Graisseria parasuis three-component subunit vaccine and preparation method thereof

Abstract

The invention discloses a Graisseria parasuis three-component subunit vaccine and a preparation method thereof, and belongs to the technical field of biology. The vaccine comprises three kinds of antigen proteins of the Gleisseria parasuis in an immunizing dose and a pharmaceutically acceptable adjuvant, and the amino acid sequences of the three kinds of antigen proteins are respectively shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3. The invention further discloses a preparation method of the vaccine. The three-component subunit vaccine provided by the invention has cross protection force on infection of type-4 and type-5 Graisseria parasuis, has an excellent immune protection effect, and is expected to play a better role in prevention and control of infectious diseases caused by the Graisseria parasuis.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to an immunoprotective three-component subunit vaccine against Glaesserella parasuis (GPS) and its preparation method. Background Technology

[0002] *Glasotherium parasuis* is a bacterium that primarily infects pigs, causing a disease known as *Glasotherium parasuis* Glaser disease. This disease leads to widespread fibrinous serositis and arthritis in pigs. Infectious disease can cause various clinical symptoms in pigs, including fever, anemia, and subcutaneous hemorrhage, and in severe cases, death. It causes significant economic losses to the pig farming industry and poses a potential threat to public health. *Glasotherium parasuis* is a Gram-negative, short, morphologically variable bacillus with more than 15 serotypes, among which serotypes 4, 5, and 13 are the most common.

[0003] Once infected with *Glassonia parasuis*, treatment requires large doses of antibiotics. However, excessive antibiotic use not only leads to drug resistance but also causes drug residues, raising food safety concerns. Compared to antibiotics, vaccines are a more effective means of animal disease control. Currently, *Glassonia parasuis* vaccines are mainly inactivated vaccines. Inactivated vaccines have a simple manufacturing process and high immunogenicity, but they have drawbacks such as numerous adverse reactions and poor stability. Unlike inactivated vaccines, subunit vaccines do not contain the entire pathogen but only the antigenic portion. Therefore, there is no risk of introducing disease. Compared to vaccines containing the complete pathogen, they are safer, more stable, and more suitable for large-scale production.

[0004] SH0165 is a standard virulent strain of *Glassonella parasuis*, with a genome consisting of 2,269,156 nucleotides encoding 2,299 genes. Currently, the most studied virulence-related factors in *Glassonella parasuis* include transferrin, cell-lethal swelling toxins, lipooligosaccharide proteins, virulence-associated trimer autotransporters, and outer membrane proteins. However, most subunit vaccines used in existing technologies are single-component. Given the numerous serotypes of *Glassonella parasuis* circulating in China, and the lack of cross-protection between different serotypes, these subunit vaccines have limited clinical efficacy.

[0005] CN102864157A discloses an immunoprotective antigen for *Glasotherium parasuis*. The outer membrane protein gene HbpB, stably expressed from 15 *HP* serotypes, was screened. HbpB was cloned and expressed, demonstrating that the antigen protein exhibits good immunogenicity, inducing high antibody levels and enhancing mouse resistance to *HPS*. It can serve as a candidate antigen for *Glasotherium parasuis* subunit vaccines. CN103479996A discloses an immunoprotective antigen composition for *Glasotherium parasuis*. Multiple immunogenic proteins, including HbpA, afuA, oppA, oppA2, D15, Hps06257, and nqrA, were isolated from *Glasotherium parasuis*. Immunization with this seven-protein combination showed an 80% protection rate against *HPS* strain 3361 in mice. However, this composition suffers from drawbacks such as complex components and high production costs. CN 105617373A discloses a vaccine composed of TbpA, CdtB, OmpP2, and VtaA antigen proteins, which provides cross-protection against Glasgow parasuis serotypes 4, 5, and 12. It provides 80% protection against serotypes 4 and 5 in piglets challenged with the virus, and 80% protection against serotype 12 in piglets challenged with the virus, and can effectively prevent infection with multiple serotypes of Glasgow parasuis. Summary of the Invention

[0006] Due to the numerous serological variants of *Glassonella parasuis*, cross-immunity between different serotypes is very limited. Therefore, it is necessary to provide subunit vaccines with durable and cross-immune protection. Based on this, the present invention, by screening for antigen proteins that can be stably expressed in different serotypes and have strong immunoprotective efficacy, has obtained a novel three-component subunit vaccine for *Glassonella parasuis*.

[0007] To achieve the above objectives, this invention selected three proteins stably expressed in *Glasgiola parasuis* serotypes 4 and 5 as candidate factors and prepared a subunit vaccine. Fourteen days after the second immunization, piglets were challenged with *Glasgiola parasuis* strains 4-MD0322 and 5-SH0165, respectively. Piglet survival was observed for seven consecutive days, and the survival rate was calculated. The results showed that the subunit antigen combination provided offered 80% and 100% protection against *Glasgiola parasuis* serotypes 4 and 5, respectively. These results indicate that the three-component subunit vaccine provided by this invention has cross-protective efficacy against *Glasgiola parasuis* serotypes 4 and 5 and exhibits excellent immunoprotective activity, potentially playing a better role in the prevention and control of infectious diseases caused by *Glasgiola parasuis*.

