Coxsackinia cocori Kos-10 and application of coxsackinia cocori Kos-10

By screening out Kos-10, a bacterium with nitrogen-fixing, phosphorus-solubilizing, potassium-solubilizing, iron-carrier-producing, and disease-suppressing functions, the problems of pathogen resistance caused by chemical fungicides and the suppression of the effects of plant growth-promoting bacteria in existing technologies have been solved, achieving green and efficient control of bacterial wilt and promotion of plant growth.

CN120843326APending Publication Date: 2025-10-28SOUTH CHINA AGRICULTURAL UNIVERSITY

Patent Information

Application Number
CN202510835807.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

Current technologies for controlling bacterial wilt of mulberry trees rely on chemical fungicides, which leads to increased drug resistance in pathogens and suppresses the effectiveness of plant growth-promoting bacteria under pathogen invasion, making it difficult to achieve green and efficient control.

Method used

A strain of *Sacchariformis*, Kos-10, was screened out. This strain has the ability to fix nitrogen, solubilize phosphorus, solubilize potassium, produce siderophores, and inhibit *Raulella solanaceae*. It was used to prepare microbial preparations for promoting plant growth and controlling diseases under bacterial wilt stress.

Benefits of technology

The Kos-10 strain can effectively provide plants with the nutrients nitrogen, phosphorus, potassium and iron, while inhibiting the growth of Solanaceae Raulella and preventing bacterial wilt. It shows broad application prospects and development value, providing new microbial resources and technical pathways for green agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843326A_ABST
    Figure CN120843326A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganisms. The invention relates to a coxakella cocori Kos-10 strain, in particular to a coxakella cocori Kos-10 strain and application thereof. The invention discloses a Cosakya cokei Kos-10 strain which is preserved in the Guangdong Microbial Culture Collection Center on June 5, 2025, and the preservation number of the Cosakya cokei Kos-10 strain is GDMCC (China General Microbiological Culture Collection Center) NO: 66468. The Cosakya cokei Kos-10 strain has been preserved in the Guangdong Microbial Culture Collection Center on June 5, 2025. The strain has the capabilities of fixing nitrogen, dissolving phosphorus, dissolving potassium and producing siderophores, can be used as a growth-promoting bacterium for promoting plant growth, provides nutrient elements of nitrogen, potassium and iron for plants, and also can prevent and treat bacterial wilt of the plants. The Kos-10 strain disclosed by the invention is comprehensive in growth promoting effect, and has a good application prospect and application value in the aspect of promoting plant growth under the stress of bacterial wilt.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial technology. More specifically, it relates to a strain of Coccidioides sacchariformis Kos-10 and its applications. Background Technology

[0002] Mulberry leaves are not only the main food source for the oligophagous insect, the silkworm, but also an important plant with both medicinal and edible value. As a crucial foundation for the sustainable development of my country's sericulture industry, the mulberry tree occupies a pivotal position in agricultural production. However, mulberry diseases have long constrained the healthy and stable development of the mulberry industry, with fungal and bacterial diseases being the most common, severely impacting mulberry yield and quality.

[0003] Plant diseases cause approximately 220 billion yuan in losses to the global economy annually, resulting in crop yield reductions typically between 13% and 22%, and in severe cases, as high as 80% to 98%. Bacterial wilt is one of the most destructive diseases, causing more than 1 billion US dollars in economic losses globally each year. This disease has been listed as a key quarantine pest by the Chinese Ministry of Agriculture and Rural Affairs and many other countries. Bacterial wilt, also known as bacterial wilt or bacterial rot, is a soil-borne disease caused by bacteria and is widely recognized as one of the most difficult bacterial plant diseases to control in the world. The pathogens mainly include Ralstonia solanacearum species complex (RSSC), Enterobacter cloacae complex (ECC), Klebsiella pneumoniae species complex (KpSC), Klebsiella oxytoca complex (KoC), and Pantoea ananatis (Pa), among other pathogens and opportunistic pathogens. This disease primarily occurs in tropical and warm temperate regions, and is known to infect over 450 species of plants from more than 50 plant families and genera, exhibiting a wide host range and causing serious damage.

