Bacillus vallismortis TCS004 and application thereof
By optimizing the fermentation conditions of Bacillus cereus TCS004, its inhibition rate and spectrum against Alternaria alterniflora were improved, overcoming the shortcomings of existing Bacillus cereus strains in the control of plant fungal diseases and achieving broad-spectrum antibacterial effect and multifunctionality.
Patent Information
- Application Number
- CN202511065604.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-10-28
AI Technical Summary
Existing Bacillus cereus is not effective in controlling plant fungal diseases, has a single target, is easily affected by the natural environment, and has limited ability to compete for survival.
Bacillus cereus TCS004 was obtained through artificial mutagenesis breeding. Its fermentation conditions were optimized to improve the inhibition rate against Alternaria alternata. Glucose and soluble peanut meal were used as the carbon and nitrogen sources of the fermentation medium. Culture parameters such as temperature, rotation speed and time were optimized, and fermentation filtrate was prepared for antibacterial purposes.
It improved the inhibition rate against Alternaria to 89.77%, broadened the inhibition spectrum, and achieved an inhibition rate of over 50% against 19 plant pathogenic fungi. It also possesses functions such as nitrogen fixation, iron carrier production, and salt tolerance.
Smart Images

Figure CN120843359A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of marine microbial applications, specifically involving the artificial mutagenesis breeding of stable strains of Bacillus vallismortis TCS004 obtained from marine habitats. These strains possess nitrogen fixation, siderophore production, drought resistance, and salt tolerance, and the fermentation filtrate from their culture exhibits good antibacterial activity against most plant pathogenic fungi. Using Alternaria alternata as the target pathogen, fermentation condition optimization experiments were conducted, improving the inhibition rate of the fermentation filtrate against this pathogen. Background Technology
[0002] Plant diseases are a significant issue in agricultural production. While chemical pesticides have played a crucial role in controlling pests and diseases, their widespread application has also brought a series of problems, including environmental pollution, threats to human and animal health, the development of pesticide resistance, harm to non-target organisms, and pesticide residues. These problems pose serious threats to human health and ecological balance. Therefore, there is a global trend of actively developing highly effective and low-toxicity biological control agents to replace or reduce the use of chemical pesticides, a trend that has attracted widespread attention from scholars, businesses, and consumers. The development of microbial agents for controlling pests has become a novel control strategy. Since Hartely first used fungi to control damping-off in 1921, the biological control of plant diseases has encompassed a variety of microorganisms, including fungi, actinomycetes, bacteria, and viruses (such as bacteriophages). Utilizing these antagonistic microorganisms to control plant diseases has become one of the main strategies of biological control and has shown great application potential.
[0003] Currently, the most widely used biocontrol bacteria are plant growth-promoting rhizosphere bacteria (PGPR), whose beneficial effects on plants are mainly manifested in disease prevention and growth stimulation. Their disease control mechanisms include antagonism, parasitism, competition, and predation, with the production of active secondary metabolites being one of the important mechanisms of antagonism. Meanwhile, marine microorganisms—a new resource that has attracted attention both domestically and internationally in recent years—are more likely to function effectively in extreme environments due to the low-temperature, high-salinity characteristics of their original habitats, demonstrating their habitat advantages in the development of biocontrol agents.
[0004] *Bacillus vallismortis* is an aerobic, spore-forming, Gram-positive bacterium. It was first isolated from soil in 1996 by American biologist Michael S. Roberts. This bacterium is very similar to *Bacillus subtilis*, but its fatty acid composition and DNA sequence differ from *Bacillus subtilis*. *Bacillus vallismortis* is an ideal biocontrol microorganism because it can produce spores that are highly resistant to heat, ultraviolet radiation, electromagnetic radiation, and certain chemicals, allowing it to tolerate various adverse environments. This makes it suitable for the processing, storage, and production of biocontrol agents. *Bacillus vallismortis* successfully colonizes in the rhizosphere, on the plant surface, or within the plant, competing with pathogens for nutrients in the surrounding environment. It inhibits pathogen growth by secreting active secondary metabolites and simultaneously induces the plant's defense system to resist pathogen invasion, thus achieving biocontrol. Therefore, *Bacillus vallismortis* has promising applications as a biocontrol agent. Currently known Bacillus vallismortis species include Bacillus vallismortis SZ-4 (CGMCC No. 8273), Bacillus vallismortis WMOO5 (CCTCC No. M2016020), Bacillus vallismortis N23 (CGMCC No. 9920), Bacillus vallismortis SCQN-5 (CGMCC No. 16564), Bacillus vallismortis (CGMCC No. 21871), and Bacillus vallismortis (CGMCC No. 29750). These Bacillus vallismortis species can all be used in the prevention and control of plant diseases.
[0005] Microbial pesticides generally refer to pesticides derived from microorganisms and their natural products, including using microorganisms to control microorganisms, using microorganisms to control insects, and inhibiting fungi and weeds. Microbial fungicides have many advantages, such as being less likely to develop resistance, being harmless to humans and animals, having great research potential, and being widely available. They can also reduce pollution to the environment and play a certain protective role. These advantages give them greater room for development in the market.
[0006] Currently, Bacillus cereus, which is known to have a control effect on plant fungal diseases, especially on some economic forest plants, has many drawbacks, such as poor efficacy, limited target, susceptibility to natural environmental influences, and limited competitive survival ability. Summary of the Invention
[0007] In view of the problems existing in the prior art, the purpose of this invention is to provide a dead Bacillus glutathione TCS004, whose accession number is CGMCC NO.25850.
[0008] Another object of the present invention is to provide a dead Bacillus glutathione TCS004, which has the accession number CGMCCNO.25850.
[0009] Another objective of this invention is to provide an application of Bacillus cereus TCS004 in nitrogen fixation, the accession number of which is CGMCC NO.25850.
