Self-energized PEC aptamer sensor and construction method and application thereof

Abstract

The invention belongs to the technical field of biosensors, and discloses a self-energized PEC aptamer sensor as well as a construction method and application thereof. According to the invention, the self-powered PEC biosensor for ciprofloxacin detection is constructed by integrating a CdS / PDA photo-anode and a CuInS2 photo-cathode. In the sensing system, the introduction of the photoanode is used for amplifying a photocurrent signal, and the photocathode is used for constructing a sensing interface. The ciprofloxacin aptamer is modified on the surface of the CuInS2 photocathode through chitosan and glutaraldehyde. When the ciprofloxacin exists, the ciprofloxacin can be specifically combined with the aptamer, electron transfer is hindered through a steric hindrance effect, and a photocurrent signal is reduced, so that sensitive detection of the ciprofloxacin is realized. The sensing platform shows relatively low detection limit and relatively good selectivity to ciprofloxacin, and a theoretical basis and an experimental basis are provided for constructing a novel and efficient self-energized PEC biosensor.

Description

Technical Field

[0001] The invention belongs to the technical field of biosensors and relates to the detection of ciprofloxacin. Background Art

[0002] Ciprofloxacin (CIP), a fluoroquinolone antibiotic, is widely used in human medicine, animal husbandry, and aquaculture due to its potent bactericidal and broad-spectrum antimicrobial activity. However, excessive use of CIP can accumulate in organisms through the food chain, leading to a variety of adverse reactions, including toxicity, allergic reactions, and intestinal dysbiosis.

[0003] At present, the detection methods of CIP mainly include liquid chromatography-mass spectrometry, surface enhanced Raman scattering, electrochemical method and fluorescence spectroscopy. x -based nanozyme with enhanced peroxidase-like activity for quinolone antibiotics detection discloses a method for detecting ciprofloxacin using colorimetry, with a detection limit of 3.10×10 2 nM. A Label-Free Fluorescence Aptasensor for the Detection of Ciprofloxacin in Actual Samples discloses a method for detecting ciprofloxacin using fluorescence, with a detection limit of 2.99×10 0 nM. Synergistic nanomaterials:zinc sulfide-polyaniline forciprofloxacin electrochemical sensing discloses a method for detecting ciprofloxacin using electrochemical methods, with a detection limit of 5.00×10 2 nM. Self-Enhanced Near-Infrared Copper Nanoscale Electrochemiluminescence Probe for the Sensitive Detection of Ciprofloxacin Foods discloses a method for detecting ciprofloxacin using electrochemiluminescence, with a detection limit of 2.59×10 0nM. Development of a novel photosensing method for the detection of ciprofloxacin residues in athlete's biological samples discloses a method for detecting ciprofloxacin using photoelectrochemical method with a detection limit of 1.60×10 -2 nM. Compared to other methods, photoelectrochemical (PEC) aptamer sensors have been widely used in analytical detection due to their excellent selectivity, high sensitivity, and ease of miniaturization. As the core component of PEC sensors, the photoactive material is crucial to sensor performance. Based on the type of charge carrier, photoactive materials can be divided into n-type and p-type. Among them, n-type semiconductors are commonly used to construct photoanode sensors. They use photogenerated electrons as the primary charge carriers. Photogenerated holes in the valence band (VB) oxidize electron donors in the electrolyte, resulting in a significant anodic photocurrent. However, in actual detection environments, interference from reducing substances (such as glucose and amino acids) is unavoidable. These substances are easily oxidized by holes, leading to false positive signals during photoanode detection. In contrast, photocathodes based on p-type semiconductors use photogenerated holes as the primary charge carriers. Photogenerated electrons flow from the cathode interface into the electrolyte, making them highly resistant to interference from reducing substances. However, the low photoelectric conversion efficiency of p-type semiconductors results in a weak PEC response, limiting the detection sensitivity of photocathode sensors.

[0004] In recent years, in order to overcome the above limitations, researchers have been committed to exploring and developing a self-powered PEC sensing platform based on dual photoelectrodes. In the self-powered PEC sensing system, the photocathode is used to construct the sensing interface, which can effectively avoid the generation of false positive signals and significantly improve the anti-interference ability of the sensor. At the same time, the introduction of the photoanode brings significant photoelectric signal amplification effect and a lower detection limit to the PEC sensing system. In addition, the sensing system does not rely on an external power supply, but drives electron transfer through the Fermi energy level difference between the photoanode and the photocathode to achieve efficient amplification of the photoelectric signal, thereby significantly improving the detection sensitivity of the sensor. Therefore, screening photoanode and photocathode materials with excellent performance and energy level matching is crucial for building high-performance self-powered PEC sensors. Summary of the Invention

[0005] In response to the above technical problems, the present invention proposes a self-powered PEC aptamer sensor and its construction method and application.

[0006] To achieve the above object, the technical solution of the present invention is implemented as follows:

[0007] A self-powered PEC aptamer sensor comprises an ITO / CdS / PDA photoanode, an ITO / CuInS2 photocathode, and an aptamer assembled on the ITO / CuInS2 photocathode; wherein the ITO / CdS / PDA photoanode comprises an ITO electrode, the surface of which is CdS nanoparticles adhered with polydopamine; the ITO / CuInS2 photocathode comprises an ITO electrode, the surface of which is loaded with CuInS2 nanoflowers; and the aptamer is assembled on the CuInS2 nanoflowers.

[0008] Furthermore, the aptamer is a ciprofloxacin aptamer (Apt), and its sequence number is 5'-NH2-(CH2)6-ATACCAGCTT ATTCAATTGC AGGGT ATCTG AGGCT TGATC TACTAAATGT CGTGG GGCAT TGCTATTGGCGTTGATACGT ACAAT CGTAATCAGT TAG-3'

[0009] The above-mentioned method for constructing a self-powered PEC aptamer sensor comprises the following steps: assembling an aptamer on an ITO / CuInS2 photocathode to form an ITO / CuInS2 / CS / Apt / MCH electrode, and then forming a self-powered PEC aptamer sensor with an ITO / CdS / PDA photoanode;

[0010] The preparation method of the ITO / CdS / PDA photoanode is as follows:

[0011] (1) First, an ITO electrode (0.5 × 4 cm) was ultrasonically cleaned with anhydrous ethanol and ultrapure water for 15 min, and then dried at 60°C. CdS nanoparticles were dispersed in ultrapure water, and the resulting CdS suspension was drop-coated on the surface of the ITO electrode (working area: 0.25 cm). 2 ), and dried under an infrared lamp to obtain an ITO / CdS electrode;

[0012] CdS nanoparticles can be prepared by dissolving Cd(NO₃)₂·4H₂O and Na₂S·9H₂O in ultrapure water. After stirring at room temperature for 30 minutes, the resulting suspension is transferred to a 100 mL reactor and reacted at 140°C for 5 hours. After cooling, the product is washed several times with ultrapure water and ethanol and dried in a vacuum oven at 60°C for 12 hours. The molar ratio of Cd(NO₃)₂·4H₂O to Na₂S·9H₂O is 1:5.

