Application of preparation for overexpressing UQCRC2 or GS in preparation of medicine for preventing and / or treating hepatic fibrosis

By overexpressing UQCRC2 or GS, the activation of hepatic stellate cells is inhibited, which solves the problem of liver fibrosis progression in the existing technology and achieves the effect of delaying liver fibrosis. UQCRC2 or GS can be used as therapeutic targets for liver fibrosis.

CN120837653APending Publication Date: 2025-10-28ZHEJIANG CHINESE MEDICAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511162072.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-19
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

Existing technologies lack effective targeted therapeutics to inhibit the activation of hepatic stellate cells, which leads to the progression of liver fibrosis, partly due to an incomplete understanding of the molecular mechanisms driving fibrosis.

Method used

By overexpressing UQCRC2 or GS, the activation of hepatic stellate cells can be inhibited, affecting their expression and thus delaying the progression of liver fibrosis. UQCRC2 or GS can serve as therapeutic targets for liver fibrosis.

Benefits of technology

By inhibiting the activation of hepatic stellate cells, the progression of liver fibrosis is slowed down, showing an anti-liver fibrosis effect. UQCRC2 or GS can be used as therapeutic targets for liver fibrosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120837653A_ABST
    Figure CN120837653A_ABST
Patent Text Reader

Abstract

The invention discloses application of a UQCRC2 or GS overexpression preparation in preparation of a medicine for preventing and / or treating hepatic fibrosis, and belongs to the field of biological medicine. According to the application, glutamine synthetase (GS) is found to be remarkably reduced in fibrotic hepatic tissues and hepatic stellate cells through a proteomics technology, and the GS can catalyze glutamic acid and ammonia to be converted into glutamine, so that the GS plays a key role in maintaining nitrogen balance and preventing neurotoxic ammonia accumulation. Further, the invention finds that GS exerts an ammonia removal function instead of promoting glutamine synthesis, thereby inhibiting HSCs activation and preventing liver fibrosis progression. The invention also finds that UQCRC2 can influence the activation of hepatic stellate cells by regulating GS. Therefore, the preparation for overexpressing UQCRC2 or GS can inhibit the activation of hepatic stellate cells and delay the progress of hepatic fibrosis, and UQCRC2 or GS can be used as a hepatic fibrosis treatment target.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the use of formulations overexpressing UQCRC2 and / or GS in the preparation of medicaments for the prevention and / or treatment of liver fibrosis. Background Art

[0002] Liver fibrosis is characterized by excessive accumulation and abnormal distribution of the extracellular matrix (ECM), leading to structural distortion and functional impairment of the liver. While various cell types, such as hepatocytes, bile duct epithelial cells, Kuffer cells, and sinusoidal endothelial cells, play important regulatory roles in the occurrence and progression of liver fibrosis, the activation of hepatic stellate cells (HSCs) is the core step in this process. In a normal liver, HSCs are in a resting state, residing in the perisinusoidal space between hepatocytes and sinusoidal endothelial cells. Their intracellular contents contain numerous lipid droplets, primarily storing 50%-95% of the body's vitamin A in the form of retinyl esters. However, when the liver is under chronic, persistent damage (such as in viral hepatitis (hepatitis B, hepatitis C), alcoholism, metabolic disorder-associated steatohepatitis (MASH), and autoimmune diseases), damaged or apoptotic hepatocytes stimulate Kuffer cells to release large amounts of inflammatory factors or directly promote HSC activation and further differentiation into myofibroblast-like cells through paracrine signaling. Activated hepatic fibrosis cells (HSCs) can rapidly proliferate and migrate to the damaged area of ​​the liver, while simultaneously secreting large amounts of endogenous coagulation (ECM) primarily composed of type I and type III collagen, thereby repairing the damaged site. When the primary disease causing liver damage is controlled in time, liver fibrosis can be reversed; however, when the damaging factors persist, excessive ECM deposition leads to the destruction of normal liver lobule structure, abnormal hepatic hemodynamics, and ultimately, loss of normal liver function, with liver fibrosis progressing to cirrhosis. However, effective targeted therapies are currently lacking, partly due to an incomplete understanding of the molecular mechanisms driving fibrosis. Therefore, understanding the molecular mechanisms of HSC activation and identifying more effective anti-fibrotic therapeutic targets is of great significance for the treatment of liver fibrosis and chronic liver diseases. Summary of the Invention

[0003] The purpose of this invention is to provide the application of formulations overexpressing UQCRC2 or GS in the preparation of drugs for the prevention and / or treatment of liver fibrosis, thereby addressing the problems existing in the prior art. Formulations overexpressing UQCRC2 or GS can inhibit the activation of hepatic stellate cells and delay the progression of liver fibrosis. Therefore, UQCRC2 or GS can serve as therapeutic targets for liver fibrosis.