[0004] Currently, the control of bacterial wilt still mainly relies on the application of chemical fungicides and antibiotics, such as streptomycin sulfate and triazole thiazide. However, the long-term use of these drugs not only exacerbates the development of drug resistance in pathogens but also poses potential threats to agricultural ecosystems and human health. With the growing prominence of antibiotic resistance, finding safe and effective alternative control strategies has become a research hotspot.

[0005] Against this backdrop, plant growth-promoting bacteria (PGPB) have attracted widespread attention due to their potential in promoting plant growth, enhancing stress resistance, and inhibiting pathogens. Studies have shown that various rhizosphere microorganisms, such as *Streptomyces*, *Pseudomonas*, and *Bacillus*, can enhance plant disease resistance through multiple mechanisms. However, when plants are attacked by pathogens, the growth-promoting effect of PGPB is often suppressed, making it difficult for them to exert their intended function, which limits their application in practical production.

[0006] In recent years, relevant studies have explored the use of plant growth-promoting bacteria to alleviate abiotic stress and promote crop growth. For example, Chinese patent CN117050915A reported a strain of *Kosakonia cowstofii* MD10, which can synthesize plant growth regulators (IAA) and secrete siderophores, helping to alleviate the toxic effects of copper ions on pepper seeds and significantly improving seed germination rate and seedling growth indicators. Pot experiments further confirmed that this strain can effectively increase the biomass of pepper seedlings. However, the function of this strain is relatively limited, limited to the production of IAA and siderophores, and its effect on addressing nutrient stresses such as phosphorus and nitrogen deficiency is limited, and it does not have the ability to inhibit bacterial wilt. Therefore, it is urgent to screen and develop plant probiotics with broader adaptability and both growth-promoting and disease-suppressing functions to achieve a green, efficient, and sustainable agricultural development path. Summary of the Invention

[0007] The present invention aims to screen for biological resources that can promote growth and prevent bacterial wilt, and provides a strain of Kosakonia cowanii Kos-10.

[0008] The first objective of this invention is to provide a strain of Kosakonia cowanii Kos-10.

[0009] A second objective of this invention is to provide a microbial preparation.

[0010] A third objective of this invention is to provide the application of the aforementioned Coccidia sacchariformis Kos-10 and the aforementioned microbial preparation.

[0011] The fourth objective of this invention is to provide a method for promoting plant growth under bacterial wilt stress.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution:

[0013] This invention provides a strain of Kosakonia cowanii Kos-10, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on June 5, 2025, with the accession number GDMCC NO: 66468.

[0014] The present invention provides a microbial preparation containing the above-mentioned Coccidia sacchariformis Kos-10 or its fermentation broth.

[0015] This invention provides a microbial preparation containing the fermentation product of the aforementioned Coccidia sacchariformis Kos-10.

[0016] The fermentation broth refers to the fermentation broth obtained by fermenting Kos-10 of Coccidioides sacchariformis in a culture medium.

[0017] The fermentation product refers to the product obtained after removing the bacterial cells from the fermentation broth.

[0018] This invention has screened and obtained a strain of *Kosakonia cowanii*, Kos-10, which possesses the abilities of nitrogen fixation, phosphorus solubilization, potassium solubilization, siderophore production, inhibition of *Rahuella hygroscopica* (a member of the Solanaceae family), and control of bacterial wilt. Therefore, this invention provides the following application solutions:

[0019] The application of the above-mentioned Kos-10 strain of Coccinella korshinskii or the above-mentioned microbial preparations in promoting plant growth.

[0020] The application of the above-mentioned Coccidiopsis sacchariformis Kos-10 or the above-mentioned microbial preparation in the preparation of products that promote plant growth.

[0021] The application of the aforementioned Coccidiopsis sacchariformis Kos-10 or the aforementioned microbial preparations in the production of siderophores.

[0022] The application of the above-mentioned Coccidia sacchariformis Kos-10 or the above-mentioned microbial preparation in the preparation of products for producing siderophores.

[0023] The application of the above-mentioned Coccidia sacchariformis Kos-10 or the above-mentioned microbial preparations in the preparation of iron-containing products.

[0024] The application of the above-mentioned Coccidiopsis sacchariformis Kos-10 or the above-mentioned microbial preparations in nitrogen fixation,

[0025] The application of the above-mentioned Coccidia sacchariformis Kos-10 or the above-mentioned microbial preparation in the preparation of products with nitrogen-fixing capabilities.