[0010] Another objective of this invention is to provide an application of Bacillus cereus TCS004 in siderogenic carriers, the accession number of which is CGMCC NO.25850.
[0011] Another object of the present invention is to provide the application of Bacillus cereus TCS004 in the prevention and control of plant pathogenic fungi or bacteria, or in the preparation of microbial preparations for the prevention and control of plant pathogenic fungi or bacteria.
[0012] Preferably, the plant pathogenic fungi include *Marssonina coronaria*, *Macrophoma kawatsukai*, *Diaporthe citri*, *Monilinia laxa*, *Alternaria alternata*, *Colletotrichum fructicola*, *Septoria cucurbitacearum*, *Alternaria solani*, *Fusarium solani*, *Botrytis cinerea*, *Fusarium equiseti*, *Curvularia lunata*, *Alternaria mali* (apple-specific type), *Colletotrichum gloeosporioides*, *Fusarium incarnatum*, and *Botryosphaeria*. Anthracnose fungi include *C. dothidea*, *Colletotrichum sublineolum*, *Fusarium oxysporum f.sp. vasinfectum*, *Colletotrichum siamense*, *Rhizoctonia solani*, *Fusarium graminearum*, *Sclerotinia sclerotiorum*, and *Phytophthora capsici*.
[0013] The plant pathogenic bacteria include Xanthomonas rice, etc.
[0014] Another object of the present invention is to provide a microbial preparation containing Bacillus cereus TCS004, whose accession number is CGMCC NO.25850.
[0015] Another object of the present invention is to provide the application of glucose as a carbon source in the fermentation medium of Bacillus cereus TCS004, the accession number of which is CGMCC NO.25850.
[0016] Another object of the present invention is to provide the application of peanut cake powder or peptone as a nitrogen source for the fermentation medium of Bacillus cereus TCS004, the accession number of which is CGMCC NO.25850.
[0017] Another objective of this invention is to provide a fermentation medium for Bacillus cereus TCS004, with accession number CGMCC NO2.5850, comprising 1.0%-5.0% glucose, 1.00%-8.0% soluble peanut meal powder, 1000 mL distilled water, and an initial pH of 8-8.5. Preferably, it contains 3.0% glucose, 4% soluble peanut cake powder, and 1000 mL distilled water by weight.
[0018] Another objective of this invention is to provide a fermentation process for Bacillus cereus TCS004, with a liquid volume ratio of 28%-32%, an inoculum size of 3.8%-4.2%, a culture temperature of 26-27℃, a rotation speed of 135-145 rpm, and a culture time of 72-73 h. Preferably, the liquid volume ratio is 30% (75mL / 250mL), the inoculum size is 4%, the culture temperature is 26.6 ℃, the rotation speed is 140 rpm, and the culture time is 72.6 h.
[0019] Beneficial technical effects of the present invention This invention provides the first isolation of a dead Bacillus glutathione TCS004, with accession number CGMCC NO.25850.
[0020] This strain has nitrogen-fixing capabilities, which can reduce atmospheric molecular nitrogen into ammonia and other nitrogen-containing compounds.
[0021] When grown in CAS blue medium, the presence of an orange-red transparent ring indicates that the strain has the ability to produce siderophores, chelating insoluble Fe3+ and reducing it to readily soluble Fe2+.
[0022] When grown in NBRIP medium, no clear zone was formed around the growth, indicating that the strain has no ability to solubilize phosphorus and cannot decompose sparingly soluble phosphorus into H2PO4- and HPO42-.
[0023] This strain showed an inhibition rate of over 50% against 19 plant pathogenic fungi, demonstrating a good antibacterial effect and indicating that Bacillus cereus TCS004 has a broad antibacterial spectrum.
[0024] The optimal fermentation conditions for inhibiting Alternaria alterniflora using Bacillus oryzae TCS004 fermentation filtrate, determined through single-factor optimization experiments and response surface methodology, are as follows: 3.0% glucose, 4% soluble peanut meal, 30% liquid volume, initial pH 8.3, 4% inoculum size, culture temperature 26.6 ℃, rotation speed 140 rpm, and culture time 72.6 h. Under these optimal conditions, the inhibition rate of Bacillus oryzae TCS004 fermentation filtrate against Alternaria alterniflora reached 89.77%, representing a 13.21% increase compared to the pre-optimization conditions. Attached Figure Description
[0025] Figure 1 Cluster analysis diagram of 16S rDNA of Bacillus cereus TCS004; Figure 2 Colony morphology of Bacillus cereus TCS004 and the morphology of its spores observed under an optical microscope after Gram staining; Figure 3 Physiological and biochemical test results of Bacillus cereus TCS004; Figure 4 Evaluation of the nitrogen fixation, phosphorus solubilization, and iron carrier production capabilities of Bacillus cereus TCS004; Figure 5 Salt tolerance evaluation of Bacillus cereus TCS004; Figure 6 Evaluation of drought resistance of Bacillus cereus TCS004; Figure 7 Growth curve of Bacillus cereus TCS004; Figure 8 Inhibitory effect of Bacillus cereus TCS004 on 23 plant pathogenic fungi; Figure 9 Inhibitory effect of Bacillus cereus TCS004 fermentation filtrate (CFS) on 23 plant pathogenic fungi; Figure 10 Effects of different basal culture media on the activity of Bacillus cereus TCS004 fermentation filtrate; Figure 11 Effects of different carbon and nitrogen sources and their concentrations on the activity of Bacillus cereus TCS004 fermentation filtrate; Figure 12 Effects of different culture conditions on the activity of Bacillus cereus TCS004 fermentation filtrate; Figure 13Contour plots and surface plots showing the effects of Bacillus oryzae TCS004 fermentation filtrate on Alternaria alterniflora inhibition rate. Figure 14 Response surface methodology was used to validate the antibacterial rate of Bacillus oryzae TCS004 fermentation filtrate against Alternaria alterniflora. Figure 15 Inhibitory effect of Bacillus cereus TCS004 fermentation filtrate on plant pathogenic bacteria. Specific Implementation
[0026] Example 1 Sequencing and morphological, physiological and biochemical tests of 16S rDNA of Bacillus cereus TCS004.