[0013] (2) The ITO / CdS electrode was placed in a Tris-HCl solution (10 mM, pH 8.50) containing dopamine to react, thereby obtaining an ITO / CdS / PDA photoanode. During this process, dopamine self-polymerized to form polydopamine, which adhered to the surface of the ITO / CdS electrode, thereby obtaining an ITO / CdS / PDA electrode.

[0014] In the above step (1), each cm 2 The surface of the ITO electrode (working area) is loaded with 0.072 mg of CdS nanoparticles.

[0015] Note: In the preparation process of photoanode and photocathode, the area of ​​ITO electrode and the specific amount used in calculation refer to the working area (0.25cm 2 ).

[0016] In step (2), the dopamine concentration in the Tris-HCl solution is 1-15 mM; the reaction temperature is 0-4°C, and the reaction time is 10-60 min. For example, the dopamine concentration in the Tris-HCl solution is 15 mM; the reaction temperature is 0°C, and the reaction time is 10 min; the dopamine concentration in the Tris-HCl solution is 1 mM; the reaction temperature is 0°C, and the reaction time is 60 min; the dopamine concentration in the Tris-HCl solution is 6 mM; the reaction temperature is 4°C, and the reaction time is 20 min; the dopamine concentration in the Tris-HCl solution is 3 mM; the reaction temperature is 4°C, and the reaction time is 30 min, etc.

[0017] More preferably, the concentration of dopamine in the Tris-HCl solution is 3 mM; the reaction temperature is 4° C., and the reaction time is 30 min.

[0018] The preparation method of the ITO / CuInS2 / CS / Apt / MCH electrode is as follows:

[0019] S1. The CuInS2 nanoflowers were dispersed in ultrapure water to obtain a CuInS2 suspension; the CuInS2 suspension was added dropwise to the ITO surface and dried under an infrared lamp to obtain an ITO / CuInS2 photocathode;

[0020] The CuInS2 nanoflowers can be prepared by first dispersing CuCl, InCl3·4H2O, and thiourea in 30 mL of ethylene glycol. Ultrasonic treatment is performed for 30 minutes, followed by transfer to a reactor and reaction at 200°C for 24 hours. After the reaction is completed, the mixture is cooled to room temperature, washed with ultrapure water and anhydrous ethanol, and dried under vacuum at 100°C for 10 hours. The molar ratio of CuCl, InCl3·4H2O, and thiourea is 1:1:4.

[0021] S2. Chitosan solution containing acetic acid was drop-coated on the surface of the ITO / CuInS2 photocathode, and then glutaraldehyde solution was added dropwise after drying, placed in the dark at room temperature and washed;

[0022] The specific steps can be:

[0023] First, 10 μL of 0.1 mg / mL chitosan (CS) solution (containing 1% acetic acid) was drop-coated on the ITO / CuInS2 electrode (working area 0.25 cm 2 ) surface and dried in a 60°C oven to obtain an ITO / CuInS2 / CS electrode. Subsequently, 10 μL of 2.5% glutaraldehyde (GLD) solution was added dropwise to the surface of the ITO / CuInS2 / CS electrode. After standing in the dark at room temperature for 0.5-2 hours, the electrode was washed three times with PBS buffer solution to remove excess GLD.

[0024] S3. Then, the aptamer (Apt) solution was added dropwise, and 10 μL of Apt solution (concentration 0.25-1.25 μM) was modified on the electrode surface. The electrode was incubated at 37°C for 1 hour, and washed with PBS buffer solution after incubation to obtain an ITO / CuInS2 / CS / Apt electrode. Finally, 6-mercaptohexanol (MCH) was added dropwise on the surface of the ITO / CuInS2 / CS / Apt electrode, and the electrode was incubated at room temperature for 10-60 minutes to block nonspecific binding sites. The electrode was then washed with PBS to obtain an ITO / CuInS2 / CS / Apt / MCH electrode.

[0025] More preferably, the concentration of the Apt solution is 1.00 μM.

[0026] In the above step S1, each cm 2 There are 0.08-0.48 mg of CuInS2 nanoflowers on the surface of the ITO electrode working area.

[0027] Further preferably, in the above step S1, each cm 2 There are 0.032 mg of CuInS2 nanoflowers on the surface of the ITO electrode working area.

[0028] The application of the self-powered PEC aptamer sensor in the detection of ciprofloxacin in this application comprises the following steps:

[0029] a. 10 μL of CIP solution of different concentrations was drop-coated on the ITO / CuInS2 / CS / Apt / MCH electrode, incubated at 37°C for 40 min, and then rinsed with PBS.

[0030] b. Photoelectric signal measurement in PBS buffer solution containing 0.05 M ascorbic acid (AA);

[0031] c. Substitute the measured photoelectric signal into the linear regression equation: I(μA)=-0.6824lgC+5.4468(nM)(R 2 =0.9964), and the CIP content in the test solution was obtained.

[0032] The working principle of the present invention is: the present invention is a PEC self-powered aptamer sensor constructed based on CdS / PDA photoanode and CuInS2 photocathode. Under visible light irradiation, the electrons generated by the ITO / CdS / PDA photoanode are driven by the Fermi energy level difference, transmitted to the ITO / CuInS2 photocathode through an external circuit, and captured by the holes of the photocathode. In this sensing system, the introduction of the photoanode is used to amplify the photocurrent signal, while the photocathode is used to construct a sensing interface. The CIP aptamer (Apt) is modified on the surface of the CuInS2 photocathode by chitosan (CS) and glutaraldehyde (GLD). When CIP is present, it can specifically bind to the aptamer, hinder electron transfer through the steric effect, resulting in a decrease in the photocurrent signal, thereby achieving sensitive detection of CIP. The mechanism diagram is shown in FIG. Figure 1 shown.

[0033] The beneficial effects produced by the present invention are:

[0034] (1) The present invention constructs a self-powered PEC aptamer sensor for ciprofloxacin detection based on CdS / PDA photoanode and CuInS2 photocathode. Under visible light irradiation, the electrons generated by the CdS / PDA photoanode are driven by the Fermi energy level difference and transmitted to the CuInS2 photocathode through an external circuit, forming a self-powered system that does not require an external power supply. The photoanode amplifies the photocurrent using the efficient charge transfer ability of CdS / PDA, and the photocathode constructs a sensing interface through the three-dimensional structure of CuInS2 nanoflowers. The ciprofloxacin aptamer is fixed to the surface of the photocathode by chitosan and glutaraldehyde. After the target molecule binds, the electron transfer is hindered by the steric effect, resulting in a decrease in the photocurrent signal, realizing the dual regulation of "photoanode amplification-photocathode response". The dual-electrode system drives electron transfer through a built-in electric field, without the need for an external power supply, thereby improving the convenience and stability of detection.

[0035] (2) This sensing platform exhibits a low detection limit and good selectivity for CIP, providing a new strategy for constructing novel, efficient, self-powered PEC biosensors. The specific binding of the ciprofloxacin aptamer to the target molecule triggers a significant decrease in the photocurrent signal, which is proportional to the concentration of ciprofloxacin, with a linear range of 100fM to 100nM and a detection limit as low as 11.2fM. The sensor has also been successfully applied to the detection of actual samples such as milk, tap water, and lake water. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0037] Figure 1 This is a diagram of the mechanism of the self-powered PEC aptamer sensor for CIP detection according to the present invention.