[0026] The application of the above-mentioned Coccidiopsis Sacchariformis Kos-10 or the above-mentioned microbial preparations in phosphate solubilization.

[0027] The application of the above-mentioned Coccidia sacchariformis Kos-10 or the above-mentioned microbial preparation in the preparation of products with phosphorus-solubilizing ability.

[0028] The application of the above-mentioned Coccidiopsis Sacchariformis Kos-10 or the above-mentioned microbial preparations in potassium solubilization.

[0029] The application of the above-mentioned Coccidia sacchariformis Kos-10 or the above-mentioned microbial preparation in the preparation of products with potassium-solubilizing ability.

[0030] The application of the above-mentioned Kos-10 strain of Coccidia sacchariformis or the above-mentioned microbial preparations in inhibiting Raulella solanaceae or preventing bacterial wilt.

[0031] The application of the above-mentioned *Codonopsis sacchariformis* Kos-10 or the above-mentioned microbial preparation in the preparation of products inhibiting *Raylorhizium anisopliae* (of the Solanaceae family).

[0032] The application of the above-mentioned Coccidioides sacchariformis Kos-10 or the above-mentioned microbial preparations in the preparation of products for the prevention and control of bacterial wilt.

[0033] The present invention also provides a method for promoting plant growth under bacterial wilt stress, by treating the plants with the above-mentioned Kos-10 bacteria or the above-mentioned microbial preparation.

[0034] As an alternative implementation, plants are treated with the fermentation broth of *Coccobacillus sacchariformis* Kos-10, with a concentration of not less than 10. 8 CFU / mL.

[0035] As an alternative implementation, the fermentation broth is the fermentation broth of Coccidia sacchariformis Kos-10 fermented in NA medium.

[0036] The present invention has the following beneficial effects:

[0037] This invention isolates and identifies a strain of *Kosakonia cowanii*, Kos-10, which possesses both growth-promoting and biocontrol functions. This strain exhibits nitrogen fixation, phosphorus solubilization, potassium solubilization, and siderophore production capabilities. As a growth-promoting bacterium, it can promote plant growth, providing plants with the essential nutrients nitrogen, phosphorus, potassium, and iron. Simultaneously, it inhibits the growth of *Rayloria solanaceae*, thereby controlling bacterial wilt. The Kos-10 strain of this invention effectively controls bacterial wilt while promoting plant growth, demonstrating broad application prospects and development value. It provides a new microbial resource and technical approach for green agriculture and sustainable disease management. Attached Figure Description

[0038] Figure 1Figure 1 shows the nitrogen fixation activity of the Kos-10 strain (Figure 2 shows the growth of Kos-10 on a nitrogen-free medium by streak plating; Figure 3 shows the growth of Kos-10 on a combined nitrogen-fixing medium by streak plating; Figure 4 shows the growth of Kos-10 on a nitrogen-free medium by spot inoculation; Figure 5 shows the growth of Kos-10 on a combined nitrogen-fixing medium by spot inoculation).

[0039] Figure 2 The diagram shows the phosphorus solubility of Kos-10 strain (Figure a shows the growth of Kos-10 in streak culture on inorganic phosphorus medium; Figure b shows the growth of Kos-10 in inoculated culture on inorganic phosphorus medium; Figure c shows the growth of Kos-10 in inoculated culture on inorganic phosphorus medium).

[0040] Figure 3 Figure 1 shows the potassium-solubilizing effect of Kos-10 strain (Figure 2 shows the growth of Kos-10 in streak culture on potassium-solubilizing bacteria solid medium; Figure 3 shows the growth of Kos-10 in spot inoculation culture on potassium-solubilizing bacteria solid medium; Figure 4 shows the growth of Kos-10 in streak culture on silicate bacteria medium; Figure 5 shows the growth of Kos-10 in spot inoculation culture on silicate bacteria medium).

[0041] Figure 4 The diagram shows the siderophore production process of Kos-10 strain (Figure a shows the growth of Kos-10 after inoculation in CAS medium; Figure b shows the growth of Kos-10 after spot inoculation in CAS medium).

[0042] Figure 5 The colony morphology of Kos-10 strain on NA medium plates.

[0043] Figure 6 Gram staining results for Kos-10 strain.