[0027] DNA extraction was performed using the Ezup column-based bacterial genomic DNA extraction kit from Shanghai Sangon Biotech Co., Ltd. 16S rDNA sequences were amplified using universal bacterial primers: 27F (SEQ ID NO.1: AGAGTTTGATCCTGGCTCAG) and 149R (SEQ ID NO.2: GGTTACCTTGTTACGACTT). The PCR reaction mixture (50 μL) consisted of: 5 μL 10X PCR buffer, 4 μL dNTPs, 1 μL each primer, 2.5 μL DNA template, 0.25 μL Takara Taq enzyme, and 36 μL ultrapure water. The PCR amplification program was: 94 ℃ for 3 min; 94 ℃ for 1 min, 52 ℃ for 1 min, 72 ℃ for 1.5 min, 30 cycles; 72 ℃ for 10 min. The amplified products were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.
[0028] The sequence was determined using the BLAST procedure and compared with sequences in GenBank (NCBI, website http: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Then, 16S rDNA sequences from species and genera closely related to *Bacillus cereus* TCS004 were obtained from GenBank. The alignment results showed that the 16S rDNA sequence of *Bacillus cereus* TCS004 was similar to that of *Bacillus cereus* BL-01 in the GenBank gene bank. Bacillus vallismortis The 16S rDNA sequence of the strain is highly homologous, with a homology rate of 99%. The phylogenetic tree constructed from strain *Bacillus cereus* TCS004 showed that... Figure 1 ), Bacillus cereus TCS004 and Bacillus cereus ( Bacillus vallismortis BL-01 forms a separate branch and is the closest in evolutionary distance, reflecting the closest kinship between them. The strain TCS004 was identified as Bacillus cereus.
[0029] Bacillus cereus TCS004 is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit date is September 30, 2022, and the accession number is CGMCC NO.25850.
[0030] Test culture medium LB medium: 10.0 g tryptone, 5.0 g yeast extract, 10.0 g NaCl, 1000 mL distilled water, pH 7.0~7.2.
[0031] NA medium: 10.0 g peptone, 3.0 g beef extract, 10.0 g glucose, 1.0 g yeast extract, 18.0 g agar powder, 1000 mL distilled water, pH 7.0~7.2.
[0032] Carbon source utilization of basic culture medium: (NH4)2SO4 2.0 g, MgSO4·7H2O 0.2 g, NaH2PO4·H2O 0.5 g, CaCl2·2H2O 0.1 g, K2HPO4 0.5 g, agar powder 18.0 g, distilled water 1000 mL.
[0033] Starch hydrolysis medium: 5.0 g beef extract, 5.0 g NaCl, 5.0 g soluble starch, 20.0 g agar powder, 1000 mL distilled water, pH 7.2.
[0034] Glucose oxidation fermentation medium: KH2PO4 1.0 g, MgSO4·7H2O 0.2 g, KCl 0.2 g, yeast extract 0.2 g, glucose 10.0 g, distilled water 1000 mL, bromothymol blue 1% aqueous solution 3 mL, pH 6.8~7.0.
[0035] Nitrate-reducing medium: 5.0 g beef extract, 10.0 g peptone, 1.0 g KNO3, 6.0 g NaCl, 1000 mL distilled water, pH 7.2.
[0036] Tresner medium for hydrogen sulfide generation: 10.0 g peptone, 0.5 g ferric citrate, 18.0 g agar powder, 1000 mL distilled water, pH 7.2.
[0037] VP test medium: 5.0 g peptone, 5.0 g glucose, 5.0 g NaCl, 1000 mL distilled water, pH 7.2.
[0038] Methyl red test medium: 5.0 g peptone, 5.0 g glucose, 5.0 g NaCl, 1000 mL distillation, pH 7.2.
[0039] Citrate culture medium: NaCl 1.0 g, MgSO4·7H2O 0.2 g, NH4H2PO4 0.5 g, sodium citrate 2.0 g, distilled water 1000 mL, 0.04% phenol red solution 20 mL, pH natural.
[0040] Gelatin liquefaction medium: 5.0 g peptone, 200.0 g gelatin, 1000 mL distilled water, pH 7.2~7.4.
[0041] Test methods Morphological identification: Single colonies of Bacillus cereus TCS004 were picked up with a sterile inoculation loop and inoculated onto solid LB medium. The colonies were incubated upside down in the dark at 28 °C for 3 days and 7 days to observe their morphology.
[0042] Gram staining: On a slide fixed with Bacillus oryzae TCS004, add crystal violet staining solution and stain for 1 minute, then rinse with water. Next, cover the smear with iodine solution and continue staining for about 1 minute, then rinse with water again. Then, add 95% alcohol, gently shake the smear to destain, and rinse with water after 20 seconds to remove excess water. Finally, counterstain with diluted safranin staining solution for 1 minute, rinse with distilled water, and examine under a microscope after drying.
[0043] Glucose oxidation fermentation test: Bacillus cereus TCS004 cultured for 24 h was inoculated into glucose medium, with blank medium as the control group, and the test was repeated 3 times. After incubation at 28 ℃ for different times (1, 3, 5 days), the culture medium turned yellow, indicating positive glucose fermentation (+), and no color change indicated negative glucose fermentation (-).