[0038] Figure 2 (A) SEM and (B) TEM images of CdS; (C) TEM, (D) HRTEM and (E) mapping element scanning images of CdS / PDA.

[0039] Figure 3 (A) XRD spectra and (B) Fourier transform infrared spectra of CdS, PDA and CdS / PDA.

[0040] Figure 4 (AB) SEM images, (C) TEM images and (D) mapping element mapping scan images of CuInS2.

[0041] Figure 5 XRD pattern of CuInS2; high-resolution XPS spectrum of CuInS2: (B) Cu 2p, (C) In 3d and (D) S2p.

[0042] Figure 6 (A) Photocurrent response of ITO / CuInS2 under different conditions (curve a: Pt wire as CE, Ag / AgCl as RE; curve b: ITO / CdS / PDA photoanode as CE / RE); (B) OCP of the constructed self-powered PEC system; (C) polarization curves of ITO / CdS / PDA and (D) ITO / CuInS2; (E) voltage-current curves and (F) power-current curves with Pt wire (a) and ITO / CuInS2 (b) as cathodes and ITO / CdS / PDA as photoanode, respectively.

[0043] Figure 7 (A) Photocurrent response of ITO / CuInS2 under different conditions (curve a: ITO / CdS as photoanode; curve b: ITO / CdS / PDA as photoanode); (B) polarization curve of ITO / CdS; (C) voltage-current curve and (D) power-current curve with ITO / CdS (a) and ITO / CdS / PDA (b) as photoanode and ITO / CuInS2 as photocathode, respectively.

[0044] Figure 8 (A) PEC response curves and (B) EIS spectra of different modified electrodes; among them, ITO / CuInS2 (a), ITO / CuInS2 / CS (b), ITO / CuInS2 / CS / Apt (c), ITO / CuInS2 / CS / Apt / MCH (d), ITO / CuInS2 / CS / Apt / MCH / CIP (e).

[0045] Figure 9 (A) UV-visible diffuse reflectance spectrum and (B) Tauc plot of CuInS2; (C) Mott-Schottky curves of ITO / CuInS2 and (D) ITO / CdS / PDA.

[0046] Figure 10 (A) UV-visible diffuse reflectance spectra of CdS, PDA, and CdS / PDA; (B) Tauc plots of CdS and (C) PDA; (D) Mott-Schottky plots of ITO / CdS and (E) ITO / PDA.

[0047] Figure 11 This is the charge transfer mechanism of the dual photoelectrode system.

[0048] Figure 12 Optimization of (A) CuInS2 drop coating concentration; (B) Apt concentration; (C) CIP incubation time.

[0049] Figure 13 (A) PEC response of the sensor to different concentrations of CIP (ag: 0.0001, 0.001, 0.01, 0.1, 1, 10, 100 nM) (n=3); (B) linear relationship between PEC response and IgC.

[0050] Figure 14 (A) Selectivity of the sensor (n=3); (B) reproducibility of the sensor (CIP: 100 fM); (C) PEC response curves of ITO / CuInS2 (a) and ITO / CuInS2 / CS / Apt / MCH / CIP (b) under multiple on / off illumination cycles; (D) long-term storage stability of the sensor. DETAILED DESCRIPTION

[0051] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without creative work are within the scope of protection of the present invention.

[0052] The reagents used in this application are detailed in Table 1. All reagents were obtained from commercial suppliers without additional purification.

[0053] Table 1

[0054]

[0055] The CIP aptamer (Apt) used was purchased from Shanghai Bioengineering Co., Ltd. The Apt sequence is as follows: 5′-NH2-(CH2)6-ATACC AGCTT ATTCA ATTGC AGGGT ATCTG AGGCT TGATC TACTA AATGT CGTGG GGCATTGCTA TTGGC GTTGA TACGT ACAAT CGTAATCAGT TAG-3′.

[0056] The 100 μM ciprofloxacin aptamer (Apt) was prepared by dispersing the ciprofloxacin aptamer in 0.1 M phosphate buffer (PBS, pH 7.40). Upon use, the ciprofloxacin aptamer was added to different volumes of 0.1 M phosphate buffer to obtain final concentrations of 0.25 μM, 0.5 μM, 0.75 μM, 1 μM, and 1.25 μM, respectively.

[0057] CIP solution: Dilute 1 μM CIP solution directly to 100 nM with PBS solution, and then perform a stepwise 10-fold dilution to generate all target concentrations (from 100 nM to 0.0001 nM).

[0058] The main instruments and equipment used in this application are listed in Table 2

[0059] Table 2

[0060]

[0061]

[0062] Example 1

[0063] The method for constructing the self-powered PEC aptamer sensor of this embodiment comprises the following steps:

[0064] 1. Preparation of ITO / CdS / PDA Photoanode

[0065] a. Dissolve 3.2 mmol of Cd(NO₃)₂·4H₂O and 16 mmol of Na₂S·9H₂O in 40 mL of ultrapure water. After stirring at room temperature for 30 minutes, transfer the resulting suspension to a 100 mL reactor and react at 140°C for 5 hours. After cooling, wash the product several times with ultrapure water and ethanol, and dry it in a vacuum oven at 60°C for 12 hours to produce CdS particles.

[0066] b. First, an ITO electrode (0.5 × 4 cm) was ultrasonically cleaned with anhydrous ethanol and ultrapure water for 15 min, followed by drying at 60°C. 18 μL of a 1.0 mg / mL CdS suspension (CdS nanoparticles dispersed in ultrapure water) was drop-coated on the surface of the ITO electrode (working area: 0.25 cm). 2 ) and dried under an infrared lamp to obtain an ITO / CdS electrode. The prepared CdS / ITO electrode was then placed in a Tris-HCl solution (10 mM, pH 8.50) containing 3.0 mM dopamine and reacted at 4°C for 30 minutes. During this process, dopamine self-polymerized to form polydopamine. Due to its strong adhesive properties, polydopamine adhered firmly to the surface of the ITO / CdS electrode, thus obtaining an ITO / CdS / PDA electrode.

[0067] The microstructure of CdS and CdS / PDA composites was studied by SEM and TEM. Figure 2 As shown in AB, CdS presents a nanoparticle structure. After the introduction of PDA, the edges of the CdS nanoparticles become blurred and the surface is covered by a clear thin film ( Figure 2 C). In the HRTEM image of CdS / PDA ( Figure 2 D) The lattice spacing of 0.336 nm is attributed to the (002) plane of CdS. The region outlined by the solid yellow line represents the PDA layer. Lattice fringes are not visible in this region because PDA, as an organic polymer, does not typically exhibit such features. Figure 2 The elemental mapping results of E showed the presence of N, a characteristic element of PDA, confirming the successful introduction of PDA. Furthermore, the uniform distribution of Cd, S, C, N, and O elements in the CdS / PDA composite material was consistent with the XPS analysis results, further verifying the successful preparation of the CdS / PDA composite material.