[0008] Based on this, the present invention provides a three-component subunit vaccine for Gracilaria parasuis, which contains three Gracilaria parasuis antigen proteins at an immunizing dose and a pharmaceutically acceptable adjuvant, wherein the amino acid sequences of the three Gracilaria parasuis antigen proteins are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0009] The mass ratio of the three antigen proteins is 1:1:1.

[0010] The antigen protein has a purity of not less than 90% and an endotoxin content of less than 1000 EU / mL.

[0011] The adjuvant is the biphasic oil emulsion adjuvant ISA 201VG.

[0012] Furthermore, the present invention provides a method for preparing the three-component subunit vaccine of *Glassonia parasuis*, comprising the following steps: 1) Design and synthesize primers for amplifying the genes encoding the three antigen proteins; 2) Using the genome of *Glassella parasuis* as a template, three target gene fragments were obtained by PCR amplification; 3) The amplified target gene fragments were cloned into expression vectors to construct recombinant expression plasmids; 4) The recombinant expression plasmids were transformed into competent E. coli cells, induced to express, and purified to obtain three recombinant proteins; 5) Mix the three recombinant antigen proteins in a certain proportion and add adjuvants to make a vaccine.

[0013] The primer sequences for amplifying the tbpB gene are shown in SEQ ID NO. 38 and 39; the primer sequences for amplifying the Y167A gene are shown in SEQ ID NO. 36 and 37; and the primer sequences for amplifying the lpxC gene are shown in SEQ ID NO. 28 and 29.

[0014] The expression vector is either pCold-TF or pET28a.

[0015] To better achieve prokaryotic expression of the three candidate proteins, the expression systems pET28a and pCold-TF were modified, as follows: An enhancer sequence, Enhancer S (sequence shown in SEQ ID NO: 44), was synthesized and inserted between the promoter and ribosome binding sites of the vectors (between lacO and RBS in the pET28a vector, and between lacO and cspA in the pCold-TF vector). ， The vectors constructed between UTRs were named pET28a-S and pCold-TF-S, respectively.

[0016] The beneficial effects of this invention are: The three Gracilaria parasuis antigen proteins screened in this invention have good immunogenicity. These three antigen proteins, together with adjuvants, are formulated into Gracilaria parasuis subunit vaccines, which can be used to protect pigs against Gracilaria parasuis serotypes 4 and 5, laying the foundation for the development of subunit vaccines with cross-protective efficacy against different serotypes. Attached Figure Description

[0017] Figure 1 Electrophoresis results of PCR amplification of 20 antigen proteins: In Figure 1(a), lane M is the 2000 DNA marker; lane 1 is HPS-06257; lane 2 is PALA; lane 3 is HAPS-0017; lane 4 is HP5-2; lane 5 is omp26; lane 6 is GAPDH; lane 7 is HP5-18; lane 8 is YFEA; lane 9 is CSGG; lane 10 is ompA; lane 11 is CDTB; lane 12 is RNFC; lane 13 is lpxC; lane 14 is PLPA; and lane 15 is hbpA. Figure 1 In (b), lane M is the 2000 DNA marker; lane 1 is PFLA; lane 2 is Y167A; lane 3 is tbpB; and lane 4 is FOG. Figure 1 In (c), lane M is a 2000 DNA marker; lane 1 is Hsds.

[0018] Figure 2 A bar chart showing the serum antibody levels of piglets immunized with five antigen proteins: PFLA, Y167A, lpxC, tbpB, and hbpA.

[0019] Figure 3 The image shows the pCold-TF-Enhancer S vector plasmid spectrum.

[0020] Figure 4 The image shows the pET28a-Enhancer S vector plasmid spectrum.

[0021] Figure 5 This is a representative image from the challenge experiment using the saline control group.

[0022] Figure 6 These are representative images from a challenge trial of a three-component subunit vaccine. Detailed Implementation

[0023] The present invention will now be described in detail with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and not for limiting the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art based on the following embodiments should also be considered to fall within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions or reference books such as *Molecular Cloning: A Laboratory Manual* (New York: Cold Spring Harbor Laboratory, 2017), or according to the methods recommended in the manufacturer's operating manual. Materials in the embodiments that do not specify their source are all commonly used materials well known in the art, which can be constructed based on literature reports or obtained commercially.

[0024] Key material descriptions: HPs-SH0165 strain: is a specific strain of Grasella parasuis serotype 5. This strain is prevalent in China and is considered a highly pathogenic strain. Its accession number is CCTCC No. M2011284, and it has been recorded in Chinese patent document with publication number CN102329746A.