[0044] Gelatin liquefaction test: Bacillus cereus TCS004 cultured for 48 h was picked and inoculated into the gelatin layer to a depth of about 2 / 3 with a relatively large amount of puncture. The blank culture medium was used as the control group. The test was repeated 3 times. After incubation at 28 ℃ for different times (5, 10, 20, 30 d), the liquefaction of gelatin was observed. If flowing liquid appeared in the test tube, the hydrolysis was positive (+) and the gelatin had the ability to produce protease; otherwise, the hydrolysis was negative (-).
[0045] Nitrate Reduction Test: ① Griess' reagent includes solution A—0.5 g of p-aminobenzenesulfonic acid and 150 mL of 10% acetic acid; solution B—0.1 g of α-aniline, 150 mL of 10% acetic acid, and 20 mL of distilled water. ② Diphenylamine reagent: Dissolve 0.5 g of diphenylamine in 100 mL of sulfuric acid, then dilute with 20 mL of distilled water. Inoculate *Bacillus cereus* TCS004 into nitrate reduction medium and incubate at 28 ℃ for 1, 3, and 5 days. Add Griess' reagent and observe the results. If the solution turns pink, rose-red, orange, or brown after adding solutions A and B, it indicates the presence of nitrite and is considered positive (+) for nitrate reduction. If no red color appears, add 1 drop of diphenylamine reagent; a blue reaction indicates a negative (-) result. If no blue reaction occurs, it is still considered positive.
[0046] Starch hydrolysis test: Iodine solution was prepared by mixing 1.0 g iodine tablets, 2.0 g potassium iodide, and 300 mL distilled water. *Bacillus oryzae* TCS004 was inoculated onto starch hydrolysis medium and cultured at 28 ℃ for 48 h. Iodine solution was then added around the colonies for detection. If a colorless, transparent band appeared around the colony, it indicated that *Bacillus oryzae* TCS004 had produced amylase, and the reaction was positive (+). If a blue band appeared around the colony, the reaction was negative (-).
[0047] Hydrogen sulfide gas production test: Bacillus cereus TCS004 was streaked onto hydrogen sulfide gas-producing medium. The uninoculated control group was repeated for 3 days. The culture was carried out at 28 °C for about 7 days. The color change around the colony was observed. If it turned black, it indicated that hydrogen sulfide was produced, which was positive (+); if it did not turn black, there was no hydrogen sulfide production, which was negative (-).
[0048] Carbon source utilization experiment: Seven different carbon sources were added to the basal culture medium at a concentration of 1% (w / v): fructose, maltose, sucrose, glucose, lactose, xylose, and mannitol. A basal culture medium without added carbon sources served as a blank control. The experiments were repeated three times, streaked, and incubated at 28 ℃ for 7 days. The growth of *Bacillus cereus* TCS004 was observed periodically. Colony growth was considered positive (+), and no growth was considered negative (-).
[0049] VP test: Inoculate Bacillus cereus TCS004 into the above VP medium, with 3 replicates per group, and incubate at 28 ℃ for 3 days. Mix the culture medium with an equal volume of 40% NaOH, add a small amount of creatine, shake vigorously, and observe after 15 min. If the culture medium turns red, it is a positive reaction (+).
[0050] Methyl red test: Inoculate Bacillus cereus TCS004 into the above methyl red medium, with 3 replicates per culture, and incubate at 28 ℃ for 3 days. Add one drop of methyl red reagent to the culture medium; red indicates a positive result (+), and yellow indicates a negative result (-).
[0051] Oxidase test: Place a filter paper in a clean petri dish and add a drop of 1% aqueous solution of dimethyl-p-phenylene diamine, just enough to moisten the filter paper, not too wet. Use an inoculation loop to take a piece of bacterial growth that has been cultured for 24 hours and smear it onto the moistened filter paper. If the bacterial growth turns red within 10 seconds, it is positive (+), otherwise it is negative (-).
[0052] Citrate utilization test: Inoculate Bacillus oryzae TCS004 onto a slant and incubate at 28 ℃ for 3–7 days. A positive result (+) is indicated by an alkaline culture medium (blue or pink indicator), otherwise a negative result (-).
[0053] Contact enzyme test: Take a small loop of Bacillus cereus TCS004 cultured for 24 h and smear it on a glass slide with 3% hydrogen peroxide. If bubbles are produced, it is positive (+), and if no bubbles are produced, it is negative (-).
[0054] Morphological identification and preliminary physiological and biochemical identification of *Bacillus cereus* TCS004 were performed, including Gram staining, glucose oxidative fermentation assay, carbon source utilization assay, catalase assay, nitrate reduction assay, VP assay, H2S gas production assay, gelatin liquefaction assay, methyl red assay, oxidase assay, starch hydrolysis assay, and citric acid assay. The test methods employed conventional methods in the art for determining these physiological and biochemical indicators, combined with… Figure 1 Table 1 Figure 2 , Figure 3 The results suggest that strain TCS004 belongs to Bacillus cereus.
[0055] Table 1 Results of Physiological and Biochemical Tests .
[0056] Example 2 Determination of growth-promoting and stress-resistance capabilities of Bacillus cereus TCS004 Test culture medium LB broth medium: 10.0 g tryptone, 5.0 g yeast extract, 3.0 g beef extract, 10.0 g NaCl, 18.0 g agar, 1000 mL distilled water, pH 7.0-7.2.
[0057] NBRIP medium: 10.0 g glucose, 5.0 g Ca3(PO4)2, 5.0 g MgCl2·6H2O, 0.25 g MgSO4·7H2O, 0.2 g KCl, 0.1 g (NH4)2SO4, 18.0 g agar, 1000 mL distilled water, pH 7.0. Ca3(PO4)2 must be sterilized separately and cooled to 70 °C before being mixed with the other components of the medium.