[0068] The crystal structures of the prepared CdS, PDA and CdS / PDA composite materials were characterized by XRD. Figure 3As shown in Figure A, the diffraction peaks of the ITO substrate (curve a) are clearly visible, while after PDA modification (curve b), no new diffraction peaks appear, indicating that PDA has an amorphous structure. In the XRD spectrum of CdS (curve c), the 2θ values ​​are located at 24.8°, 26.5°, 36.6°, 43.7°, 50.9° and 51.8°, respectively, corresponding to the (100), (002), (102), (110), (200) and (112) crystal planes of CdS (PDF no.41-1049), indicating that the synthesized CdS has good crystallinity. After further loading PDA on ITO / CdS (curve d), no other new diffraction peaks are observed, further proving that PDA has an amorphous structure and also indicating that the loading of PDA has no effect on the crystal structure of CdS. Figure 3 As can be seen in B, in the spectrum of CdS, around 3500 cm -1 The broad absorption peak at 1509 cm is attributed to the adsorbed water, while no obvious characteristic absorption peaks are observed in the other bands. In contrast, the characteristic absorption peaks of PDA are clearly seen in the spectrum of CdS / PDA composite materials, including the characteristic absorption peaks at 1509 cm -1 and 1627cm -1 The peak at 2800-3600 cm -1 The broad absorption peaks in the range are derived from the stretching vibrations of amino and hydroxyl groups. These results demonstrate the successful preparation of CdS / PDA composites.

[0069] 2. Preparation of ITO / CuInS2 Photocathode

[0070] a. First, 0.089g of CuCl, 0.264g of InCl3·4H2O, and 0.274g of thiourea were dispersed in 30mL of ethylene glycol. After ultrasonic treatment for 30 minutes, the mixture was transferred to a reactor and reacted at 200°C for 24 hours. After completion of the reaction, the mixture was naturally cooled to room temperature, washed with ultrapure water and anhydrous ethanol, and dried under vacuum at 100°C for 10 hours to produce CuInS2.

[0071] b. Disperse 4 mg of CuInS2 in 1 mL of ultrapure water and ultrasonicate to obtain a uniform suspension. Add 20 μL of CuInS2 suspension dropwise to a clean ITO surface (working area: 0.25 cm 2 ), dried under an infrared lamp to obtain an ITO / CuInS2 photocathode.

[0072] As can be seen from 4A-C, CuInS2 is a three-dimensional flower-like structure composed of nanosheets with a relatively smooth surface. This unique three-dimensional structure provides a large specific surface area and has a strong light capture efficiency, which helps to improve the performance of photoelectrochemical sensors. Figure 4 D), it can be seen that Cu, In and S elements are evenly distributed in the material.

[0073] from Figure 5 A shows that the characteristic diffraction peaks at 27.9°, 32.4°, 46.3°, 55.1° and 74.6° correspond to the (112), (013), (024), (132) and (136) crystal planes of CuInS2 (PDF no.47-1372), respectively, and no other peaks are observed, indicating that high-purity CuInS2 has been successfully prepared. The chemical valence states of Cu, In and S elements in CuInS2 were further studied by XPS. Figure 5 As can be seen in Figure B, the two peaks at 951.7 and 931.9 eV correspond to Cu + 2p 1 / 2 and 2p 3 / 2 orbital. At the same time, a Cu 2+ The satellite peaks indicate that Cu + Slightly oxidized. Figure 5 C is the high-resolution XPS spectrum of In3d. The characteristic peaks at 451.9 eV and 444.3 eV correspond to In 3+ 3D 3 / 2 and 3D 5 / 2 orbital, indicating that the main valence state of In in CuInS2 is +3. In the S2p spectrum ( Figure 5 D), the characteristic absorption peaks at 162.6eV and 161.3eV are attributed to S2p 1 / 2 and S2p 3 / 2 The XPS analysis results further verified the successful preparation of CuInS2.

[0074] 3. Construction of PEC aptamer sensing platform

[0075] First, 10 μL of 0.1 mg / mL chitosan (CS) solution (containing 1% acetic acid) was drop-coated on the surface of the ITO / CuInS2 electrode and dried in an oven at 60°C to obtain an ITO / CuInS2 / CS electrode. Subsequently, 10 μL of 2.5% glutaraldehyde (GLD) solution was added to the surface of the ITO / CuInS2 / CS electrode. After being placed in the dark at room temperature for 1 hour, the electrode was washed three times with PBS buffer solution to remove excess GLD. Next, 10 μL of Apt solution (1 μM) was modified on the electrode surface, incubated at 37°C for 1 hour, and washed with PBS buffer solution after incubation to obtain an ITO / CuInS2 / CS / Apt electrode. Then, 10 μL of MCH was added to the electrode surface and incubated at room temperature for 30 minutes to block nonspecific binding sites. The electrode was then washed with PBS to obtain an ITO / CuInS2 / CS / Apt / MCH electrode.

[0076] Examples 2-6

[0077] The methods for constructing the self-powered PEC aptasensors of Examples 2-6 differ from those of Example 1 in that sensors with different CuInS2 droplet coating concentrations (1 mg / mL, 2 mg / mL, 3 mg / mL, 5 mg / mL, and 6 mg / mL) were prepared. The remaining steps were the same, and the specific variables are shown in Table 3. The steps are as follows:

[0078] (1) Preparation of ITO / CdS / PDA photoanode

[0079] a. Dissolve 3.2 mmol of Cd(NO₃)₂·4H₂O and 16 mmol of Na₂S·9H₂O in 40 mL of ultrapure water. After stirring at room temperature for 30 minutes, transfer the resulting suspension to a 100 mL reactor and react at 140°C for 5 hours. After cooling, wash the product several times with ultrapure water and ethanol, and dry it in a vacuum oven at 60°C for 12 hours to produce CdS particles.

[0080] b. First, an ITO electrode (0.5 × 4 cm) was ultrasonically cleaned with anhydrous ethanol and then ultrapure water for 15 min, and then dried at 60°C. 18 μL of a 1.0 mg / mL CdS suspension (CdS particles dispersed in water) was drop-coated on the surface of the ITO electrode (working area: 0.25 cm). 2) and dried under an infrared lamp to obtain an ITO / CdS electrode. The prepared CdS / ITO electrode was then placed in a Tris-HCl solution (10 mM, pH 8.50) containing 3.0 mM dopamine and reacted at 4°C for 30 minutes. During this process, dopamine self-polymerized to form polydopamine. Due to its strong adhesive properties, polydopamine adhered firmly to the surface of the ITO / CdS electrode, thus obtaining an ITO / CdS / PDA electrode.

[0081] (2) Preparation of ITO / CuInS2 photocathode

[0082] a. First, 0.089g of CuCl, 0.264g of InCl3·4H2O, and 0.274g of thiourea were dispersed in 30mL of ethylene glycol. After ultrasonic treatment for 30 minutes, the mixture was transferred to a reactor and reacted at 200°C for 24 hours. After completion of the reaction, the mixture was naturally cooled to room temperature, washed with ultrapure water and anhydrous ethanol, and dried under vacuum at 100°C for 10 hours to produce CuInS2.

[0083] b. Disperse 1 mg, 2 mg, 3 mg, 5 mg, or 6 mg of CuInS2 in 1 mL of ultrapure water and ultrasonicate to obtain a uniform suspension. Add 20 μL of the CuInS2 suspension dropwise onto a clean ITO surface (working area: 0.25 cm 2 ), dried under an infrared lamp to obtain a series of ITO / CuInS2 photocathodes.