[0025] HPS4-MD0322 strain: is a specific strain of Grasella parasuis serotype 4. This strain is prevalent in China and is considered a highly pathogenic strain. Its accession number is CCTCC No. M2011283, and it has been described in Chinese patent application with publication number CN102329746A.

[0026] pET28a vector: pET-28a(+) is a commonly used E. coli expression vector that can achieve high-level protein expression in host cells. pET-28a(+) vector was purchased from Wuhan Weiwu Origin Biotechnology Co., Ltd.

[0027] pCold-TF vector: a cold shock expression vector for expressing recombinant proteins in Escherichia coli. It incorporates a soluble tag for expression, enabling the soluble expression of difficult-to-express genes. It is identified, preserved, and supplied by Wuhan Keqian Biotechnology Co., Ltd.

[0028] pCold-NusA vector: pCold-NusA vector is a cold shock expression vector, mainly used for the efficient expression of recombinant proteins in Escherichia coli under low temperature conditions. It was purchased from Wuhan Weiwu Origin Biotechnology Co., Ltd.

[0029] Enhancer S: This enhancer sequence can be applied to E. coli expression systems to improve the expression level of exogenous proteins. It was synthesized by Wuhan Qingke Biotechnology Co., Ltd.

[0030] DH5α: Escherichia coli competent cells, used for the cloning and preservation of recombinant plasmids.

[0031] BL21: Escherichia coli competent cells used for prokaryotic expression of recombinant plasmids.

[0032] All primers were synthesized by Wuhan Qingke Biotechnology Co., Ltd. Other materials not mentioned in the text are conventional materials in the field and can be obtained commercially.

[0033] Example 1: Screening of antigen proteins 1. Primer design Twenty proteins stably expressed in *Glassella parasuis* types 4 and 5 were screened by mass spectrometry as candidate factors. Primers for amplifying protein-coding genes were designed using Primer 5.0 software, referencing the whole genome sequence of strain SH0165 (NCBI accession number: CP001321). The 20 primer pairs and their information are shown in Table 1.

[0034] Table 1 Primers used for amplifying the antigen protein gene

[0035] 2. PCR amplification The genome of the extracted strain of Gerasidium parasuis HPs-SH0165 was used as a template for PCR amplification. PCR amplification was performed using the primers shown in Table 1. The PCR amplification reaction system was as follows: 2.0 μL template; 2.0 μL each of forward and reverse primers; 25 μL 2×PhantaMax Master Mix; ddH2O added to 50 μL.

[0036] The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30-60 sec / kb, 35 cycles, and a final extension at 72℃ for 5 min. After the PCR amplification reaction, the amplification products were electrophoresed on a 1% agarose gel, and the target fragment was recovered from the gel. The electrophoresis image of the gene encoding the antigen protein after amplification is shown below. Figure 1 As shown.

[0037] 3. Expression vector digestion The pET28a vector was double-digested with EcoRI + NotRI, BamHI + NotRI, and SacHI + XhoHI; the pCold-TF vector was double-digested with NdeHI + XbaHI and KpnHI + SalHI; and the pCold-NusA vector was double-digested with BamHI + XbaHI. The digestion system was as follows: 1 μg template; 5.0 μL 10× buffer; 1.0 μL each restriction endonuclease; and ddH2O to a final volume of 50 μL. The reaction was carried out at 37℃ for 3 h. The digestion products were then recovered by agarose gel electrophoresis on a 1% agarose gel.

[0038] 4. Ligation, transformation, and screening of recombinant bacteria Homologous recombination was performed using the ClonExpress II One Step Cloning Kit on the recovered DNA fragment from step 2 and the target fragment from step 3. After preparing the ligation system, the reaction was carried out at 37°C for 30 min. The ligated recombinant expression vector was then transformed into E. coli DH5α competent cells. The ligation system consisted of: 100 ng linearized vector; 80 ng target fragment; 4 μL 5×CE II Buffer; 2 μL Exnase; and ddH2O added to a final volume of 20 μL.

[0039] The transformed single colonies were subjected to PCR detection. After correct identification, they were sent to Wuhan Qingke Biotechnology Co., Ltd. for sequencing. After the results were correct, plasmids were extracted.

[0040] 5. The extracted plasmid was transformed into E. coli BL21 competent cells, and the resulting recombinant E. coli were cultured in LB liquid medium containing 50 μg / mL until OD200. 600 When the concentration of the bacterial culture reached 0.6, 1 mL of bacterial culture was used as a pre-induction control. Isopropyl thiogalactoside (IPTG, purchased from Invitrogen, USA) was added to the remaining bacterial culture to a final concentration of 0.5 mmol / L, and expression was induced at 37℃ in a shaker for 8 h. 1 mL of bacterial culture was then processed as follows: centrifuged at 5000 rpm for 1 min, the supernatant was discarded, and 300 μL of PBS was added for sonication. After disruption, the culture was centrifuged at 12000 rpm, and the supernatant and precipitate were collected separately. 5× protein loading buffer was added to the supernatant, and the culture was boiled in water at 100℃ for 10 min. After boiling, expression was confirmed by SDS-PAGE gel electrophoresis. Results showed that all 20 genes encoding the amplified antigen proteins were successfully cloned and expressed in the supernatant.