[0004] To achieve the above objectives, the present invention provides the following solution:

[0005] This invention provides the use of formulations overexpressing UQCRC2 or GS in the preparation of medicaments for the prevention and / or treatment of liver fibrosis.

[0006] Optionally, the UQCRC2 exerts its role in preventing and / or treating liver fibrosis by inhibiting the activation of hepatic stellate cells.

[0007] Optionally, the UQCRC2 can affect the activation of hepatic stellate cells by influencing the expression of GS.

[0008] Optionally, the formulation overexpressing UQCRC2 or GS comprises cells overexpressing UQCRC2 or GS.

[0009] The present invention also provides a drug for the prevention and / or treatment of liver fibrosis, wherein the active ingredient is a formulation that overexpresses UQCRC2 or GS.

[0010] Optionally, formulations that overexpress UQCRC2 or GS include cells that overexpress UQCRC2 or GS.

[0011] Optionally, the UQCRC2 exerts its role in preventing and / or treating liver fibrosis by inhibiting the activation of hepatic stellate cells.

[0012] Optionally, the UQCRC2 can affect the activation of hepatic stellate cells by influencing the expression of GS.

[0013] Optionally, it may also include pharmaceutically acceptable excipients.

[0014] Optionally, the excipients include at least one of diluents, fillers, excipients, binders, humectants, disintegrants, absorption promoters, surfactants, adsorbent carriers, lubricants, and flavorings.

[0015] The present invention discloses the following technical effects:

[0016] This invention utilizes proteomics to discover that glutamine synthase (GS) is significantly downregulated in fibrotic liver tissue and hepatic stellate cells. GS plays a crucial role in maintaining nitrogen balance and preventing neurotoxic ammonia accumulation by catalyzing the conversion of glutamate (Glu) and ammonia into glutamine (Gln). Notably, decreased GS activity and its mediated ammonia accumulation are associated with disease progression, indicating its role in liver pathology.

[0017] This invention discovers that GS (glucamine serotonin) functions to clear ammonia rather than promote glutamine synthesis, thereby inhibiting HSC (hepatic stellate cells) activation and preventing the progression of liver fibrosis. Mechanistically, experiments in this invention demonstrate that the absence of GS leads to impaired ammonia clearance and ammonia accumulation, which is key to inducing HSC activation. Furthermore, by constructing a GS overexpression model using adeno-associated virus type 8 and the GS-HA plasmid, in vivo and in vitro GS function supplementation experiments both showed anti-liver fibrosis effects. Given the reduced GS expression in damaged livers, this invention also finds that GS activation is related to ubiquinone-cytochrome c reductase core protein 2 (UQCRC2). UQCRC2 can affect hepatic stellate cell activation by regulating GS expression. Therefore, preparations overexpressing UQCRC2 or GS can inhibit hepatic stellate cell activation and delay the progression of liver fibrosis; UQCRC2 or GS can serve as therapeutic targets for liver fibrosis. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 Map of UQCRC2 overexpression plasmids carrying the Flag tag;

[0020] Figure 2 Map of GS overexpression plasmids carrying the HA tag;

[0021] Figure 3 To reveal a significant decrease in GS in liver fibrosis through quantitative proteomics; A: ALT level in mouse serum; B: AST level in mouse serum; C: H&E, Masson, and Sirius red staining images of liver tissue; D: List of the top 15 differentially expressed proteins in the liver proteomics results of CCl4 mice; E: List of the top 15 differentially expressed proteins in the proteomics results of HSC-T6 cells; F: Venn diagram of differentially expressed proteins in liver fibrosis in vitro and in vivo; G: Western blot verification of GS expression in mice with CCl4-induced liver fibrosis; H: Western blot verification of GS expression in HSC-T6 cells induced by TGF-β; I: Western blot verification of GS expression in mice with BDL-induced liver fibrosis; J: Western blot verification of GS expression in LX-2 cells induced by TGF-β.

[0022] Figure 4The following are examples of direct metabolic changes induced by GS: A: GS-catalyzed reactions; B: GS activity in liver tissue of CCl4-induced liver fibrosis mice; C: GS activity in liver tissue of BDL-induced liver fibrosis mice; D: Detection of ammonia, glutamate, and glutamine levels in liver tissue of CCl4-induced liver fibrosis mice; E: Detection of ammonia, glutamate, and glutamine levels in liver tissue of BDL-induced liver fibrosis mice; F: Detection of ammonia, glutamate, and glutamine levels in TGF-β-induced LX-2 cells; G: Detection of ammonia, glutamate, and glutamine levels in GS KO cells.