[0084] (3) Construction of PEC aptamer sensing platform

[0085] First, 10 μL of 0.1 mg / mL chitosan (CS) solution (containing 1% acetic acid) was drop-coated on the surface of different ITO / CuInS2 electrodes and dried in a 60°C oven to obtain ITO / CuInS2 / CS electrodes. Subsequently, 10 μL of 2.5% glutaraldehyde (GLD) solution was added to the surface of the ITO / CuInS2 / CS electrode. After being placed in the dark at room temperature for 1 hour, the electrode was washed three times with PBS buffer solution to remove excess GLD. Next, 10 μL of Apt solution (1 μM) was modified on the electrode surface, incubated at 37°C for 1 hour, and washed with PBS buffer solution after incubation to obtain ITO / CuInS2 / CS / Apt electrodes. Then, 10 μL of MCH was added to the electrode surface and incubated at room temperature for 30 minutes to block nonspecific binding sites. Subsequently, it was washed with PBS to obtain ITO / CuInS2 / CS / Apt / MCH electrodes.

[0086] Table 3

[0087]

[0088] Examples 7-10

[0089] The methods for constructing the self-powered PEC aptamer sensors of Examples 7-10 differ from those of Example 1 in that sensors with different concentrations of Apt (0.25 μM, 0.5 μM, 0.75 μM, and 1.25 μM) were prepared. The remaining steps were the same, and the specific variables are shown in Table 4. The steps are as follows:

[0090] (1) Preparation of ITO / CdS / PDA photoanode

[0091] a. Dissolve 3.2 mmol of Cd(NO₃)₂·4H₂O and 16 mmol of Na₂S·9H₂O in 40 mL of ultrapure water. After stirring at room temperature for 30 minutes, transfer the resulting suspension to a 100 mL reactor and react at 140°C for 5 hours. After cooling, wash the product several times with ultrapure water and ethanol, and dry it in a vacuum oven at 60°C for 12 hours to produce CdS particles.

[0092] b. First, an ITO electrode (0.5 × 4 cm) was ultrasonically cleaned with anhydrous ethanol and then ultrapure water for 15 min, and then dried at 60°C. 18 μL of a 1.0 mg / mL CdS suspension (CdS particles dispersed in water) was drop-coated on the surface of the ITO electrode (working area: 0.25 cm). 2 ) and dried under an infrared lamp to obtain an ITO / CdS electrode. The prepared CdS / ITO electrode was then placed in a Tris-HCl solution (10 mM, pH 8.50) containing 3.0 mM dopamine and reacted at 4°C for 30 minutes. During this process, dopamine self-polymerized to form polydopamine. Due to its strong adhesive properties, polydopamine adhered firmly to the surface of the ITO / CdS electrode, thus obtaining an ITO / CdS / PDA electrode.

[0093] (2) Preparation of ITO / CuInS2 photocathode

[0094] a. First, 0.089g of CuCl, 0.264g of InCl3·4H2O, and 0.274g of thiourea were dispersed in 30mL of ethylene glycol. After ultrasonic treatment for 30 minutes, the mixture was transferred to a reactor and reacted at 200°C for 24 hours. After completion of the reaction, the mixture was naturally cooled to room temperature, washed with ultrapure water and anhydrous ethanol, and dried under vacuum at 100°C for 10 hours to produce CuInS2.

[0095] b. Disperse 4 mg of CuInS2 in 1 mL of ultrapure water and ultrasonicate to obtain a uniform suspension. Add 20 μL of CuInS2 suspension dropwise to a clean ITO surface (working area: 0.25 cm 2), dried under an infrared lamp to obtain an ITO / CuInS2 photocathode.

[0096] (3) Construction of PEC aptamer sensing platform

[0097] First, 10 μL of 0.1 mg / mL chitosan (CS) solution (containing 1% acetic acid) was drop-coated on the surface of the ITO / CuInS2 electrode and dried in an oven at 60°C to obtain an ITO / CuInS2 / CS electrode. Subsequently, 10 μL of 2.5% glutaraldehyde (GLD) solution was added to the surface of the ITO / CuInS2 / CS electrode. After being placed in the dark at room temperature for 1 hour, the electrode was washed three times with PBS buffer solution to remove excess GLD. 10 μL of Apt solution (concentrations of 0.25 μM, 0.5 μM, 0.75 μM or 1.25 μM) was modified on the surface of a series of electrodes, incubated at 37°C for 1 hour, and washed with PBS buffer solution after incubation to obtain an ITO / CuInS2 / CS / Apt electrode. Then, 10 μL of MCH was added to the electrode surface and incubated at room temperature for 30 min to block nonspecific binding sites, followed by washing with PBS to obtain an ITO / CuInS2 / CS / Apt / MCH electrode.

[0098] Table 4

[0099]

[0100] To investigate the feasibility of the sensor, we investigated the feasibility of the dual photoelectrode and measured the photoelectric signal and EIS during the fabrication of the sensing platform. The performance of the materials, electrodes, and PEC aptamer sensor prepared in Example 1 was investigated as follows:

[0101] (1) Feasibility study of dual photoelectrodes

[0102] First, the photoelectric performance of the dual photoelectrode system was evaluated by measuring the photocurrent of CuInS2. The photoelectric performance measurements were performed on an RST5000 electrochemical workstation with the electrolyte being a PBS (pH 7.40, 0.10 M) buffer solution containing 0.05 M AA. Figure 6As shown in Figure A, using a Pt wire as the counter electrode (CE) and Ag / AgCl as the reference electrode (RE), the photocurrent of ITO / CuInS2 is 2.65 μA (curve a). When an ITO / CdS / PDA photoanode and an ITO / CuInS2 photocathode are integrated to form a self-powered system, with the ITO / CdS / PDA photoanode serving as the counter and reference electrodes and the ITO / CuInS2 photocathode serving as the working electrode, the CuInS2 photocurrent significantly increases to 17.20 μA (curve b), 6.8 times that of the CuInS2 / Pt system, demonstrating the excellent photoelectric performance of this system.

[0103] To further investigate the effect of illumination on the dual-photoelectrode system, the open-circuit voltage (OCP) of a self-powered sensor constructed with an ITO / CdS / PDA photoanode and an ITO / CuInS2 photocathode was measured. OCP measurements were performed on an RST5000 electrochemical workstation using a PBS (pH 7.40, 0.10 M) buffer solution containing 0.05 M AA as the electrolyte. Figure 6 Figure B shows that under light conditions, the OCP signal rapidly increased from 0.11V to 0.34V. After 80s, when the xenon lamp was turned off, the OCP quickly returned to the baseline. This demonstrates that the dual-photoelectrode system, driven by a light source, can effectively promote electron transfer between the two photoelectrodes without an external voltage, thereby significantly improving power generation.

[0104] In order to investigate the thermodynamic feasibility of the dual photoelectrode system, the polarization curves of the photoanode ITO / CdS / PDA and the photocathode ITO / CuInS2 were measured in 0.1M PBS (pH 7.40) solution. The polarization curve measurements were performed on an RST5000 electrochemical workstation, and the electrolyte was PBS (pH 7.40, 0.10M) buffer solution. Figure 6 It can be seen from C that the initial oxidation potential of ITO / CdS / PDA under light is about -0.35V, while the initial reduction potential of ITO / CuInS2 is 0.26V ( Figure 6 D). Obviously, the initial reduction potential of the photocathode is higher than the initial oxidation potential of the photoanode, indicating that the self-energy system is thermodynamically feasible.