[0044] Figure 7 The results of the antagonistic experiment between Kos-10 strain and *Raurus spp.* (Figure a shows the antagonistic effect of Kos-10 on *R-YLXTK-5* strain of *Cymbidium goeringii*; Figure b shows the antagonistic effect of Kos-10 on *R-Lj-26* strain of *Pepper*; Figure c shows the antagonistic effect of Kos-10 on *R-Fq-32* strain of *Tomato*; Figure d shows the antagonistic effect of Kos-10 on *R-YC-6* strain of *Tobacco*; Figure e shows the antagonistic effect of Kos-10 on *R-Hs-8* strain of *Peanut*).

[0045] Figure 8The results of a pot experiment on the control of bacterial wilt of mulberry by strain Kos-10 are shown (Figure A shows the results of sterile water treatment; Figure B shows the results of Kos-10 bacterial solution treatment; Figure C shows the results of Kos-10 bacterial solution + Solanaceae Raulella bacterial solution treatment; Figure D shows the results of Solanaceae Raulella bacterial solution treatment). Detailed Implementation

[0046] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0047] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0048] Sample collection: Roots, stems and new shoots of healthy mulberry trees of the variety Sha 2 × Lun 109 were collected from the mulberry orchard of Huazhong Agricultural University.

[0049] The reagents used in the following examples are: Gram staining kit from Beijing Solarbio Science & Technology Co., Ltd.; biochemical identification tubes from Guangdong Huankai Microbial Technology Co., Ltd.; 2×CTAB extraction buffer from Beijing Dingguochangsheng Biotechnology Co., Ltd.; TE buffer (pH 8.0), sterilized dd H2O, ethanol, and 2×Taq HiFi PCR mix (with blue dye) from Sangon Biotech (Shanghai) Co., Ltd.

[0050] The culture media used in the following examples: LB agar (LB solid medium), LB broth (with sugar), LB broth (without sugar), beef extract peptone (NA) medium, NB medium, and physiological and biochemical medium were all purchased from Guangdong Huankai Microbial Technology Co., Ltd.; nitrogen-free medium, combined nitrogen-fixing medium, Assab broth for nitrogen-fixing bacteria, inorganic phosphorus bacteria medium, inorganic phosphorus liquid medium, organic phosphorus bacteria medium, silicate bacteria medium, and CAS detection medium were all purchased from Qingdao Haibo Biotechnology Co., Ltd.; and potassium-solubilizing bacteria solid medium was purchased from Beijing Coollab Technology Co., Ltd.

[0051] The method for isolating and purifying endophytic bacteria from mulberry rhizomes in Example 1 refers to the method described in the reference "Isolation and Identification of Endophytic Fungi of Mulberry and Pathogenic Fungi of Alfalfa in Shaanxi Province [D]. Northwest A&F University, Liang Jiajun. 2018".

[0052] The methods for Gram staining, morphological observation and biochemical identification in Example 3 were based on the references "Manual of Systematic Identification of Common Bacteria [M]. Science Press, Dong Xiuzhu and Cai Miaoying. 2001." and "Bergey's Manual of Bacterial Identification. 8th Edition [M]. Science Press, Buchanan and Gibbons. 1984.".

[0053] The *Raulella solanaceae* strains used in the embodiments of this invention, namely *Raulella solanaceae* strain R-YLXTK-5 (host of night-blooming jasmine), strain R-Lj-26 (host of chili pepper), strain R-Fq-32 (host of tomato), strain R-Yc-6 (host of tobacco), strain R-Hs-8 (host of peanut), and strain Rm-35 (host of mulberry), are all preserved in the inventor's laboratory.

[0054] Example 1: Isolation and purification of endophytic bacteria from mulberry rhizomes

[0055] Twenty-nine samples of mulberry roots, stems, and new shoots from the mulberry variety Sha 2 × Lun 109 were cleaned with tap water, dried, and the branches were cut into 3cm sections. Under sterile conditions, the cut roots and stems were disinfected with 75% ethanol for 3 minutes, and the new shoots were disinfected with alcohol for 30 seconds and then rinsed four times with sterile water. The cut roots and stems were then disinfected with 0.1% mercuric chloride solution for 5 minutes, and the new shoots were disinfected with 0.1% mercuric chloride solution for 1 minute. Finally, they were rinsed five times with sterile water.