[0058] Ashby medium: KH2PO4 0.2 g, MgSO4·7H2O 0.2 g, NaCl 0.2 g, CaCO3 5.0 g, mannitol 10.0 g, CaSO4·2H2O 0.1 g, agar 18.0 g, distilled water 1000 mL, pH 6.8~7.0.
[0059] CAS medium: 1 mL of 20% sucrose solution and 10% acid-hydrolyzed casein per 100 mL of medium, 1 mmol / L -1 100 μL of CaCl2, 1 mmol / L -1 MgSO4·7H2O, 1.8 g agar, and 5 mL each of phosphate buffer and CAS staining solution were slowly added at 60 °C.
[0060] Test methods (1) Determination of nitrogen fixation capacity of strains Use a sterile inoculation loop to pick up an activated *Bacillus cereus* TCS004 colony and inoculate it onto Ashby nitrogen-free medium. Observe whether it grows after 48 h. If it grows normally, it indicates that the strain has nitrogen-fixing ability.
[0061] (2) Determination of the phosphorus solubilization capacity of the strain Use a sterile inoculation loop to pick up an activated *Bacillus cereus* TCS004 colony, inoculate it in the center of NBRIP medium, and incubate at 28 ℃ for 7 days. Observe whether a transparent phosphate-solubilizing zone is produced.
[0062] (3) Determination of the strain's ability to produce siderophores Pick a colony of activated Bacillus cereus TCS004 using a sterile inoculation loop, inoculate it in the center of CAS medium, and incubate it in a 30 ℃ incubator for 3-6 days. Observe whether a yellow halo, i.e., a band of iron erosion, appears around the colony.
[0063] (4) Determination of drought resistance of strains Different concentrations of aseptically treated PEG 6000 were added to 100 mL of sterilized LB medium to achieve final concentrations of 0, 30, 60, 90, 120, 150, 180, 210, and 240 g / L. A 1% seed culture was then added, and the medium was incubated at 37 °C with shaking at 200 r / min for 24 h. The OD value at 700 nm was then read using LB liquid medium to zero the culture. A PEG 6000 concentration of 0-60 g / L represents mild drought, 90-150 g / L represents moderate drought, and greater than 150 g / L represents severe drought.
[0064] (5) Determination of salt tolerance of strains Salt tolerance standards for Bacillus. Non-salt-tolerant strains: NaCl content less than 1.17%; low salt-tolerant strains: NaCl 1.17-2.93%; moderately salt-tolerant strains: NaCl concentration 2.93%-14.63%; highly salt-tolerant strains: 14.63%-30.4%. Bacillus belye TCS001 was streaked onto LB medium containing 5%, 10%, and 15% NaCl, and incubated at 28 ℃ for 7 days to observe whether it could grow normally.
[0065] Depend on Figure 4 It was found that *Bacillus cereus* TCS004 could grow normally in Ashby medium without a nitrogen source, proving that this strain has nitrogen-fixing capabilities and can reduce atmospheric molecular nitrogen to ammonia and other nitrogen-containing compounds. When grown in CAS blue medium, it exhibits an orange-red transparent ring, indicating that this strain has the ability to produce siderophores and chelate insoluble Fe. 3+ And reduce it to easily soluble Fe. 2+ When grown in NBRIP medium, the absence of a clear zone indicates that this strain lacks the ability to solubilize phosphorus and cannot decompose sparingly soluble phosphorus into H2PO4. - and HPO4 2- .
[0066] Depend on Figure 5 It can be seen that Bacillus cereus TCS004 cannot grow on LB medium with 15% NaCl, but can grow on LB medium with 10% NaCl, indicating that it is a moderately salt-tolerant strain.
[0067] Depend on Figure 6 It can be seen that Bacillus cereus TCS004 can still survive in LB medium containing 240 g / L PEG 6000, proving that this strain has a high drought resistance.
[0068] Depend on Figure 7It can be seen that, under the growth conditions of LB liquid medium with a volume of 100 / 250 mL, an ambient temperature of 28 ℃, and a shaking speed of 180 rpm, the growth period of Bacillus cereus TCS004 after inoculation is as follows: 0-12 h after inoculation is the adjustment period; 12-16 h is the logarithmic growth period, during which the bacteria rapidly multiply in large quantities; and 16-48 h is the stationary period, during which the number of colonies is relatively constant but also slowly increasing.
[0069] Example 3 This embodiment tested the effects of *Bacillus cereus* TCS004 on *Marssonina coronaria*, *Macrophoma kawatsukai*, *Diaporthe citri*, *Monilinia laxa*, *Alternaria alternata*, *Colletotrichum fructicola*, *Septoria cucurbitacearum*, *Alternaria solani*, *Fusarium solani*, *Botrytis cinerea*, *Fusarium equiseti*, *Curvularia lunata*, *Alternaria mali* (apple-specific type), *Colletotrichum gloeosporioides*, *Fusarium incarnatum*, and *Botryosphaeria*. Growth inhibition tests of *Cyclocarya dothidea*, *Colletotrichum sublineolum*, *Fusarium oxysporum f.sp. vasinfectum*, *Colletotrichum siamense*, *Rhizoctonia solani*, *Fusarium graminearum*, *Sclerotinia sclerotiorum*, and *Phytophthora capsici*.
[0070] The plate confrontation method was used, in which 23 plant pathogenic fungi of 6 mm diameter were confronted with Bacillus oryzae TCS004 on PDA solid medium. Each treatment was repeated 3 times, and the culture was carried out in a constant temperature incubator at 26 ℃ for 5 days. The antibacterial effect was observed. Table 2. Figure 8 The antibacterial effect showed that Bacillus cereus TCS004 inhibited 19 kinds of plant pathogenic fungi by more than 50%, which is a good antibacterial effect, indicating that Bacillus cereus TCS004 has a broad antibacterial spectrum.