[0023] Figure 5 The effects of ammonia and glutamine on liver fibrosis; A: Western blot analysis of fibrotic proteins α-SMA and Desmin after supplementation with NH4Cl and glutamine in CCl4-induced liver fibrosis in vivo; B: Quantitative statistical graph of α-SMA protein in Figure A; C: Quantitative statistical graph of Desmin protein in Figure A; D: Protein bands of Collagen I and α-SMA in LX-2 cells after glutamine supplementation in vitro; E: Protein bands of Collagen I and FN in LX-2 cells after NH4Cl supplementation in vitro;

[0024] Figure 6 A: Schematic diagram of Co-IP experiment; B: Venn diagram of proteins interacting with GS and IgG, identified by mass spectrometry analysis; C: List of proteins interacting with GS; D: Co-IP experiment to detect the binding of GS to UQCRC2 (using GS antibody as IP antibody and UQCRC2 antibody as detection antibody); E: Expression of UQCRC2 and GS in UQCRC2 KO cells; F: Expression of GS and UQCRC2 in GS KO cells; G: UQCRC2 KO accelerates the protein degradation of GS; H: UQCRC2 affects the ubiquitination degradation pathway of GS; I: Ammonia level in UQCRC2 KO cells; J: Changes in ammonia level induced by UQCRC2 OE and GS KO.

[0025] Figure 7 The diagram shows the effects of UQCRC2 on the activation of hepatic stellate cells via GS. A: Bands of FN, α-SMA, GS, and UQCRC2 proteins in GS OE and UQCRC2 KO cells; B: Quantitative statistical graph of FN protein in Figure A; C: Quantitative statistical graph of α-SMA protein in Figure A; D: Quantitative statistical graph of GS protein in Figure A; E: Quantitative statistical graph of UQCRC2 protein in Figure A; F: Bands of FN and α-SMA proteins in UQCRC2 OE and GS KO cells; G: Quantitative statistical graph of FN protein in Figure F; H: Quantitative statistical graph of α-SMA protein in Figure F. Detailed Implementation

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0029] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example

[0032] 1. Construction of cell and animal models

[0033] Rat hepatic stellate cells (HSC-T6) and human hepatic stellate cells (LX-2) were purchased from Wuhan Pronosei Biotechnology Co., Ltd. Both HSC-T6 and LX-2 cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin, and incubated at 37°C in a 5% CO2 incubator. When the cells reached 80-90% confluence, they were digested with EDTA trypsin for 1 min, the trypsin was discarded, and complete culture medium was added and mixed thoroughly by pipetting. Cells were then seeded into plates at a density of 1.2 × 10⁶ cells per well. 6After culturing in the incubator for 24 h, discard the culture medium and replace it with DMEM incomplete medium without FBS and containing 1% P / S. All were set as the TGF-β group, and TGF-β (10 ng / mL) was given for stimulation. After 24 h, take out the six-well plate, discard the supernatant, and collect the cells for subsequent experiments.

[0034] Male adult C57BL / 6 mice at 6-8 weeks old (license number: SCXK[Shanghai]2022-0004) were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. The mice had free access to food and water, and the breeding environment temperature was 22-24 °C, and the humidity was 40%-60%. All mice were adaptively raised for one week before the experiment. All animal experiments were approved by the Animal Experiment Ethics Committee of Zhejiang Chinese Medical University, with the license SYXK(Zhejiang)2021-0012 and the approval number IACUC-20250331-03. The mice were randomly divided into a control group and a CCl4 group. The mice in the CCl4 group were subcutaneously injected with 40% olive oil CCl4 (6 mL / kg) once in the first week, and then subcutaneously injected with 40% olive oil CCl4 (3 mL / kg) twice a week for the following 7 weeks. The mice in the control group were given an equal amount of olive oil. After 8 weeks, the mice were anesthetized and sacrificed, and the serum and liver were collected for subsequent experiments.

[0035] For the grouping and treatment of BDL model animals: The mice were randomly divided into 2 groups: the sham operation group and the BDL operation group. Constructed by the conventional method, after 2 weeks, the mice were anesthetized and sacrificed, and the serum and liver were collected for subsequent experiments.

[0036] 2. Total protein extraction

[0037] 2.1 Total protein extraction from cells

[0038] Take out the six-well plate after cell drug treatment, remove the culture medium, add an appropriate amount of PBS for washing, remove the PBS, then add 500 μL of PBS to each well and scrape the cells with a cell scraper, repeat three times, collect the PBS containing cells in a centrifuge tube, and centrifuge at 4 °C and 5000 rpm for 5 min. Discard the supernatant, add an appropriate volume of RIPA lysis buffer (containing 1% PMSF), pipette and mix well, incubate on ice for 30 min, and vortex every 5 min during this period. After the incubation, place the centrifuge tube in a pre-cooled low-temperature centrifuge and centrifuge (15000 rpm, 4 °C) for 20 min, and take the supernatant, which is the total protein of the cells.