[0041] 6. Induction and purification of antigen proteins The recombinant *E. coli* strain was inoculated into 10 mL of LB liquid medium containing the corresponding antibiotic and cultured on a shaker at 37°C. 8 mL of the cultured bacterial solution was then inoculated into 800 mL of fresh LB liquid medium containing the corresponding antibiotic and cultured with shaking at 37°C for approximately 3 hours. When the culture reached OD... 600 When the concentration of OD was 0.6, IPTG was added to a final concentration of 0.5 mmol / L. The cells were then incubated on a shaker at 37°C for 8 hours and centrifuged at 5000 rpm for 10 minutes to collect the cells. The collected cells were resuspended in binding buffer, sonicated, and centrifuged at 4°C and 12000 rpm for 15 minutes. The supernatant was loaded onto an affinity chromatography column. The column was washed with binding buffer and washing buffer until the OD value reached near the baseline. Elution buffer was then used to elute the bound recombinant protein. The protein at the peak was the purified recombinant protein. The supernatant was loaded onto an SDS-PAGE gel, and the purity and concentration of the harvested recombinant protein were calculated using grayscale analysis for subsequent experiments.

[0042] Example 2: Recombinant Protein Screening Test 1. Screening test for the immunoprotective effect of recombinant protein in mice The purified recombinant protein was emulsified with Freund's complete adjuvant and Freund's incomplete adjuvant at a 1:1 (v / v) ratio to prepare a mouse vaccine. The final concentration of the recombinant protein in the vaccine formulation was 125 μg / mL. An adjuvant control (prepared by emulsifying PBS with equal volumes of Freund's complete adjuvant and Freund's incomplete adjuvant) and a blank control group (injected with PBS only) were also set up. Twenty female Kunming mice aged 6-8 weeks were selected for each group. The mice were initially immunized with 0.4 mL of the mouse vaccine emulsified with Freund's complete adjuvant via intramuscular injection in the leg. Three weeks later, a booster immunization was performed by intramuscular injection of 0.4 mL of the mouse vaccine emulsified with Freund's incomplete adjuvant. Two weeks after the booster immunization, the mice were challenged. Ten mice in each group were infected with 4LD50 doses of *Glasotherium parasuis* HPS4-MD0322 bacterial suspension, and the other ten mice were infected with 4LD50 doses of *Glasotherium parasuis* HPs-SH0165 bacterial suspension. The mice were observed for one week, and their clinical characteristics and mortality were recorded.

[0043] The results showed that 7 days after HPS4-MD032 infection, the survival rate in the adjuvant control group was 20%, while all patients in the blank control group died. The survival rate of the immunization groups with recombinant proteins PalA, 06257, HPAS-0017, HP5-2, omp26, GAPDH, HP5-18, YEFA, CSGG, ompA, CDTB, and RNFC was less than 50%. The recombinant proteins PLPA, PFLA, FOG, hbpA, Y167A, tbpB, lpxC, and Hsds had high protective efficacy, with survival rates of 60% and above.

[0044] Seven days after HPs-SH0165 infection, the survival rate in both the adjuvant control group and the blank control group was 10%. The survival rate in the immunization groups with recombinant proteins PalA, 06257, HPAS-0017, HP5-2, omp26, GAPDH, HP5-18, YEFA, CSGG, ompA, CDTB, RNFC, Hsds, FOG, and PLPA was less than 50%. The recombinant proteins PFLA, omp26, GAPDH, hbpA, lpxC, Y167A, and tbpB all showed high protective efficacy, with survival rates of 60% or higher.

[0045] In summary, the five recombinant proteins PFLA, Y167A, lpxC, tbpB, and hbpA showed good protective efficacy against infection by Glasgow Glassiella parasuis serotypes 4 and 5. Therefore, these five recombinant proteins were used to further conduct protein screening experiments in piglet immunization models.