[0105] In order to evaluate the output performance of the single photoelectrode and the dual photoelectrode, their voltage-current (UI) curves were tested and the corresponding power-current (PI) curves were calculated. The UI curve measurements were performed on an RST5000 electrochemical workstation, and the electrolyte was a PBS (pH 7.40, 0.10M) buffer solution containing 0.05M AA. Figure 6As shown in Figure E, when ITO / CuInS2 is used as the photocathode, its output voltage (curve b) is significantly higher than that when Pt is used as the cathode (curve a). Figure 6 F further shows that the maximum output power density of the dual-photoelectrode PEC sensing platform constructed with ITO / CdS / PDA photoanode and ITO / CuInS2 photocathode is 2.47 μW / cm 2 (curve b) is a traditional Pt-based PEC platform (1.12 μW / cm 2 , 2.2 times that of curve a). Therefore, ITO / CuInS2 can effectively replace Pt as the cathode to construct a dual photoelectrode system and improve the output performance of the sensor.

[0106] In addition, the performance of dual-photoelectrode self-powered sensors was further compared when ITO / CdS and ITO / CdS / PDA were used as photoanodes. Figure 7 Figure A shows the photocurrent signals of an ITO / CuInS2 photocathode using ITO / CdS and ITO / CdS / PDA as photoanodes. Compared to the ITO / CdS photoanode (curve a), the ITO / CdS / PDA photoanode (curve b) exhibits stronger signal amplification for ITO / CuInS2. This is likely due to the enhanced separation efficiency of photogenerated electron-hole pairs due to the recombination of CdS and PDA.

[0107] Figure 7 B is the polarization curve of ITO / CdS photoanode, and its initial oxidation potential is -0.25 V. Figure 7 CD analysis shows that the initial potential difference between ITO / CdS / PDA photoanode and ITO / CuInS2 photocathode is greater than the initial potential difference between ITO / CdS and ITO / CuInS2, which indicates that ITO / CdS / PDA is more suitable than ITO / CdS to be combined with ITO / CuInS2 to construct a dual photoelectrode system.

[0108] Under the same test conditions, the output performance of single CdS and composite material CdS / PDA as photoanode was compared. Figure 7 Figures CD show the UI and PI curves of a PEC platform using ITO / CdS (curve a) and ITO / CdS / PDA (curve b) as photoanodes and ITO / CuInS2 as photocathodes. The results show that the output voltage and maximum output power density of the ITO / CdS / PDA photoanode are significantly improved compared to those of ITO / CdS. This result further validates the superior performance of the ITO / CdS / PDA photoanode and demonstrates that its combination with the ITO / CuInS2 photocathode can construct a more efficient self-powered PEC sensing platform.

[0109] (2) Research on CIP detection using sensing platform

[0110] The PEC response and EIS changes during the construction of the sensing interface were compared and analyzed. PEC measurements were performed on an RST-5000 electrochemical workstation. Different modified electrodes in Example 1 (ITO / CuInS2 photocathode, ITO / CuInS2 / CS, ITO / CuInS2 / CS / Apt, ITO / CuInS2 / CS / Apt / MCH, ITO / CuInS2 / CS / Apt / MCH / CIP (10 μL, 1 nM CIP incubated for 40 min) were used as working electrodes, and ITO / CdS / PDA photoanode was used as counter electrode and reference electrode. The bias voltage was 0 V, and the electrolyte was PBS (pH 7.40, 0.10 M) buffer solution containing 0.05 M AA. Electrochemical impedance spectroscopy (EIS) measurements were performed in 5 mM [Fe(CN)6] containing 0.1 M KCl. 3- / 4- The amplitude was set to 10 mV and the frequency range was 0.1 Hz to 10 kHz. Figure 8 As shown. The ITO / CuInS2 electrode shows a higher photocurrent (curve a, Figure 8 A). After modification of CS, the photocurrent intensity decreased due to its lower conductivity (curve b). As Apt and MCH were gradually modified, the steric hindrance on the electrode surface increased, further hindering electron transfer, resulting in a gradual decrease in the photocurrent (curve cd). When the target CIP was specifically recognized and captured by its aptamer, the photocurrent decreased significantly (curve e). This is because CIP combined with Apt to form a bioconjugate, which further increased the steric hindrance effect on the electrode surface, resulting in obstruction of electron transfer on the sensing interface. The EIS results further verified the successful construction of the sensor. Compared with the ITO / CuInS2 electrode (curve a, Figure 8 B), after the introduction of CS (curve b), the charge transfer impedance (R ct ) increased significantly. Subsequently, after Apt and MCH were fixed on the electrode surface in sequence, R ct After incubation with the target molecule CIP, the steric hindrance on the electrode surface further increases, which further hinders the charge transfer and leads to R ct The above PEC and EIS analysis results both confirmed the successful construction of the self-powered PEC sensing platform.

[0111] (3) Research on PEC sensing mechanism

[0112] In order to explore the working mechanism of self-powered PEC sensors, the energy band structures of CdS / PDA photoanode and CuInS2 photocathode were studied. g ) by UV-visible diffuse reflectance spectroscopy ( Figure 9 A) and Tauc curve ( Figure 9 B) was determined, and the calculated results showed that its band gap was 1.80eV. In order to further analyze the semiconductor type and band structure, the Mott-Schottky curve test was performed on CuInS2 ( Figure 9 C). The results show that the flat band potential (E FB ) is 1.18V (vs. Ag / AgCl equivalent to 1.38V vs NHE). In addition, the slope of the Mott-Schottky curve of CuInS2 is negative, indicating that CuInS2 is a p-type semiconductor and its valence band potential (E VB ) is close to the flat band potential. VB is 1.38V (vs. NHE). According to formula E CB =E VB –E g , the conduction band potential of CuInS2 (E CB ) is -0.42V (vs. NHE). CB and E VB are -0.60V and 1.82V (vs. NHE), respectively, while the E CB and E VB -0.78V and 0.61V (vs. NHE) Figure 10 ).like Figure 9 As shown in D, the flat band potential E of CdS / PDA is obtained by Mott-Schottky curve test of CdS / PDA. FB The optical absorption characteristics of CdS, PDA and CdS / PDA composites were studied by UV-Vis DRS. Figure 10 As shown in Figure A, CdS has a clear absorption edge at 487nm, while PDA exhibits strong absorption across the entire spectral range. Compared to CdS alone, the PDA-modified CdS / PDA composite material exhibits stronger light absorption in the range of 200-800nm, especially in the visible light region. This indicates that the composite of CdS and PDA can significantly enhance the absorption of CdS in the visible light range, thereby improving its photoelectric activity. Using DRS data to fit the Tauc plot ( Figure 10BC), the calculated band gap of CdS is 2.42eV and the band gap of PDA is 1.39eV. According to the Mott-Schottky curve ( Figure 10 D) shows that the flat band potential of CdS is -0.80V (vs.Ag / AgCl). The band structure of PDA can also be obtained by Mott-Schottky curve test, such as Figure 10 As shown in E, the flat band potential of PDA is -0.98V (vs.Ag / AgCl). The slopes of the Mott-Schottky curves of CdS and PDA are both positive, indicating that they have n-type semiconductor properties. Their conduction band potential (E CB ) is close to the flat band potential. Therefore, the E CB are -0.80 V and -0.98 V (vs. Ag / AgCl), corresponding to -0.60 V and -0.78 V (vs. NHE). By substituting E VB =E CB +E g , the valence band (VB) of CdS and PDA are calculated to be 1.82V and 0.61V (vs. NHE) respectively. CdS and PDA both exhibit n-type semiconductor characteristics, so the E of CdS / PDA is FB Close to CB, its conduction band potential (E CB ) was finally determined to be -0.65V (vs. NHE).