[0056] After blotting the surface moisture of the mulberry root and stem samples with sterile filter paper, cut off both ends. Split the remaining section in half lengthwise and remove the xylem. Under sterile conditions, cut the xylem into 0.1 cm³ pieces with scissors, place them in 10 mL of sterile water, and shake in a shaker at 28°C and 140 rpm for 15–30 min to obtain a bacterial suspension containing endophytic bacteria. Using a 10-fold serial dilution method, the bacterial suspension was serially diluted 8 times to obtain a dilution factor of 10. -1 ~10 -8 The bacterial culture dilution. Take 100 μL of each of the 10... -1 ~10 -8 The bacterial suspension was diluted and evenly spread on LB and NA agar plates using a spreader, with each dilution repeated three times. The plates were then incubated upside down in a 28°C incubator for 2 days. Single colonies of different morphologies were picked and streaked onto LB agar plates for purification to obtain pure strains, which were then stored in glycerol tubes at -80°C.

[0057] Example 2: Detection and Screening of Growth-Promoting Characteristics of Endophytic Fungi in Mulberry Trees

[0058] I. Experimental Methods

[0059] The growth-promoting ability of endophytic bacteria isolated from the rhizomes of mulberry trees was tested using nitrogen-free culture medium, inorganic phosphorus-soluble bacteria culture medium, potassium-solubilizing bacteria solid culture medium, and CAS detection medium. Then, their abilities in nitrogen fixation, phosphorus solubilization, potassium solubilization, and siderophore production were combined to evaluate and screen growth-promoting bacteria.

[0060] (1) Nitrogen fixation characteristics analysis

[0061] The bacteria isolated and purified in Example 1 were streaked and spot-inoculated on nitrogen-free medium and combined nitrogen-fixing medium. After the plates were sealed, they were placed in a constant temperature incubator at 28°C for culture. The growth of bacteria on each nitrogen-fixing medium was observed. Strains that could grow on nitrogen-free medium were identified as nitrogen-fixing bacteria with nitrogen-fixing function.

[0062] (2) Analysis of phosphorus solubility characteristics

[0063] The bacteria isolated and purified in Example 1 were streaked and dotted on phosphate-solubilizing bacterial culture media (inorganic phosphorus bacteria culture media and organic phosphorus bacteria culture media). After the plates were sealed, they were placed in a constant temperature incubator at 28°C for culture, and the growth of the bacteria on each phosphate-solubilizing bacterial culture medium was observed.

[0064] In addition, the phosphorus-solubilizing ability of the isolated mulberry endophytic bacteria was detected using the phosphorus-solubilizing zone method. Single colonies of the isolated and purified bacteria were picked and cultured in nutrient broth (NB) medium at 28℃ and 180 rpm for 3 days to obtain the bacterial fermentation broth. Using a perforator, 5 mm diameter wells were evenly punched on an inorganic phosphorus bacteria medium plate. Then, 50 μL of the prepared bacterial fermentation broth was added to each well. After addition, the plate was placed in a 28℃ incubator for cultivation. The formation of a transparent phosphorus-solubilizing zone around the inoculated bacterial solution was observed. Strains that formed a transparent phosphorus-solubilizing zone were identified as phosphorus-solubilizing bacteria.

[0065] (3) Potassium solubilization characteristics analysis

[0066] The bacteria isolated and purified in Example 1 were streaked and spot-inoculated on solid culture medium for potassium-solubilizing bacteria with potassium feldspar as the potassium source and on silicate bacteria culture medium with glass powder as the potassium source, respectively. After sealing, the plates were placed in a constant temperature incubator at 28°C for culture, and the growth of the strains was observed. The strains that could grow on solid culture medium for potassium-solubilizing bacteria and silicate bacteria culture medium plates were identified as potassium-solubilizing bacteria with potassium-solubilizing ability.

[0067] (4) Analysis of the characteristics of iron-producing carriers

[0068] The bacteria isolated and purified in Example 1 were cultured by punching holes and adding bacterial solution on CAS detection medium plates and by spot injection culture. After sealing, the plates were placed in a constant temperature incubator at 28°C. The presence of orange-yellow halos around the strains was observed. Bacteria that formed orange-yellow halos were identified as siderogenic bacteria with siderogenic function.