[0046] 2. Screening test for immune protection of recombinant protein in piglets Five recombinant proteins—PFLA, Y167A, lpxC, tbpB, and hbpA—were emulsified with Freund's complete adjuvant and Freund's incomplete adjuvant at a 1:1 (v / v) ratio to prepare a vaccine for piglet immunization. The final concentration of each recombinant protein was 125 μg / mL. A blank control group (injected with PBS only) and an adjuvant control group were set up. Healthy susceptible piglets at 4 weeks of age were selected and divided into 7 groups of 10 piglets each. The first immunization was administered via intramuscular injection in the neck, with 2 mL / piglet. A booster immunization was given three weeks later, with the same dosage and route of administration as the first immunization. Antibody levels in pig serum were detected by indirect ELISA at 21 and 35 days after the first immunization. Fourteen days after the second immunization, 5 piglets from each group were infected with HPS4-MD032 at a dose of 7.0 × 10⁻⁶. 9 CFU, and another 5 piglets were infected with HPs-SH0165 at a dose of 3.6 × 10⁻⁶. 9 CFU was administered via tracheal injection. Piglets were observed for 7 consecutive days after challenge, and their clinical characteristics and mortality were recorded for each group. All surviving piglets were euthanized and subjected to systematic necropsy at the end of the experiment. Piglets that died during the experiment underwent immediate pathological examination on the same day.

[0047] The results showed that on the first day after HPS4-MD032 infection, piglets in both the adjuvant control group and the blank control group exhibited depression, ataxia, and mortality. By day 3 post-challenge, the survival rate in the adjuvant control group was 20%, while all piglets in the blank control group died. By day 7 post-challenge, the survival rates of piglets immunized with hbpA and PFLA recombinant proteins were 40% and 20%, respectively, while the survival rates in the Y167A, lpxC, and tbpB recombinant protein immunization groups were 60%, 80%, and 60%, respectively, demonstrating good immunoprotective effects.

[0048] All patients in the blank control group died on the second day after HPs-SH0165 infection, while the survival rate in the adjuvant control group was 20%. All patients in the adjuvant control group died on the 5th day after challenge. By the 7th day after challenge, the survival rate of the PFLA recombinant protein group was 20%, while the survival rates of the Y167A, lpxC, tbpB, and hbpA recombinant protein groups were above 60%, specifically 80%, 80%, 60%, and 60%, respectively.

[0049] The above results indicate that the three recombinant proteins Y167A, lpxC, and tbpB have higher protective efficacy against piglets infected with Glasgow parasuis serotypes 4 and 5. Figure 2 The results showed that on days 21 and 35 after immunization, the antibody levels of piglets in each protein immunization group were significantly higher than those in the adjuvant control group and the blank control group. Furthermore, the specific antibody levels of the three proteins Y167A, lpxC, and tbpB were significantly higher than those of hbpA and PFLA, which was consistent with the results of the immunoprotection test.

[0050] 3. Screening test for immune protection in piglets using multi-component recombinant proteins The recombinant proteins Y167A, lpxC, and tbpB proteins that showed better immunoprotective effects against HPS4-MD032 and HPs-SH0165 infections were mixed in a specific ratio to serve as the aqueous phase antigen. The aqueous phase antigen was then mixed with Freund's complete adjuvant and Freund's incomplete adjuvant at a 1:1 volume ratio to ensure that the total concentration of recombinant proteins in the subunit vaccine was 125 μg / mL. After preparing the subunit vaccine, another round of immunoprotective testing was conducted. The specific groupings are shown in Table 2. The infection dose was the same as in step 2, and the survival rate of piglets in each group was monitored after infection.

[0051] Table 2 Results of the immunoprotective test of multi-component recombinant protein in piglets

[0052] Table 2 shows that 7 days after HPS4-MD032 infection in piglets, the survival rates of the Y167A+lpxC, Y167A+tbpB, lpxC+tbpB, and Y167A+lpxC+tbpB immunized groups were 80%, 60%, 60%, and 80%, respectively; 7 days after HPS-SH0165 infection in piglets, the survival rates of the Y167A+lpxC, Y167A+tbpB, lpxC+tbpB, and Y167A+lpxC+tbpB immunized groups were 80%, 80%, 80%, and 100%, respectively. During the observation period, the surviving piglets in the immunized groups showed no significant abnormalities in their mental state, feed intake, or behavior. After the experiment, the surviving piglets were euthanized and pathological autopsies were performed. The surviving piglets in the immunized groups showed no obvious symptoms of Glasgow parasuis infection, while the deceased piglets showed mild to moderate symptoms of Glasgow parasuis infection.

[0053] Example 3: Modification of expression vectors for recombinant proteins tbpB, Y167A, and lpxC To increase the concentration of recombinant protein after expression and purification, an enhancer sequence, Enhancer S (SEQ ID NO: 44), was synthesized and inserted into the lacO and cspA5 sequences of the tbpB and Y167A expression vectors, respectively. ， The vectors constructed between UTR and between lacO and RBS of the lpxC expression vector were named pCold-TF-S-tbpB, pCold-TF-S-Y167A, and pET28a-S-lpxC, respectively.