[0039] 2.2 Total protein extraction from liver tissue

[0040] Take liver samples stored at -80℃, weigh 30mg of liver tissue from each group into a 1.5mL centrifuge tube, and add 300μL of RIPA lysis buffer (containing 1% PMSF) to the centrifuge tube containing the liver tissue. Place the centrifuge tube in a pre-chilled tissue homogenizer to homogenize the liver tissue, then incubate on ice for 30min, vortexing every 5min. After incubation, centrifuge at 4℃ and 15000rpm for 15min, and collect the supernatant, which is the total protein of the liver tissue.

[0041] 3. Western blot experiment

[0042] Western blot experiments were performed on the extracted cell proteins or liver tissue proteins.

[0043] After rinsing the glass plates with ultrapure water using a traceless glass plate, align and clamp the two glass plates, add ultrapure water, and perform a leak check using the water seal method. Prepare a separating gel of appropriate concentration according to the target protein molecular weight, degas it by vortexing, and inject it into the gap between the glass plates, taking care not to absorb foam. Seal with pure water for 40 minutes. Discard the sealing solution, absorb excess pure water with clean filter paper, pour in a 5% stacking gel, insert a 10 / 15-well sample comb, and polymerize at room temperature for 30 minutes. Install the prepared gel into the electrophoresis tank and add diluted 1× electrophoresis buffer. Use a sample pipette tip to inject the denatured protein sample and protein marker into the wells. Initially, apply an voltage of 80V to allow the sample to pass through the stacking gel. Once the protein marker reaches the 70kDa indicator line, increase the voltage to 120V and continue electrophoresis until the indicator reaches the bottom of the gel. Use a wet transfer method: place the transfer tank in an ice-filled foam box and add pre-diluted 1× transfer buffer. PVDF membranes were activated with anhydrous methanol for 30 seconds. The transfer layers were assembled in the order of cathode side (black side) [sponge pad-filter paper-gel-PVDF membrane-filter paper-sponge pad], and transferred under constant voltage of 70V, maintaining a temperature of 4-6℃ in an ice bath throughout. After transfer, the PVDF membrane was immersed in 5% skim milk powder-TBST blocking solution and blocked on a shaker for 1 hour. The blocking solution was then discarded, and the membrane was washed three times with an appropriate amount of PBST solution, 5 min each time. Primary antibody diluted to its potency (using dedicated primary antibody diluent) was added, and the membrane was incubated overnight at 4℃ with shaking. The next day, the primary antibody was recovered, and the membrane was washed three times with PBST (10 min each time), and incubated with HRP-labeled secondary antibody at room temperature for 1 hour. Subsequently, the secondary antibody was recovered, and the membrane was washed three times with PBST (10 min each time). ECLA / B solution was mixed at a 1:1 ratio, and the PVDF membrane was immersed for 1 min before signal acquisition in a developer. The exposure time was dynamically adjusted according to the signal intensity.

[0044] 4. 4D Label-free quantitative proteomics analysis

[0045] Proteomic analysis was performed on liver cells and HSC-T6 cells in each group.

[0046] Samples were removed from -80℃, and an appropriate amount of tissue sample was weighed into a mortar pre-cooled with liquid nitrogen and ground thoroughly into powder. Four volumes of lysis buffer (8M urea, 1% protease inhibitor, 1% phosphatase inhibitor) were added to each group of samples (including tissue powder samples and cell samples), and the mixture was sonicated for lysis. The samples were centrifuged at 12000g for 10 min at 4℃ to remove cell debris, and the supernatant was transferred to a new centrifuge tube. Protein concentration was determined using a BCA kit. Equal volumes of protein from each sample were digested, and the volumes were adjusted to be consistent with the lysis buffer. A final concentration of 20% TCA was slowly added, vortexed, and the mixture was precipitated at 4℃ for 2 h. The mixture was centrifuged at 4500g for 5 min, the supernatant was discarded, and the precipitate was washed 2-3 times with pre-cooled acetone. After drying the precipitate, 200mM TEAB was added, and the precipitate was sonicated to disperse it. Trypsin was added at a ratio of 1:50 (protease: protein, m / m), and the mixture was incubated overnight. Dithiothreitol (DTT) was added to a final concentration of 5 mM, and reduction was performed at 56 °C for 30 min. Iodoacetamide (IAA) was then added to a final concentration of 11 mM, and incubation was carried out at room temperature in the dark for 15 min. The peptides were dissolved in mobile phase A of liquid chromatography and then separated using a NanoElute ultra-high performance liquid chromatography system. Mobile phase A was an aqueous solution containing 0.1% formic acid and 2% acetonitrile; mobile phase B was a solution containing 0.1% formic acid and 100% acetonitrile. The liquid phase gradient settings were: 0-70 min, 6%-24% B; 70-84 min, 24%-35% B; 84-87 min, 35%-80% B; 87-90 min, 80% B, with the flow rate maintained at 450 nL / min. After separation by the ultra-high performance liquid chromatography system, the peptides were injected into a Capillary ion source for ionization and then analyzed by timsTOF Pro mass spectrometry. The ion source voltage was set to 1.75 kV. High-resolution TOF was used to detect and analyze both the peptide precursor ion and its secondary fragments. The secondary mass spectrometry scan range was set to 400-1500 m / z. Parallel cumulative serial fragmentation (PASEF) mode was used for data acquisition. After a primary mass spectrometry acquisition, 10 PASEF scans were performed to acquire secondary spectra with precursor ion charges ranging from 0 to 5. The dynamic exclusion time for tandem mass spectrometry was set to 30 s to avoid duplicate scans of the precursor ion. Maxquant (v1.6.15.0) was used for protein search and identification, with the following search parameters: restriction enzyme method set to Trypsin / P; number of missed cleavage sites set to 2; minimum peptide length set to 7 amino acid residues; maximum number of peptide modifications set to 5; mass error tolerance for primary precursor ions in First search and Main search set to 20 ppm and 20 ppm, respectively; mass error tolerance for secondary fragment ions was 20 ppm. Cysteine ​​alkylation (Carbamidomethyl(C)) was set as a fixed modification, with alternative modifications including methionine oxidation and N-terminal acetylation. The FDR for both protein identification and PSM identification was set to 1%.