[0071] Table 2. Inhibition rate of Bacillus cereus TCS004 against 23 plant pathogenic fungi. .
[0072] Example 4 This embodiment describes the effects of *Bacillus cereus* TCS004 fermentation filtrate (CFS) on *Marssoninacoronaria*, *Macrophoma kawatsukai*, *Diaporthe citri*, *Monilinia laxa*, *Alternaria alternata*, *Colletotrichum fructicola*, *Septoria cucurbitacearum*, *Alternaria solani*, *Fusarium solani*, *Botrytis cinerea*, *Fusarium equiseti*, *Curvularia lunata*, *Alternaria mali* (apple-specific type), *Colletotrichum gloeosporioides*, and *Fusarium rosenbergii*. Antibacterial activity assays were performed on *Incarnatum*, *Botryosphaeria dothidea*, *Colletotrichum sublineolum*, *Fusarium oxysporum f.sp. vasinfectum*, *Colletotrichum siamense*, *Rhizoctonia solani*, *Fusarium graminearum*, *Sclerotinia sclerotiorum*, and *Phytophthora capsici*.
[0073] First, the fermentation filtrate of *Bacillus oryzae* TCS004 was prepared according to the following steps: *Bacillus oryzae* TCS004 was cultured in LB liquid medium (10.0 g tryptone, 5.0 g yeast extract, 3.0 g beef extract, 10.0 g NaCl, 18.0 g agar, 1000 mL distilled water, pH 7.0-7.2) at 28 ℃ for 14 h at a rotation speed of 180 rpm. Then, a 4% inoculum was added to LB liquid medium and cultured at 28 ℃ for 48 h at a rotation speed of 180 rpm. After the culture was completed, the fermentation broth was centrifuged at 8000 r / min for 10 min at 4 ℃. The supernatant was then filtered three times through a 0.22 μm microporous membrane to obtain the fermentation filtrate. Then, the fermentation filtrate was mixed with PDA medium cooled to about 50 ℃ at a volume ratio of 1:4 (20 mL fermentation filtrate: 80 mL PDA medium), and poured into plates until solidified. Next, a 7 mm diameter vigorous pathogenic fungal cake was inoculated in the center of the PDA plate, with the mycelial side facing down. PDA medium with an equal volume of sterile water was used as the control group. Each treatment was repeated 3 times and incubated in the dark at 26 ℃. When the diameter of the pathogenic fungus in the control group reached 3 / 4 of the diameter of the petri dish, the diameter of the pathogenic fungus in the treatment group was measured using the cross-cross method, and the inhibition rate was calculated according to formula (1). The inhibition rate was analyzed by one-way ANOVA using SPSS 26.0 software. The results in Table 3 show that it has inhibitory activity against 23 pathogenic fungi, with inhibition rates ranging from 16.33% to 99.74%.
[0074] Formula (1): Inhibition rate % = (Coronavirus diameter of control group - Coronavirus diameter of treatment group) / (Coronavirus diameter of control group - 0.7) × 100% Table 3. Inhibition rate of Bacillus cereus TCS004 CFS against 23 plant pathogenic fungi. ; According to Table 3, Figure 9 It can be seen that the fermentation filtrate of Bacillus cereus TCS004 has antibacterial activity against 23 kinds of plant pathogenic fungi, among which the inhibition rate against Aureobasidium monnieri, Botrytis cinerea, Botrytis cinerea, Botrytis cinerea, and Sclerotinia sclerotiorum reached more than 90%.
[0075] Example 5 In this embodiment, Alternaria alternata was used as the target pathogen to screen Bacillus cereus TCS004 basal fermentation medium.
[0076] Test culture medium NB medium: 10.0 g peptone, 3.0 g beef extract, 10.0 g glucose, 1.0 g yeast extract, 1000 mL distilled water.
[0077] LB medium: 5.0 g yeast extract, 10.0 g tryptone, 10.0 g NaCl, 1000 mL distilled water.
[0078] BPD medium: 5.0 g beef extract, 10.0 g peptone, 5.0 g NaCl, 1000 mL distilled water.
[0079] SOB medium: 20.0 g peptone, 5.0 g yeast extract, 0.5 g NaCl, 0.18 g KCl, 0.95 g MgCl2·H2O, 1000 mL distilled water.
[0080] BPY medium: 5.0 g beef extract, 10.0 g peptone, 5.0 g yeast extract, 5.0 g glucose, 1000 mL distilled water.
[0081] YT medium: 10.0 g peptone, 5.0 g yeast extract, 1.0 g glucose, 5.0 g NaCl, 1000 mL distilled water.
[0082] Test methods Bacillus cereus TCS004, which had been streaked at 28 °C for 48 h, was inoculated into LB medium and cultured at 28 °C and 180 rpm for 14 h to obtain TCS004 seed culture. The above seed culture was inoculated into six different basal fermentation media at an inoculum volume of 4% and cultured at 28 °C and 180 rpm for 24 h, with three replicates per treatment.
[0083] The fermentation broth of *Bacillus oryzae* TCS004 was centrifuged at 4 ℃ and 8000 rpm for 10 min. The supernatant was filtered three times through a 0.22 μm microporous membrane to obtain the fermentation filtrate. The fermentation filtrate was mixed with PDA medium cooled to approximately 55 ℃ at a volume ratio of 1:19 (5 mL fermentation filtrate: 95 mL PDA medium). After solidification on agar plates, a 6 mm diameter *Alternaria alternata* mycelial cake was inoculated into the center of the PDA plate, with the mycelial side facing down. PDA medium with an equal volume of sterile water was used as a blank control. Each treatment was repeated three times and incubated in the dark at 28 ℃. When the diameter of the pathogen in the control group reached 3 / 4 of the petri dish diameter, the diameter of the pathogen in the treatment group was measured using the cross-multiplication method. The inhibition rate was calculated according to Equation 2, and a one-way ANOVA was performed on the inhibition rate using SPSS 26.0 software.