[0054] 1. Construction of pCold-TF-S-tbpB and pCold-TF-S-Y167A vectors: (1) Using the pCold-TF vector as a template and P4-F / P4-R as primers for PCR amplification, the PCR reaction system and amplification procedure were as described in step 2 of Example 1. The primer sequences (5'-3') were: P4-F: caaattgtgagcggataacaa GATCCTAATACGACTCACTATAGGGAGACACGCTGCTA GCGATCGGATCC cagtgtagtaaggcaagtccc (SEQ ID NO: 45) P4-R: gggacttgccttactacactg GGATCCGATCGCTAGCAGCGTGTCTCCCTATAGTGAGT CGTATTAGGATC ttgttatccgctcacaatttg (SEQ ID NO: 46) The underlined part in the primer is the Enhancer S sequence; (2) After the PCR reaction, add 1µL of DpnI to the PCR reaction system to remove the template, mix well and incubate at 37℃ for 30min; (3) Transform DH5α competent cells and select single clones for sequencing identification; (4) After correct sequencing, the pCold-TF-Enhancer S vector is obtained, and the plasmid map is as follows. Figure 3 As shown; (5) The pCold-TF-Enhancer S vector was double-digested with KpnI and SalI. The digestion system was the same as step 3 in Example 1 to obtain the linearized vector. (6) The enzyme digestion products were reacted at 37℃ for 3 hours, and then recovered by agarose gel electrophoresis with 1% agarose gel. (7) Using the synthesized tbpB and Y167A as templates, PCR amplification was performed using primers (the primer sequences for amplifying the tbpB gene are shown in SEQ ID NO. 38 and 39; the primer sequences for amplifying the Y167A gene are shown in SEQ ID NO. 36 and 37) to obtain the insert fragments. The PCR reaction system and amplification procedure are as described in step 2 of Example 1; (8) The PCR products were electrophoresed on a 1% agarose gel and recovered using an agarose gel recovery kit; (9) Using the Novizan ClonExpress II One Step Cloning Kit, the linearized vector pCold-TF-Enhancer S recovered in (4) and (7) and the insert fragments tbpB, pCold-TF-Enhancer S and Y167A were homologously recombinated. The reaction was carried out at 37℃ for 30 min, and the resulting recombinant expression vectors were transformed into E. coli DH5α competent cells. Single colonies were picked for PCR identification. After correct identification, they were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to obtain the pCold-TF-S-tbpB and pCold-TF-S-Y167A vectors.

[0055] 2. Construction of the pET28a-S-lpxC vector: (1) Using the pET28a(+) vector as a template and P5-F / P5-R as primers, reverse PCR amplification was performed. The PCR reaction system and amplification procedure were as described in step 2 of Example 1. The primer sequences (5'-3') were: P5-F: ttgtgagcggataacaattcc GATCCTAATACGACTCACTATAGGGAGACACGCTGCTAGCGA TCGGATCC tttgtttaactttaagaagga (SEQ ID NO: 47) P5-R: tccttcttaaagttaaacaaa GGATCCGATCGCTAGCAGCGTGTCTCCCTATAGTGAGTCGTA TTAGGATC ggaattgttatccgctcacaa (SEQ ID NO: 48) The underlined part in the primer is the Enhancer S sequence; (2) After the PCR reaction, add 1µL of DpnI to the PCR reaction system to remove the template, mix well and incubate at 37℃ for 30min; (3) Transform DH5α competent cells and select single clones for sequencing identification; (4) After correct sequencing, the pET28a-Enhancer S vector is obtained, and the plasmid map is as follows. Figure 4 As shown; (5) The pET28a-Enhancer S vector was double-digested with SacⅠ+XhoⅠ, and the digestion system was the same as step 3 in Example 1 to obtain the linearized vector; (6) React at 37℃ for 3 hours, and then recover the enzyme digestion product by electrophoresis on a 1% agarose gel and agarose gel. (7) Using the synthesized lpxC as a template, PCR amplification was performed with primers (sequences shown in SEQ ID NO. 28 and 29) to obtain the insert fragment. The PCR reaction system and amplification procedure are as described in step 2 of Example 1; (8) The PCR products were electrophoresed on a 1% agarose gel and recovered using an agarose gel recovery kit; (9) Homologous recombination of the linearized vector pET28a-Enhancer S and the insert fragment tbpB recovered in (4) and (7) was performed using the Novizan ClonExpress II One Step Cloning Kit. The reaction was carried out at 37℃ for 30 min, and the resulting recombinant expression vector was transformed into Escherichia coli DH5α competent cells. Single colonies were picked for PCR identification. After correct identification, the colonies were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing to obtain the pET28a-S-lpxC vector.

[0056] 3. pCold-TF-S-tbpB, pCold-TF-S-Y167A, and pET28a-S-lpxC were transformed into competent Escherichia coli BL21(DE3). The recombinant strains were induced for 8 h at 0.5 mM IPTG, 28 °C, and 180 rpm. The collected bacterial cells were resuspended in binding buffer, sonicated, and centrifuged at 4 °C and 12000 rpm for 15 min to collect the supernatant. SDS-PAGE gel electrophoresis confirmed that all three recombinant proteins were successfully cloned and expressed in the supernatant.