[0047] 5. Co-immunoprecipitation (Co-IP) assay

[0048] To explore the binding of GS to potential proteins in HSC-T6 cells.

[0049] Collect HSC-T6 cells (approximately 1 × 10⁻⁶) 7 (Number of samples) were washed twice with pre-chilled PBS, and 1 mL of WB and IP lysis buffer containing the protease inhibitor benzoyl fluoride (PMSF) was added. Lysis was performed on ice for 30 min, vortexing every 5 min to ensure complete protein release. The mixture was centrifuged at 12000×g for 15 min at 4°C, and the supernatant was collected as the total protein sample. To reduce non-specific binding, 50 μL of Protein A / G magnetic beads were added to the lysis buffer, and the mixture was incubated at 4°C for 1 h. After magnetic separation to remove the magnetic beads, the supernatant was retained. GS antibody (isotype IgG was used for the negative control group) was added at a 1:200 ratio for antibody-antigen reaction, and the mixture was incubated at 4°C for 12 h to ensure complete binding of the antibody to the target protein. 30 μL of Protein A / G magnetic beads were added, and the mixture was incubated at 4°C for 4 h to adsorb the antibody-antigen complex. After magnetic separation, the magnetic beads were washed four times with pre-chilled lysis buffer to thoroughly remove unbound protein. Add 40 μL of 1×SDS-PAGE loading buffer, boil at 95℃ for 5 min to dissociate the complex, centrifuge, and take the supernatant for SDS-PAGE electrophoresis and Western blotting analysis to detect the binding of GS and UQCRC2.

[0050] 6. Construction of GS / UQCRC2 knockout cell lines

[0051] The nucleotide sequence of UQCRC2 is shown in SEQ ID NO.1, and the nucleotide sequence of GS is shown in SEQ ID NO.2.

[0052] SEQ ID NO.1:

[0053]

[0054] SEQ ID NO.2:

[0055]

[0056] Guide RNA (sgRNA: 5'-aggtctcaagatcgacctagagg-3', SEQ ID NO.3) targeting the target sequence was designed using the CRISPR design tool (http: / / chopchop.cbu.uib.no / ). Lentiviral packaging vectors psPAX2 and VSV-G plasmid were transiently transfected into HEK (human embryonic kidney) 293T cells using PEI 40000. Eight hours after transfection, the culture medium containing the DNA-lipid complex was removed and replaced with normal culture medium. After 72 hours, the virus-containing supernatant was collected, concentrated with 5×PEG 8000, thoroughly mixed by inversion, and incubated overnight at 4°C. The next day, the virus was removed, centrifuged at 4800 rpm for 10 min on ice at 4°C, the supernatant was discarded, and the virus was resuspended in 400 μL of PBS. Polybrene was added to the culture medium, and 150 μL of the virus solution was slowly added dropwise to the plate. The medium was changed after 8 hours. After 24 hours, the knockout cell line (GS KO cells) was obtained by screening under the action of 0.5 μg / mL puromycin.

[0057] The method for constructing GS KO cells is the same as that for GS KO cells, except that a guide RNA targeting the target sequence (sgRNA: 5'-ggatgtaagacgcagcaaatggg-3', SEQ ID NO.4) was designed, and the lentiviral UQCRC2 CRISPR / Cas9 KO plasmid was used. HEK (human embryonic kidney) 293T cells were transiently transfected with the lentiviral packaging vector psPAX2 and the VSV-G plasmid using PEI 40000. The knockout cell line (UQCRC2 KO cells) was then selected.