[0084] Equation (2): Inhibition rate / % = (Coronavirus diameter of control group - Coronavirus diameter of treatment group) / (Coronavirus diameter of control group - 0.6) × 100 Table 4. Effects of different basal culture media on the antibacterial activity of Bacillus cereus TCS004 fermentation filtrate ; From Table 4, Figure 10 It can be seen that the antibacterial activity of Bacillus cereus TCS004 varies significantly when fermented in different basic fermentation media. When NB is used as the basic medium, the antibacterial effect of the fermentation filtrate of Bacillus cereus TCS004 is significantly better than that of other media (P<0.05), with an inhibition rate of 76.49%. Therefore, NB medium was selected as the basic fermentation medium.
[0085] Example 6 This embodiment optimizes the optimal fermentation medium selected in Example 5. First, the composition and culture conditions of the medium are optimized using single-factor methods. Then, response surface methodology is used to further optimize the antibacterial activity of the fermentation filtrate against Alternaria alternata, thus obtaining the optimal fermentation conditions.
[0086] (a) Optimization of optimal culture medium components Several tested carbon sources (glucose, starch, galactose, fructose, and sucrose) were used to replace the corresponding components in the initial culture medium in equal amounts. The fermentation filtrate was cultured for 48 h in 250 mL Erlenmeyer flasks (40% full, hereinafter the same), with an inoculum size of 4% (volume fraction, hereinafter the same), a rotation speed of 180 rpm, and a temperature of 28 °C. The inhibition rate of the fermentation filtrate against *Alternaria alterniflora* was then determined. The determination method was the same as in Example 5 to determine the optimal carbon and nitrogen sources. The effects of different concentrations (mass fractions) of carbon and nitrogen sources on the activity of *Bacillus cereus* TCS004 fermentation filtrate were screened, and the determination method was the same as in Example 5 to determine the optimal carbon and nitrogen source concentrations.
[0087] The results of the carbon source screening test are as follows Figure 11 A. The inhibition rates of *Bacillus oryzae* TCS004 fermentation filtrate against *Alternaria alterniflora*, from highest to lowest, were glucose > starch > galactose > fructose > sucrose, depending on the carbon source. When glucose was used as the carbon source, the inhibition rate of *Bacillus oryzae* TCS004 fermentation filtrate against *Alternaria alterniflora* was the highest, at 77.02%. Figure 11 As shown in D, the inhibition rate varies with different glucose concentrations, reaching its highest value of 81.95% at a glucose concentration of 3%. Therefore, a 3% glucose concentration was selected as the carbon source component for the Bacillus oryzae TCS004 fermentation medium.
[0088] The results of the nitrogen source screening test are as follows Figure 11B. Among different nitrogen sources, the inhibition rate of *Alternaria alternifolia* in the fermentation filtrate of *Bacillus cereus* TCS004 against *Alternaria alternifolia*, from highest to lowest, was peptone > peanut meal > yeast powder > beef extract > soybean meal. When peanut meal or peptone was used as the nitrogen source, there was no significant difference in the inhibition rate of *Alternaria alternifolia* against the TCS004 fermentation filtrate, which were 77.23% and 77.54%, respectively. Considering the need for subsequent scale-up fermentation, and taking into account overall cost, peanut meal was selected as the optimal nitrogen source for the fermentation medium of *Bacillus cereus* TCS004. Figure 11 E shows that the antibacterial rate reaches a maximum of 81.81% when the peanut meal concentration is 4%. Therefore, a 4% concentration of peanut meal was selected as the subsequent nitrogen source concentration for the Bacillus cereus TCS004 fermentation medium.
[0089] Inorganic salt screening test results are as follows Figure 11 C. Among different inorganic salts, the inhibition rate of *Bacillus cereus* TCS004 fermentation filtrate against *Alternaria alternifolia*, from high to low, is NaCl > MgSO4 > KH2PO4 > CaCl2 > MnSO4. When NaCl is used as the inorganic salt, the inhibition rate of *Bacillus cereus* TCS004 fermentation filtrate against *Alternaria alternifolia* is the highest at 77.67%. Therefore, NaCl is selected as the most suitable inorganic salt for the fermentation medium. Further screening of its concentration shows, as shown in Figure F, adding 1%-5% NaCl has no significant effect on the inhibition rate of *Bacillus cereus* TCS004 fermentation filtrate, and the inhibition rate is always less than 80%. Considering the overall cost, no inorganic salts are added to the fermentation medium of *Bacillus cereus* TCS004.
[0090] (II) Optimization of optimal culture conditions The optimized culture medium was used as the fermentation medium, with initial fermentation conditions of 4% inoculum, initial pH 7.0, 40% liquid volume, fermentation temperature 28 ℃, rotation speed 180 rpm, and incubation time 48 h. Experiments were conducted on six factors: fermentation temperature (25 ℃, 28 ℃, 32 ℃, 35 ℃, 37 ℃), initial pH (5.0, 6.0, 7.0, 8.0, 9.0), inoculum size (2%, 4%, 6%, 8%, 10%), liquid volume (20%, 30%, 40%, 50%, 60%), rotation speed (120 rpm, 140 rpm, 160 rpm, 180 rpm, 200 rpm), and time (24 h, 36 h, 48 h, 60 h, 72 h). The inhibition rate of TCS004 fermentation filtrate against Alternaria alterniflora was used as the experimental index, and the determination method was the same as in Example 5 to determine the influence of each factor on the inhibition rate.
[0091] Different inoculation doses were screened, and the results are shown in [the table below]. Figure 12A. The inhibition rate reaches its highest level of 82.47% when the inoculum concentration is 4%. The inhibition rate decreases when the inoculum concentration exceeds or falls below 4%. Therefore, the optimal inoculum concentration is 4%.
