9 and 10 , red for A base, green for T base, blue for C base, and yellow for G base), which further demonstrates that the method provided by the present invention can accurately identify Dalbergia odorifera.

[0035] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is to be construed in the widest possible manner consistent with the principles and novel features disclosed herein.

Claims

1. A molecular marker for identifying or assisting in the identification of Dalbergia odorifera, characterized in that: The molecular marker comprises at least one sequence of SEQ ID NO.1 or SEQ ID NO.

2.

2. A method for identifying or assisting in identifying Dalbergia odorifera, characterized in that: The method comprises the following steps: 1) selecting a tissue to be tested as a sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing high-throughput sequencing on the extracted total DNA to obtain sequencing reads; 4) assembling the sequencing data, and comparing the assembled contigs with the molecular markers described in claim 1; 5) judging whether the sample to be tested is Dalbergia odorifera based on the comparison results; if the assembled contigs contain a contig that is completely consistent with the molecular marker sequence, then the species of the sample to be tested is judged to be Dalbergia odorifera.

3. A method for identifying or assisting in identifying Dalbergia odorifera, characterized in that: The method comprises the following steps: 1) collecting a tissue to be tested as a sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) comparing the obtained sequencing reads with the molecular markers described in claim 1; 5) judging whether the sample to be tested contains Dalbergia odorifera based on the coverage of the sequencing reads on the molecular markers; if the sequencing reads can completely cover the molecular markers and can generate a consensus sequence that is completely consistent with the molecular markers, it is judged that the species of the sample to be tested contains Dalbergia odorifera.

4. The method for identifying or assisting in identifying Dalbergia odorifera according to claim 3, wherein: In step 4), the sequencing reads of multiple samples are grouped and mixed. The method further includes step 6): the samples containing Dalbergia odorifera are further divided into two groups, the sequencing reads of the two groups of samples are mixed respectively, and the operation of the above step 5) is repeated until the sample containing Dalbergia odorifera alone is accurately identified.

5. The method for identifying or assisting in identifying Dalbergia odorifera according to any one of claims 2 to 4, wherein: The high-throughput sequencing mentioned in step 3) is second-generation sequencing or third-generation sequencing.

6. The method for identifying or assisting in identifying Dalbergia odorifera according to any one of claims 2 to 4, wherein: In step 3), reads were aligned using any version of Geneious, Minimap, Bowtie, Tophat, or HISAT.

7. Use of the molecular marker according to claim 1 as a reference sequence in a method for identifying or assisting in the identification of Dalbergia odorifera.

Images