[0058] We commissioned Beijing Qingke Biotechnology Co., Ltd. to construct a UQCRC2 overexpression plasmid carrying a Flag tag (nucleotide sequence GATTACAAGGATGACGACGATAAG, SEQ ID NO.5) and a GS overexpression plasmid carrying an HA tag (nucleotide sequence TACCCATACGATGTTCCAGATTACGCT, SEQ ID NO.6). The map of the UQCRC2 overexpression plasmid carrying the Flag tag is shown below. Figure 1 The map of GS overexpression plasmids carrying the HA tag can be found in [link to map]. Figure 2 .

[0059] LX-2 cells were seeded overnight in 10cm culture dishes. The next day, UQCRC2 overexpression plasmids carrying the Flag tag and GS overexpression plasmids carrying the HA tag were transfected into LX-2 cells, respectively. The medium was changed after 6-8 hours, and the cells were cultured in a 37°C, 5% CO2 cell culture incubator. After 24 hours, TGF-β (10ng / mL) was added to stimulate the cells. The culture was stopped 48 hours after transfection to obtain GS OE cells and UQCRC2 OE cells.

[0060] UQCRC2 KO cells were seeded overnight in 10cm culture dishes. The next day, GS overexpression plasmids carrying the HA tag were transfected into LX-2 cells. The medium was changed after 6-8 hours, and the cells were cultured in a 37°C, 5% CO2 cell incubator. After 24 hours, TGF-β (10ng / mL) was added to stimulate the cells. The culture was stopped 48 hours after transfection, thus constructing cells that overexpress GS in UQCRC2 KO cells.

[0061] The method is the same as that for constructing GS KO cells, except that the lentiviral GS CRISPR / Cas9 KO plasmid is used. The lentiviral packaging vector psPAX2 and VSV-G plasmid are transiently transfected into UQCRC2 OE cells using PEI 40000, and cells with GS knocked out in UQCRC2 OE cells are screened.

[0062] LX-2 cells were seeded overnight in 10cm culture dishes. The next day, UQCRC2 overexpression plasmids carrying the Flag tag and GS overexpression plasmids carrying the HA tag were co-transfected into LX-2 cells. The medium was changed after 6-8 hours, and the cells were cultured in a 37°C, 5% CO2 cell culture incubator. After 24 hours, TGF-β (10ng / mL) was added to stimulate the cells, and culture was stopped 48 hours after transfection. Cell immunofluorescence double staining was performed using Flag antibody and HA antibody, followed by laser confocal immunofluorescence analysis.

[0063] 7. Treatment with cycloheximine (CHX), MG132, and chloroquine (CQ)

[0064] For treatment with the protein synthesis inhibitor CHX, UQCRC2 KO cells were treated with 50 μg / mL CHX at specified time points (0, 4, 8, 12, 24 h). For treatment with the proteasome inhibitor MG132 and the lysosome inhibitor CQ, UQCRC2 KO cells were treated with 25 μM MG132 or 25 μM CQ for 6 h.

[0065] 8. Dansyl chloride derivatization reaction

[0066] Weigh 50 mg of liver and add 1 mL of 80% methanol homogenate. After complete tissue lysis, vortex to mix, incubate at 4°C for 10 min, and centrifuge at 15000g for 10 min at 4°C. Collect the supernatant and concentrate by centrifugation. Prepare 1.5 mL centrifuge tubes in advance. Remove the cell culture dishes from the incubator and aspirate the culture medium using a vacuum aspirator. Slowly pour 5 mL of pre-cooled 0.9% physiological saline into each culture dish, gently shake to clean, and aspirate the physiological saline. Repeat the above steps with 5 mL of physiological saline to wash again. Add 1 mL of extraction reagent (80% methanol, with 1 μg internal standard added, pre-cooled) to each dish, and sonicate to disrupt the cells (ice bath, 200W power, sonication for 10 s, 10 s interval, repeated twice). Centrifuge at 15000g at 4°C for 10 min and collect the supernatant. Liver samples with evaporated solvent were collected, and 50 μL of 5 mg / mL dansyl chloride acetonitrile solution and equal volumes of 0.15 mol / L Na₂CO₃ and NaHCO₃ aqueous solutions were added for amine metabolite derivatization. After vortexing for 1 min, the mixture was reacted in a 60°C water bath for 50 min. Then, 30 μL of 0.5 mol / L butylamine aqueous solution was added, and the mixture was reacted in a 60°C water bath for 40 min. Finally, the mixture was centrifuged at 15000 g for 10 min at 4°C, and the supernatant was used for LC-MS analysis.