[0113] Therefore, the charge transfer mechanism of the self-powered PEC system constructed by CdS / PDA photoanode and CuInS2 photocathode is as follows Figure 11 As shown. Under light, both the photoanode and the photocathode are excited to produce photogenerated electron-hole pairs. At the photoanode, due to the E CB and E VB are more negative than CdS, and the photogenerated holes (h + ) migrate to the VB of PDA and are then reduced by the electron donor (AA) in the electrolyte. At the same time, the photogenerated electrons (e - ) migrates to the CB of CdS and then migrates to the surface of the ITO electrode. Due to the Fermi level difference between the CdS / PDA photoanode and the CuInS2 photocathode, electrons can be efficiently transferred to the photocathode through an external circuit. At the photocathode, the photogenerated electrons on the CB of CuInS2 are absorbed by the dissolved oxygen (O2) in the electrolyte, while the holes on the VB combine with electrons injected through the external circuit. This process effectively suppresses the recombination of photogenerated electrons and holes in the photocathode, amplifies the photocurrent signal of the photocathode, and significantly enhances the PEC response of the sensing system.

[0114] (4) Condition optimization

[0115] To achieve ideal PEC sensing performance for the constructed sensor, the detection conditions were optimized. The CuInS2 droplet concentration (Example 1 and Examples 2-6), the Apt concentration (Example 1 and Examples 7-10), and the CIP incubation time were optimized. The specific process is as follows:

[0116] The ITO / CuInS2 photocathodes prepared in step 2 of Example 1 and Example 2-6 were tested. Photoelectrochemical measurements were performed on an RST 5000 electrochemical workstation, with the ITO / CuInS2 photocathode as the working electrode and the ITO / CdS / PDA photoanode as the counter electrode and reference electrode. The bias voltage was set to 0 V, and the electrolyte was a PBS (pH 7.40, 0.10 M) buffer solution containing 0.05 M AA. The results are shown in Figure 2. Figure 12 Figure A shows the photocurrent intensity as the CuInS2 drop-coating concentration increases. As the concentration increases from 1 mg / mL to 4 mg / mL, the photocurrent gradually increases. However, further increasing the concentration leads to a decrease in the photocurrent, likely due to the obstruction of electron transport caused by excessive CuInS2 accumulation. Therefore, 4 mg / mL was determined to be the optimal CuInS2 drop-coating concentration.

[0117] The ITO / CuInS2 / CS / Apt / MCH photocathodes prepared in step 3 of Example 1 and Examples 7-10 were tested. Photoelectrochemical measurements were performed on an RST 5000 electrochemical workstation, with the ITO / CuInS2 / CS / Apt / MCH photocathodes as working electrodes and the ITO / CdS / PDA photoanodes as counter and reference electrodes. The bias voltage was set to 0 V, and the electrolyte was a PBS (pH 7.40, 0.10 M) buffer solution containing 0.05 MAA. The concentration of Apt was optimized, and the results are shown in Figure 2. Figure 12 As shown in Figure B, as the Apt concentration increases from 0.25 μM to 1.00 μM, the photocurrent gradually decreases and stabilizes at 1.00 μM, indicating that Apt modification of the electrode surface is close to saturation. Therefore, 1.00 μM was selected as the optimal Apt concentration.

[0118] Finally, CIP solution was added dropwise to the surface of the TO / CuInS2 / CS / Apt / MCH electrode prepared in Example 1. The specific preparation process of TO / CuInS2 / CS / Apt / MCH / CIP was as follows:

[0119] a. 10 μL of CIP solution of different concentrations (1 nM) was drop-coated on the ITO / CuInS2 / CS / Apt / MCH electrode, incubated at 37°C for 10-60 min, and then rinsed with PBS.

[0120] b. Photoelectric signal measurement was performed in a PBS buffer solution containing 0.05 M AA.

[0121] The testing process is as follows:

[0122] Photoelectrochemical measurements were performed on an RST 5000 electrochemical workstation using an ITO / CuInS2 / CS / Apt / MCH / CIP photocathode as the working electrode and an ITO / CdS / PDA photoanode as the counter and reference electrodes. The bias voltage was set to 0 V, and the electrolyte was PBS (pH 7.40, 0.10 M) buffer solution containing 0.05 M AA. The effect of CIP incubation time on the photocurrent is shown in Figure 2. Figure 12 As shown in Figure 3C, the photocurrent decreases with increasing incubation time and stabilizes at 40 min, indicating that the binding of CIP to its aptamer has reached saturation. Therefore, 40 min was selected as the optimal incubation time for CIP.

[0123] Implementation effect example 1: Quantitative analysis of ciprofloxacin

[0124] Under the optimal experimental conditions (CuInS2 drop coating concentration of 4 mg / mL, Apt concentration of 1.00 μM, and CIP incubation time of 40 minutes), the photocurrent response under different CIP concentrations was studied. 10 μL of CIP solution of different concentrations was drop coated on the ITO / CuInS2 / CS / Apt / MCH electrode and incubated at 37°C for 40 minutes. The electrode was then rinsed with PBS to remove physically adsorbed CIP. The specific process is as follows:

[0125] The application of the self-powered PEC aptamer sensor for detecting ciprofloxacin is as follows:

[0126] a. 10 μL of CIP solution of different concentrations was drop-coated on the ITO / CuInS2 / CS / Apt / MCH electrode, incubated at 37°C for 40 min, and then rinsed with PBS.

[0127] b. Photoelectric signal measurement was performed in a PBS buffer solution containing 0.05 M AA.

[0128] Photoelectrochemical measurement conditions: Photoelectrochemical tests were performed on an RST 5000 electrochemical workstation, with an ITO / CuInS2 / CS / Apt / MCH / CIP photocathode as the working electrode, an ITO / CdS / PDA photoanode as the counter electrode and reference electrode, a bias voltage of 0 V, and an electrolyte of PBS (pH 7.40, 0.10 M) containing 0.05 M AA. Figure 13 shown. Figure 13 As shown in A, as the concentration increases, the photoelectric response gradually decreases. Figure 13In B, the photocurrent intensity and the logarithm of the CIP concentration show a good linear correlation in the range of 100fM to 100nM, and the linear equation is I(μA)=-0.6824lgC+5.4468(nM)(R 2 =0.9964), and the limit of detection (LOD) was as low as 11.2 fM (S / N=3).