[0069] 2. Experimental Results

[0070] This invention screened a growth-promoting bacterium with nitrogen fixation, phosphorus solubilization, potassium solubilization, and siderophore production functions by detecting nitrogen fixation, phosphorus solubilization, potassium solubilization, and siderophore production. This growth-promoting bacterium strain was named Kos-10.

[0071] (1) Diagram of nitrogen fixation in Kos-10 strain as shown in the figure. Figure 1 As shown, the results indicate that the Kos-10 strain can thrive in nitrogen-free medium (…). Figure 1 Figure a), combined nitrogen-fixing medium ( Figure 1 It can grow on both (Figure b) and nitrogen-free medium (Figure b). Figure 1 (Figure c) and combined nitrogen-fixing medium ( Figure 1 The formation of a transparent zone after spot inoculation (Figure d) indicates that the Kos-10 strain has nitrogen-fixing activity.

[0072] (2) Phospholysis of Kos-10 strain is shown in the diagram. Figure 2 As shown, the results indicate that the Kos-10 strain can thrive on inorganic phosphorus bacteria culture medium (…). Figure 2 It grew on (Figure a) and was cultured in an inorganic phosphorus-free bacterial medium with perforated cells and bacterial suspension (Figure a). Figure 2 (Figure b) and spot inoculation culture ( Figure 2 The formation of a transparent phosphate-solubilizing zone in Figure c indicates that the Kos-10 strain has phosphate-solubilizing activity.

[0073] (3) Diagram of potassium solubilization activity of Kos-10 strain as shown in the figure. Figure 3 As shown, the results indicate that the Kos-10 strain can thrive on potassium-solubilizing bacteria solid culture medium (…). Figure 3 Figures a and b) and silicate bacteria culture medium ( Figure 3 The Kos-10 strain showed good growth in both Figures c and d, indicating that it has potassium-solubilizing ability.

[0074] (4) The siderophore production function of Kos-10 strain is shown in the diagram. Figure 4 As shown, the results indicate that the Kos-10 strain, after being inoculated with bacterial culture and perforated on CAS detection medium plates (with holes punched in place), showed that... Figure 4 (Figure a) and spot vaccination ( Figure 4 (Figure b) After cultivation, orange-yellow halos appeared around the strain, indicating that the Kos-10 strain has the ability to produce siderophores.

[0075] In summary, the growth-promoting characteristics of the Kos-10 strain are shown in Table 1. The results indicate that the Kos-10 strain has the ability to biologically fix nitrogen, solubilize phosphorus, solubilize potassium, and produce iron carriers.

[0076] Table 1. Growth-promoting characteristics of Kos-10 strain

[0077]

[0078] Note: +++ indicates that the effect is very good, ++ indicates that the effect is good, + indicates that the effect is average, and - indicates that there is no effect.

[0079] Example 3 Identification of Kos-10 strain

[0080] I. Experimental Methods

[0081] (1) The Kos-10 strain of Example 2 was inoculated into NA medium and cultured at 28°C. The colony morphology and growth status were observed and recorded. Gram staining, morphological observation and biochemical tests and other related physicochemical parameters were determined in accordance with the "Manual of Systematic Identification of Common Bacteria" and "Bergey's Manual of Bacterial Identification".

[0082] (2) The 16S rDNA gene of Kos-10 strain was amplified by PCR, and the PCR amplification product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The obtained 16S rDNA gene sequence was aligned by NCBI-BLAST.

[0083] The 16S rDNA sequencing primers are 27F and 1492R, and the specific primer sequences are as follows:

[0084] 27F primer sequence (5'-3'): AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1);

[0085] 1492R primer sequence (5'-3'): GGTTACCTTGTTACGACTT (SEQ ID NO.2).

[0086] PCR amplification system: 1 μL each of primers, 2 μL of DNA template, 12.5 μL of 2×Taq PCR Master Mix II, and ultrapure water to a final volume of 25 μL.

[0087] The PCR amplification conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ final extension for 8 min.

[0088] 2. Experimental Results

[0089] (1) Colony morphology of Kos-10 strain on NA medium plates as follows: Figure 5 As shown, the results indicate that the Kos-10 strain grows well on NA medium plates, with yellow, opaque colonies that are smooth and have regular edges.