[0067] 9. UPLC-Q-TOF / MS Instrument Conditions

[0068] Amine metabolites were analyzed in liver tissue and cell samples using ultra-high performance liquid chromatography-tandem quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF-MS). Chromatographic conditions: HSS T3 column (2.1 mm × 100 mm, 1.8 μm), column temperature 60 °C, injection chamber temperature 4 °C, injection volume 5 μL. Mobile phase A was an aqueous solution of 0.1% formic acid (v / v), and mobile phase B was an acetonitrile solution of 0.1% formic acid (v / v). Gradient elution conditions: 0–2 min, 2% B; 2–20 min, 2–80% B; 20–28 min, 80–100% B; 28–29 min, 100% B; 29–29.1 min, 100–2% B; 29.1–32 min, 2% B. Flow rate was 0.35 mL / min, and the post-column eluent was directly introduced into the mass spectrometry system for detection without splitting. Mass spectrometry conditions: Mass spectrometry analysis was performed using a SCIEX ZenoTOF 7600 system with an electrospray ionization (ESI) source and positive ion mode. Instrument calibration was performed using an automated calibrator delivery system, with ESI calibration solution used for every 5 samples. In positive ion mode, the spray voltage was 5.5 kV, the ion source temperature was set to 550 °C, the flow rate of ion source gas 1 was 55 psi, the flow rate of auxiliary heating gas 2 was 55 psi, the curtain gas flow rate was 35 psi, and the CAD gas flow rate was 8 units. The mass spectrometry scan range was 80–1100 m / z, and the mass spectrometry resolution was set to 60,000. Acquired data were used for qualitative and quantitative analysis using PeakView software version 1.2.0.3 (AB SCIEX).

[0069] 10. Statistical Analysis

[0070] Experimental data were statistically processed using GraphPad Prism (GraphPad Software, San Diego, CA, USA) software. Data are expressed as mean ± SD. T-test and ANOVA were used for difference analysis, and P < 0.05 was considered statistically significant.

[0071] 11. Experimental Results

[0072] 11.1 Quantitative proteomics revealed a significant decrease in GS in liver fibrosis.

[0073] This invention uses a CCl4-induced mouse hepatocyte injury model to simulate in vivo liver fibrosis. Experimental results show that CCl4 can cause significant liver damage and fibrosis, accompanied by increased alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Figure 3 China A- Figure 3(B); Histopathological results showed that, compared with the normal group, the CCl4 group of mice exhibited significant inflammatory cell infiltration and collagen deposition in the liver. Figure 3 The above results (C) confirm the success of establishing a mouse model of liver fibrosis.

[0074] To identify novel therapeutic targets that regulate the progression of liver fibrosis, this invention performed proteomic analysis on CCl4-induced fibrotic mouse liver samples and TGF-β-induced HSC-T6 cells. Analysis of differentially expressed proteins, combined with heatmap visualization, revealed that among the top 15 proteins with the most significant changes, GS (i.e., GLUL) was continuously downregulated both in vitro and in vivo. Figure 3 D- Figure 3 (Middle F). Consistent with proteomics results, Western blotting experiments confirmed that in CCl4-induced fibrosis mice and BDL-induced fibrosis mice ( Figure 3 China G and Figure 3 In both intermediate I) and activated HSCs cells, the level of liver GS protein was decreased ( Figure 3 H and Figure 3 (J).

[0075] The absence of 11.2GS leads to the accumulation of ammonia and glutamate, as well as reduced glutamine synthesis.

[0076] GS catalyzes the formation of glutamine from glutamic acid and free ammonia. Figure 4 (A). In mice with liver fibrosis induced by CCl4 or BDL modeling, GS activity was significantly reduced ( Figure 4 China B- Figure 4 (C). Liver samples were treated with dansyl chloride derivatization, and the relative contents of ammonia, glutamate, and glutamine were detected by LC-MS. The results showed that ammonia and glutamate accumulated, while glutamine synthesis decreased. Figure 4 D- Figure 4 (E), which is consistent with the function of GS in synthesizing glutamine from glutamate and ammonia. Similar results were found in GS KO cells and TGF-β-induced LX-2 cells in vitro, consistent with the detection method in the liver. Figure 4 China F- Figure 4 (G).

[0077] 11.3GS deficiency leads to ammonia accumulation, which exacerbates the progression of liver fibrosis.

[0078] As products directly affected by GS (glucose oxidase), which has a greater impact on liver fibrosis: ammonia or glutamine? To address this issue, this invention supplemented NH4Cl and glutamine into an in vivo CCl4-induced liver fibrosis model. It was found that NH4Cl exacerbated liver fibrosis to a degree similar to, or even more severely than, the GS inhibitor MSO group. Compared to the CCl4 group, glutamine supplementation did not significantly improve liver fibrosis. Figure 5 China A- Figure 5 (C). Meanwhile, in vitro glutamine supplementation did not alleviate the activation of hepatic stellate cells (C). Figure 5 (D), while NH4Cl can significantly promote the activation of hepatic stellate cells (D). Figure 5 (E). The above results suggest that liver fibrosis and hepatic stellate cell activation caused by GS deficiency are largely related to ammonia accumulation.

[0079] 11.4UQCRC2 regulates GS-mediated biological activities by stabilizing GS.