[0057] 4. Load a portion of the supernatant into an affinity chromatography column. Wash the column with binding buffer and washing buffer until the OD value reaches near the baseline. Elute the bound recombinant protein with elution buffer. The protein at the peak is the purified recombinant protein. Load the sample onto an SDS-PAGE gel and calculate the purity and concentration of the harvested recombinant protein using grayscale analysis. Table 3 shows that the endotoxin content of the tbpB, Y167A, and lpxC recombinant proteins after enhancer insertion is all below 1000 EU / ml, the purity is not less than 90%, and the concentration is greater than 0.75 mg / mL.

[0058] Table 3. Concentration determination results of recombinant protein after purification

[0059] Example 4: Screening of adjuvants To screen suitable adjuvants for Grazeria parasuis subunit vaccines, this study selected three novel and two classic veterinary subunit vaccine adjuvants, respectively, and formulated corresponding adjuvant vaccines with combined antigens. After being stored at 2–8°C for 3, 6, 12, and 15 months, their physical properties were examined, and the adjuvant vaccines stored for 12 months were subjected to piglet safety tests.

[0060] 1. Vaccine preparation Three recombinant proteins, Y167A, lpxC, and tbpB, were mixed in a 1:1:1 mass ratio as aqueous antigens. Subunit vaccines were prepared according to the adjuvant instructions using five different adjuvants: ISA 201VG biphasic oil-emulsion adjuvant vaccine (201VG vaccine), IMS1313VG N water-soluble nano-adjuvant vaccine (1313VG vaccine), ADJ-803 polymer aqueous adjuvant vaccine (803 vaccine), aluminum hydroxide gel adjuvant vaccine (aluminum gel vaccine), and Freund's complete adjuvant vaccine (Freund's vaccine). The total antigen concentration in each subunit vaccine formulation was 125 μg / mL. The prepared vaccines were aliquoted and stored at 2–8°C.

[0061] 2. Physical property testing Vaccine samples were taken after 3, 6, 12 and 15 months of storage for physical property testing including appearance, viscosity, and stability, as well as sterility testing.

[0062] ISA 201VG vaccine is a water-in-oil-in-water type, appearing as a milky white, slightly viscous emulsion with no aqueous or oil phase separation. IMS1313VG and 803 vaccines are both aqueous, appearing as colorless or pale yellow, semi-transparent suspensions. Aluminum gel vaccine is a suspension type, appearing as a milky white gel that slightly separates upon standing but redistributes evenly upon shaking. Freund's complete adjuvant is a water-in-oil type, appearing milky white, viscous, with poor flowability and a certain degree of toughness after thorough emulsification with the antigen. Vaccines formulated with these five adjuvants all meet the requirements for stability, viscosity, and appearance. Testing according to the appendices of the current Chinese Veterinary Pharmacopoeia, Part III, showed no sterile growth, thus meeting the requirements.

[0063] 3. Safety test of piglets Sixty piglets were randomly divided into six groups. Five groups of piglets were injected with a double dose (4 mL / pig) into the neck muscle of each of the following vaccines: 201VG, 1313VG, 803, aluminum gel, and Freund's vaccine (stored at 2–8℃ for 12 months). A control group was also established and injected with sterile saline (4 mL / pig). Clinical indicators such as piglet spirit, appetite, behavior, feed intake, and mortality were observed and recorded. Fourteen days after vaccination, piglets in each group were euthanized and necropsy was performed for pathological examination of the injection site for redness, ulceration, and vaccine residue.

[0064] The results showed that during the 14-day observation period after vaccination, piglets in the 201VG vaccine group, 803 vaccine group, and aluminum glue vaccine group exhibited no abnormalities in their mental state or feed intake, showing no significant difference compared to the saline control group. No stress symptoms such as vomiting, diarrhea, or even death were observed. Body temperature rose slightly on the first day after vaccination, but did not exceed 1°C and returned to normal within 48 hours. On the 14th day after vaccination, necropsy of all piglets revealed no redness, ulceration, or vaccine residue at the injection site in any group, showing no visible difference compared to the control group. However, one piglet in both the Freund's vaccine group and the 1313VG vaccine group showed mild redness and swelling at the injection site after immunization. The results indicate that the 201VG vaccine, 803 vaccine, and aluminum glue vaccine are safer for piglets.

[0065] 4. Effectiveness test in piglets Forty piglets were randomly divided into four groups. Three groups received intramuscular immunization with 2 mL of 201VG vaccine, 803 vaccine, and aluminum gel vaccine, respectively. The fourth group served as a control, injected with sterile saline. Three weeks later, all piglets received a second immunization at the same dose and via the same route. Fourteen days after the second immunization, all piglets underwent a challenge test, with five piglets in each group infected with 7.0 × 10⁻⁶ virus. 9 CFU of HPS4-MD0322 bacteria was administered to five piglets, and another five piglets were infected with 3.6 × 10⁻⁶ bacteria. 9HPs-SH0165 bacteria at a CFU dose. Piglets were observed continuously for one week, and their clinical characteristics and mortality were recorded.