[0129] Implementation effect example 2: Selectivity, reproducibility and stability investigation

[0130] In order to evaluate the selectivity of the sensor (Example 1), enrofloxacin (ENR), ofloxacin (OFL), norfloxacin (NOR), tetracycline (TET), streptomycin (STR), K + Mg 2+ 、Cu 2+ and Fe 3+ As interfering substances, the concentration was 100nM, 10μL, and three parallel experiments were performed. Specific test process: The test was carried out on an RST 5000 electrochemical workstation, with ITO / CuInS2 / CS / Apt / MCH / interfering substance photocathode as the working electrode and ITO / CdS / PDA photoanode as the counter electrode and reference electrode. The bias was set to 0V, and the electrolyte was PBS (pH 7.40, 0.10M) buffer solution containing 0.05M AA. Figure 14 As shown in Figure A, compared with 1 nM CIP, all interfering substances did not cause obvious photocurrent changes, indicating that the PEC aptasensor has good selectivity for CIP.

[0131] Under the same experimental conditions, five ITO / CuInS2 / CS / Apt / MCH electrodes were prepared in parallel to evaluate the reproducibility of the sensor. Figure 14 B shows that when detecting 100 fM CIP, the RSD of the photocurrent response is 2.9%, indicating that the sensor has excellent reproducibility.

[0132] Figure 14 C is the stability test result of the sensor under visible light on / off irradiation. After multiple on / off cycles, the photocurrent changes of ITO / CuInS2 (curve a) and ITO / CuInS2 / CS / Apt / MCH / CIP (curve b) were minimal, with RSDs of 1.4% and 2.0%, respectively, indicating that the sensor has excellent stability. To evaluate the long-term storage stability of the sensor, the ITO / CuInS2 / CS / Apt / MCH / CIP electrode was stored at 4°C. After two weeks, the photocurrent response still maintained 93.5% of the initial value (14D), indicating that the long-term storage stability of the sensor is good.

[0133] Application example: actual sample analysis

[0134] The practicality of a sensor is also an important indicator for evaluating its performance. To this end, the PEC aptamer sensor prepared in Example 1 was used to analyze milk, tap water, and lake water samples to verify its practical application. The spike-in recovery method was used to add 0.01 nM, 1.00 nM, and 100.00 nM of CIP to the samples, respectively. The results are shown in Table 5.

[0135] Table 5. Detection of CIP in actual samples (n=3)

[0136]

[0137] The experimental results in Table 5 show that no CIP was detected in the actual samples, the recovery rate ranged from 97.8% to 104.4%, and the relative standard deviation (RSD) was between 1.7% and 5.8%, indicating that the sensor has good feasibility and accuracy in the analysis of actual samples.

[0138] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A self-powered PEC aptamer sensor, characterized in that: It includes an ITO / CdS / PDA photoanode, an ITO / CuInS2 photocathode and an aptamer assembled on the ITO / CuInS2 photocathode; the ITO / CdS / PDA photoanode includes an ITO electrode, the surface of which is CdS nanoparticles adhered with polydopamine; the ITO / CuInS2 photocathode includes an ITO electrode, the surface of which is loaded with CuInS2 nanoflowers; and the CuInS2 nanoflowers are assembled with an aptamer.

2. The self-powered PEC aptamer sensor according to claim 1, characterized in that: The aptamer is a ciprofloxacin aptamer.

3. The method for constructing the self-powered PEC aptamer sensor according to claim 1 or 2, characterized in that: The steps are as follows: assemble the aptamer on the ITO / CuInS2 photocathode to make an ITO / CuInS2 / CS / Apt / MCH electrode, and then form a self-powered PEC aptamer sensor with the ITO / CdS / PDA photoanode; The preparation method of the ITO / CdS / PDA photoanode is as follows: (1) CdS nanoparticles are dispersed in a solvent, and the resulting CdS suspension is dropwise coated on the surface of an ITO electrode and dried under an infrared lamp to obtain an ITO / CdS electrode. (2) The ITO / CdS electrode is placed in a Tris-HCl solution containing dopamine to react, thereby obtaining an ITO / CdS / PDA photoanode.

4. The method for constructing a self-powered PEC aptamer sensor according to claim 3, characterized in that: The solvent in step (1) is ultrapure water; 2 The surface of the ITO electrode is loaded with 0.072 mg of CdS nanoparticles.

5. The method for constructing a self-powered PEC aptamer sensor according to claim 4, characterized in that: In step (2), the concentration of dopamine in the Tris-HCl solution is 1-15 mM; the reaction temperature is 0-4°C, and the reaction time is 10-60 min.

6. The method for constructing a self-powered PEC aptamer sensor according to claim 3, characterized in that: The preparation method of the ITO / CuInS2 / CS / Apt / MCH electrode is as follows: S1. The CuInS2 nanoflowers were dispersed in ultrapure water to prepare a CuInS2 suspension; S2. The CuInS2 suspension was added dropwise to the pretreated ITO electrode surface and dried under an infrared lamp to obtain an ITO / CuInS2 photocathode; S3. Chitosan solution containing acetic acid was dropwise coated on the surface of the ITO / CuInS2 photocathode, and then glutaraldehyde solution was added dropwise after drying, placed in the dark at room temperature and washed; S4. The aptamer solution was added dropwise to the electrode surface treated in step S3, incubated at 37°C, and then washed with PBS buffer solution to obtain an ITO / CuInS2 / CS / Apt electrode; S5. Add 6-mercapto-1-hexanol to the surface of the ITO / CuInS2 / CS / Apt electrode and incubate at room temperature for 10-60 min to block nonspecific active sites. After washing with PBS buffer solution, the ITO / CuInS2 / CS / Apt / MCH electrode was obtained.

7. The method for constructing a self-powered PEC aptamer sensor according to claim 6, characterized in that: The pretreatment in step S2 refers to ultrasonic cleaning of the ITO electrode with acetone, ethanol and ultrapure water respectively; 2 There are 0.08-0.48 mg of CuInS2 nanoflowers on the surface of the ITO electrode.

8. The method for constructing a self-powered PEC aptamer sensor according to claim 7, characterized in that: In step S3, each cm 2 The amount of 0.1 mg / mL chitosan solution required for the ITO electrode working area is 40 μL; per cm 2 The ITO electrode working area requires a volume of 40 μL of 2.5% glutaraldehyde solution, which should be placed in the dark at room temperature for 0.5-2 h.

9. The method for constructing a self-powered PEC aptamer sensor according to claim 8, characterized in that: In step S4, the aptamer solution is a ciprofloxacin aptamer solution, and the aptamer solution is 100% ciprofloxacin per cm 2 The working area of ​​the ITO electrode requires 40 μL of 0.25-1.25 μM ciprofloxacin aptamer solution and the incubation time is 60 min.

10. Use of the self-powered PEC aptamer sensor according to claim 1 in detecting ciprofloxacin, characterized in that: The following steps are involved: a. Apply 10 μL of the test solution to the ITO / CuInS2 / CS / Apt / MCH electrode, incubate at 37°C for 40 min, and rinse the electrode with PBS. b. Photoelectric signal measurement in PBS buffer solution containing 0.05 M ascorbic acid; c. Substitute the measured photoelectric signal into the linear regression equation: I (μA) = -0.6824 lgC + 5.4468 (nM) (R 2 =0.9964), and the content of ciprofloxacin in the test solution was obtained.

Images