[0090] (2) Gram staining results of Kos-10 strain are as follows Figure 6 As shown in the figure, the results indicate that the Kos-10 strain is a Gram-negative bacterium with short rod-shaped cells.

[0091] (3) The biochemical analysis results of Kos-10 strain are shown in Table 2. The results show that Kos-10 strain can utilize glucose, maltose, sucrose, xylose, galactose, sorbitol, rhamnose, salicin, eugenol and fructose, but cannot utilize lactose, inositol, calendula alcohol and starch. The glucose acid production test results were positive, while the results of β-galactoside ONPG, Simon's citrate, gluconate, nitrate gas production, nitrite gas production and glucose gas production tests were all negative.

[0092] Table 2. Biochemical analysis results of Kos-10 strain

[0093]

[0094] Note: "+" represents a positive reaction, and "-" represents a negative reaction.

[0095] (4) The 16S rDNA gene sequence of strain Kos-10 is shown in SEQ ID NO.3, SEQ ID NO.3:

[0096]

[0097] The NCBI-BLAST comparison results of the 16S rDNA of Kos-10 strain are shown in Table 3. The results show that the similarity between Kos-10 strain and multiple strains of Kosakonia cowanii reached 99.24%.

[0098] In summary, strain Kos-10 was identified as Kosakonia cowanii, and the strain was named Kosakonia cowanii Kos-10. It was deposited on June 5, 2025, at the Guangdong Provincial Microbial Culture Collection Center with accession number GDMCC No: 66468. The deposit address is Building 66, Institute of Microbiology, Guangdong Academy of Sciences, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou.

[0099] Table 3. NCBI-BLAST alignment results of 16S rDNA from Kos-10 strain.

[0100]

[0101]

[0102] Example 4: Antagonistic Experiment of Kos-10 Strain against Raulella solanaceae

[0103] I. Experimental Methods

[0104] The inhibition zone method was used to screen isolated endophytic bacteria from mulberry trees and determine their antagonistic effects against different hosts of *R. solanacearum*. The *R. solanacearum* strains used were R-YLXTK-5 (host of *Cymbidium goeringii*), R-Lj-26 (host of pepper), R-Fq-32 (host of tomato), R-Yc-6 (host of tobacco), and R-Hs-8 (host of peanut).

[0105] The isolated Kos-10 strain was inoculated into 20 mL of LB liquid medium and cultured at 28 °C with shaking at 140 rpm for 24 h. Using *R. solanacearum*, a different host organism that had been cultured in TTC liquid medium for 24 h with shaking, as indicator bacteria, *R. solanacearum* was diluted to 1 × 10⁻⁶ with sterile water. 8 CFU / mL (OD) 600=1) Reserve. Use a 5 mm diameter punch to make 3 wells in each TTC agar medium. Add 20 μL of Kos-10 strain culture to each well. Use the same volume of 100 ppm streptomycin sulfate as a positive control and sterile water as a negative control. Spread 200 μL of bacterial suspension of different hosts of Solanaceae Raulella on TTC medium. Each treatment is repeated 3 times. After incubating the plates in a 28℃ incubator for 2 days, the diameter of the inhibition zone is counted.

[0106] 2. Experimental Results

[0107] The results of the antagonistic experiment of Kos-10 strain against different hosts of *Raulella solanaceae* are as follows: Figure 7 As shown, the results indicate that strain Kos-10 is effective against strain R-YLXTK-5, whose host is *Cymbidium goeringii*. Figure 7 Figure a), the R-Lj-26 strain of pepper ( Figure 7 Figure b in the text), the R-Fq-32 strain of tomato ( Figure 7 Figure c in the diagram), the R-Yc-6 strain of tobacco ( Figure 7 Figure d in the diagram), R-Hs-8 strain of peanut ( Figure 8 All of them (e) in the figure have antagonistic effects; the size of the inhibition zone is shown in Table 4.

[0108] Table 4. Antibacterial effects of strain Kos-10 against different hosts of *Raurus oryzae* (Solanaceae).

[0109]

[0110]

[0111] Example 5: Pot experiment on the control of bacterial wilt of mulberry by Kos-10 bacterial suspension.