[0066] Clinical observation revealed that all piglets in the saline control group infected with HPS4-MD0322 and HPs-SH0165 died, with all deaths occurring within 3 days of challenge. Pathological examination showed that the dead piglets had enlarged hearts with fibrinous exudate on the surface, exhibiting a "villous heart" phenomenon. The liver and spleen showed varying degrees of congestion and swelling. The pleural and peritoneal cavities were extensively covered with purulent or fibrinous exudate. The joint cavities were significantly swollen with inflammatory effusion. Scattered hemorrhages were visible in the meninges and brain parenchyma. Figure 5 In the aluminum gel vaccine group, piglets infected with HPS4-MD0322 and HPs-SH0165 died on days 3 and 5 respectively, with a survival rate of 80%. Healthy surviving piglets showed no abnormalities in their mental state, feed intake, or behavior. Autopsy results of the deceased piglets showed mild Glasgow parasuis infection, with small amounts of fibrinous exudate in the thoracic and abdominal cavities, mild swelling of the carpal and hock joints with small amounts of clear fluid, and mild local congestion in the lungs. Seven days after HPS4-MD0322 and HPs-SH0165 infection, the survival rates of piglets in the 803 vaccine group were 80% and 100%, respectively. Autopsy results of the deceased piglets showed moderate Glasgow parasuis infection, with pale yellow fibrinous exudate accumulation in the pericardial cavity, significant swelling of the carpal, hock, and knee joints with turbid fluid, localized fibrinous pneumonia, mild spleen enlargement, and liver congestion with fibrinous exudate on the surface. The survival rate of piglets in the 201VG vaccine group after 7 days of infection with HPS4-MD0322 and HPs-SH0165 was 100%. The surviving piglets showed no abnormalities in their mental state, feed intake, behavior, or respiration. After the experiment, the surviving piglets were euthanized. The necropsy results showed that one surviving piglet in the Gracilaria parasuis subunit vaccine group exhibited mild Gracilaria parasuis symptoms. Figure 6 ).

[0067] Table 4. Results of the immunization protection trial in piglets with three adjuvant vaccines.

[0068] Appendix: Explanation of the sequence list SEQ ID NO.1: Amino acid sequence of the tbpB antigen protein; SEQ ID NO.2: Amino acid sequence of the Y167A antigen protein; SEQ ID NO.3: Amino acid sequence of the lpxC antigen protein; SEQ ID NO.4-43: Primer sequences for 20 candidate antigen proteins; SEQ ID NO.44: Enhancer sequence used to construct the expression vector; SEQ ID NO. 45, 46: Primer sequences for amplifying the pCold-TF-Enhancer S vector; SEQ ID NO.47, 48: Primer sequences used to amplify the pET28a-Enhancer S vector.

Claims

1. A three-component subunit vaccine against Glasgow parasuis, characterized in that: The invention comprises an immunizing dose of three Gracilaria parasuis antigen proteins and a pharmaceutically acceptable adjuvant, the amino acid sequences of which are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively.

2. The vaccine according to claim 1, characterized in that: The mass ratio of the three antigen proteins is 1:1:

1.

3. The vaccine according to claim 1, characterized in that: The purity of the three antigen proteins is not less than 90%, and the endotoxin content is less than 1000 EU / ml.

4. The vaccine according to claim 1, characterized in that: The adjuvant is the biphasic oil emulsion adjuvant ISA 201VG.

5. A method for preparing the vaccine according to any one of claims 1-4, characterized in that, Includes the following steps: 1) Design and synthesize primers for amplifying the genes encoding the three antigen proteins; 2) Using the genome of *Glassella parasuis* as a template, three target gene fragments were obtained by PCR amplification; 3) The amplified target gene fragments were cloned into expression vectors to construct recombinant expression plasmids; 4) The recombinant expression plasmids were transformed into competent E. coli cells, induced to express, and purified to obtain three recombinant proteins; 5) Mix the three recombinant antigen proteins in a certain proportion and add adjuvants to make a vaccine.

6. The method according to claim 5, characterized in that: The expression vector is pCold-TF or pET28a.

7. The method according to claim 6, characterized in that: The expression vector contains an enhancer sequence SEQ ID NO:44, which is inserted between the promoter and ribosome binding site of the vector.

8. The use of the vaccine according to any one of claims 1-4 in the preparation of a medicament against Glasgow parasuis infection, characterized in that: This drug provides cross-protection against swine infection with serotypes 4 and 5 of Glasgow parasuis.

Images