[0080] To further investigate the mechanism of GS loss during liver fibrosis, this invention employed immunoprecipitation (IP) and LC-MS / MS screening methods to explore the binding of GS to potential proteins in HSC-T6 cells. Figure 6 China A- Figure 6 (B) After stimulating HSC-T6 cells with TGF-β, cellular proteins were extracted, and then a Co-IP experiment was performed with GS-specific antibody (IP) and a negative control (IgG). The results showed that GS can intrinsically bind to UQCRC2 protein, and TGF-β stimulation weakened this interaction. Figure 6 C- Figure 6 (D).

[0081] To further elucidate its potential molecular mechanism, this invention investigated whether a regulatory relationship exists between UQCRC2 and GS. In LX-2 cells with UQCRC2 knockout, GS expression was reduced (…). Figure 6 In contrast, UQCRC2 expression was unaffected after GS KO (E). Figure 6 This may be because GS can be regulated by UQCRC2, while UQCRC2 is not affected by GS. To investigate whether UQCRC2 affects the stability of GS protein, this invention used cyclohexylimide (CHX) to block protein synthesis and detected the protein level of GS. Compared with the control group, the stability of GS in UQCRC2 KO cells was significantly reduced (F). Figure 6 The presence of UQCRC2 (G) indicates that UQCRC2 is crucial for maintaining GS stability.

[0082] To determine the specific pathway of GS degradation, this invention treated UQCRC2 KO LX-2 cells with the proteasome inhibitor MG132 and the lysosomal inhibitor chloroquine (CQ). The results showed that MG132 had a stronger cumulative effect on GS than CQ, indicating that UQCRC2KO reduces GS stability through the ubiquitin-proteasome degradation pathway. Figure 6 (H).

[0083] Further investigation into whether UQCRC2 affects the activity of GS revealed a significant increase in ammonia content after UQCRC2 KO, indicating that UQCRC2 can influence the activity of GS. Figure 6 To explain whether UQCRC2 affects ammonia content through GS, this invention overexpressed UQCRC2 in GS KO cells, used dansyl chloride derivatization, and detected the relative ammonia content by LC-MS. Figure 6 (J). The results showed that GS KO could partially offset the ammonia changes induced by UQCRC2 overexpression, suggesting that UQCRC2 may further influence the relative changes in ammonia through GS.

[0084] 11.5 UQCRC2 inhibits hepatic stellate cell activation by regulating GS.

[0085] To investigate whether UQCRC2 can affect hepatic stellate cell activation by regulating GS, this invention transfected UQCRC2KO cells with a GS overexpression plasmid carrying an HA tag. Western blot results showed that GS overexpression reduced the protein expression of liver fibrosis markers FN and α-SMA induced by UQCRC2 KO. This indicates that GS overexpression can inhibit the promoting effect of UQCRC2KO on hepatic stellate cell activation. Figure 7 China A- Figure 7 (E). Although UQCRC2 overexpression can alleviate hepatic stellate cell activation, knocking out GS on this basis increased the protein expression of liver fibrosis markers FN and α-SMA. Figure 7 China F- Figure 7 (H). This indicates that knocking out GS can partially counteract the inhibitory effect of UQCRC2 overexpression on hepatic stellate cell activation. The results suggest that UQCRC2 may exert its inhibitory effect on hepatic stellate cell activation by affecting GS expression.

[0086] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The use of preparations that overexpress UQCRC2 or GS in the preparation of drugs for the prevention and / or treatment of liver fibrosis.

2. The application as described in claim 1, characterized in that, The UQCRC2 exerts its role in preventing and / or treating liver fibrosis by inhibiting the activation of hepatic stellate cells.

3. The application as described in claim 2, characterized in that, The UQCRC2 can affect the activation of hepatic stellate cells by influencing the expression of GS.

4. The application as described in claim 1, characterized in that, The formulation overexpressing UQCRC2 or GS comprises cells overexpressing UQCRC2 or GS.

5. A drug for the prevention and / or treatment of liver fibrosis, characterized in that, The active ingredient is a formulation that overexpresses UQCRC2 or GS.

6. The drug as described in claim 5, characterized in that, Preparations that overexpress UQCRC2 or GS include cells that overexpress UQCRC2 or GS.

7. The drug as described in claim 5, characterized in that, The UQCRC2 exerts its role in preventing and / or treating liver fibrosis by inhibiting the activation of hepatic stellate cells.

8. The drug as described in claim 7, characterized in that, The UQCRC2 can affect the activation of hepatic stellate cells by influencing the expression of GS.

9. The drug as described in claim 5, characterized in that, It also contains pharmaceutically acceptable excipients.

10. The medicament as claimed in claim 9, characterized in that, The excipients include at least one of the following: diluent, filler, excipient, binder, humectant, disintegrant, absorption promoter, surfactant, adsorbent carrier, lubricant, and flavoring agent.