[0112] I. Experimental Methods

[0113] Based on the results of the plate inhibition experiment in Example 4, the control effect of *Codonopsis lanceolata* Kos-10 on mulberry bacterial wilt was tested. Twenty-four mulberry seedlings (120 days old) of similar growth were divided into four groups (A, B, C, and D). After root damage treatment, they were treated as follows:

[0114] Group A: Apply 20 mL of sterile water;

[0115] Group B: 20 ​​mL of Kos-10 bacterial culture of Coccidia sacchariformis cultured on NA medium for 2 days was applied;

[0116] Group C: 20 mL of *Codonopsis lanceolata* Kos-10 culture medium, incubated for 2 days, was applied. 7 days later, 20 mL of a 10% concentration was applied. 8 CFU / mL (OD) 600=1) A solution of *R. laurentii* strain from the Solanaceae family, with *Rm-35* strain as the host.

[0117] Group D: Apply 20 mL of a 10% concentration. 8 CFU / mL (OD) 600 =1) of Solanaceae Raulella suspension.

[0118] After four groups of potted plants were cultivated together for 15 days, the growth and disease incidence of mulberry seedlings were investigated.

[0119] 2. Experimental Results

[0120] Results of potted plant control experiment as follows Figure 8 As shown in Tables 5 and 6, the results indicate that the mulberry trees in both groups A and B grew normally, and compared with group C, group B grew better; this shows that the Kos-10 strain of Coccidioides sacchari in this invention does not cause mulberry wilt disease and can promote mulberry growth.

[0121] All six mulberry trees in group D showed varying degrees of wilting, with four of them severely wilted. In contrast, only two mulberry trees in group C showed wilting, indicating that the Kos-10 strain isolated in this invention has a good control effect on mulberry bacterial wilt caused by Raulella solanaceae.

[0122] Table 5. Potted plant growth performance data of strain Kos-10 in controlling bacterial wilt of mulberry.

[0123]

[0124]

[0125] Table 6. Potted plant growth performance data of strain Kos-10 in controlling bacterial wilt of mulberry.

[0126]

[0127] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A strain of Kosakonia cowanii Kos-10, characterized in that, The bacteria was deposited at the Guangdong Provincial Center for Microbial Culture Collection on June 5, 2025, with accession number GDMCCNO: 66468.

2. A microbial preparation, characterized in that, Contains Kos-10 of Coccidia sacchari as described in claim 1 or its fermentation broth.

3. A microbial preparation, characterized in that, Fermentation products containing Kos-10 of Coxsackie bacterium as described in claim 1.

4. The use of the *Codonopsis lanceolata* Kos-10 of claim 1 or the microbial preparation of claim 2 or 3 in promoting plant growth or in the preparation of products that promote plant growth.

5. The use of the Coccidia sacchariformis Kos-10 of claim 1 or the microbial preparation of claim 2 or 3 in the production of siderophores, or in the preparation of products containing siderophores, or in the preparation of products containing siderophores.

6. The use of the Coccidia sacchariformis Kos-10 of claim 1 or the microbial preparation of claim 2 or 3 in nitrogen fixation, or in the preparation of a product having nitrogen-fixing capabilities.

7. The use of the Coccidia sacchariformis Kos-10 of claim 1 or the microbial preparation of claim 2 or 3 in phosphorus solubilization, or in the preparation of a product having phosphorus solubilization capabilities.

8. The use of the Coccidia sacchariformis Kos-10 of claim 1 or the microbial preparation of claim 2 or 3 in potassium solubilization, or in the preparation of a product having potassium solubilization capabilities.

9. The use of the *Codonopsis lanceolata* Kos-10 of claim 1 or the microbial preparation of claim 2 or 3 in inhibiting *Raulella solanaceae* or in controlling bacterial wilt, or in the preparation of a product for inhibiting *Raulella solanaceae*, or in the preparation of a product for controlling bacterial wilt.

10. A method for promoting plant growth under bacterial wilt stress, characterized in that, Plants are treated with the Kos-10 strain of Coxella sacchari as described in claim 1 or the microbial preparation as described in claim 2 or 3.

Citation Information

Patent Citations

  • Coxsackie cocori MD10 as well as culture method and application of coxsackie cocori MD10

    CN117050915A

Cited By

  • Kosakonia caroliniana strain qd15 and application thereof

    CN122521537A