[0092] Different incubation temperatures were screened, and the results are shown in [the table below]. Figure 12 B. *Bacillus cereus* TCS004 produces antibacterial substances within a temperature range of 25-37 °C, but the inhibition rate varies significantly at different temperatures. The inhibition rate reaches its highest level (80.84%) at a culture temperature of 28 °C. The inhibition rate decreases significantly above 31 °C. Therefore, the optimal culture temperature is selected as 28 °C.
[0093] Different rotational speeds were screened, and the results are shown below. Figure 12 C. The antibacterial rate reaches its highest level of 86.59% when the rotation speed is 140 r / min. Therefore, the optimal rotation speed is selected as 140 r / min.
[0094] Different culture times were screened, and the results are shown in [the table]. Figure 12 D. The inhibition rate reached its highest level of 85.25% when the incubation time was 60 hours, and the inhibition rate showed a downward trend after 60 hours. Therefore, the optimal incubation time was selected as 60 hours.
[0095] Different liquid volumes were screened, and the results are shown in [the table below]. Figure 12 E. The antibacterial rate reaches its highest level of 84.35% when the liquid volume is 30%. Therefore, the optimal liquid volume is 30%.
[0096] Screening was conducted at different initial pH values, and the results are shown in [the table]. Figure 12 F. The antibacterial rate reached its highest level of 84.58% when the initial pH was 8.0, significantly better than other treatments. A pH that was too acidic or too alkaline was not conducive to the production of the antibacterial substance TCS004. Therefore, the optimal pH was chosen to be 8.0.
[0097] (iii) Plackett-Burman (PB) test Based on the results of the single-factor optimization experiments, the Plackett-Burman design experimental scheme using Design-Expert 10.0 software is shown in Table 5. Each factor was set with two levels, namely a high level "1" and a low level "-1" within a range, and each experiment was repeated three times. The inhibition rate of Bacillus oryzae TCS004 against Alternaria alterniflora was used as the response value to screen out factors that significantly affected its activity.
[0098] Table 5. PB Experimental Design and Results ; Note: A. Glucose (%); B. Soluble peanut cake powder (%); C. Temperature (°C); D. Rotation speed (rpm); E. Culture time (h); F. Inoculum size (%); G. Initial pH; H. Liquid volume (%); Y. Inhibition rate (×100%).
[0099] Table 6. Analysis of Variance for Each Factor in PB ; Table 6 shows that the four factors of liquid volume, initial pH, culture time, and soluble peanut meal powder have positive effects, while the four factors of glucose, temperature, rotation speed, and inoculum size have negative effects. The analysis results indicate that the model's R... 2 =96.73%, R 2 The adj=88% and P=0.0366<0.05 indicate that the model is relatively reliable. Initial pH, culture temperature and culture time significantly affected the inhibition rate of the fermentation filtrate of strain TCS004 (P<0.05), while other factors did not significantly affect the inhibition rate of the fermentation filtrate of strain TCS004 (P>0.05).
[0100] (iv) Steepest Climb Test Based on the PB test results, three significant factors affecting the inhibition rate of Bacillus oryzae TCS004 fermentation filtrate against Alternaria were screened. The direction of the climb was determined by the positive or negative effect value, and the climbing step size was determined according to the magnitude of the factor effect value to quickly approach the maximum response surface region and determine the center point of the Box-Behnken Design (BBD). The inhibition rate was measured using the same method as in Example 5.
[0101] Table 7 Steepest Climb Test .
[0102] The gradient direction of the experimental values of the significantly influencing factors, initial pH, culture temperature, and culture time, was used as the climbing direction. The step size of the change was determined according to the magnitude of the response value of each factor. Fermentation was carried out under the conditions of 4% inoculum, 140 rpm rotation speed, and 30% liquid volume. The results of the steepest climbing experiment are shown in Table 7. As can be seen from Table 7, the fermentation filtrate of experimental group 4 had the highest inhibition rate, reaching 88.21%. Therefore, the initial pH of 8.5, temperature of 26 ℃, and fermentation time of 72 h were used for subsequent optimization experiments. Other conditions were 3.0% glucose, 4.0% soluble peanut cake powder, 30% liquid volume, 4% inoculum, and 140 rpm rotation speed.
[0103] (v) Box-Behnken Design (BBD) Experiment Using the BBD experimental design principle, the antibacterial rate was used as the response value, and the determination method was the same as in Example 5. Based on the center point obtained from the steepest climb test, 17 groups of experiments with 3 factors and 3 levels were designed using Design Expert 10.0 software, and the results were analyzed and processed.
[0104] Table 8 Box-Behnken Experimental Design and Results ; Note: A. Temperature (°C); B. pH; C. Time (h); Y. Antibacterial rate (×100%).
[0105] Table 9. Regression Analysis Results of Box-Behnken Experimental Design ; Note: A. Temperature (°C); B. pH; C. Time (h); R 2 =96.20%, R 2 adj =91.31%, *p<0.05, **p<0.01.
[0106] The three factors—temperature, pH, and time—in the steepest climb experiment were labeled A, B, and C, respectively. The results of the BBD experiment are shown in Table 8, and the results of the regression model variance analysis are shown in Table 9. Model R... 2 =96.20%, R 2 adj =91.31%, P=0.0004<0.01, the lack-of-fit term P=0.8395>0.05 indicates that the model is reliable and can be used to analyze and predict response values. A, A 2 C 2 The fermentation filtrate of *Bacillus cereus* TCS004 had a highly significant effect on the inhibition rate of *Alternaria alternata* (P < 0.01). 2 B×C significantly affected the inhibition rate of *Alternaria alternata* by the fermentation filtrate of *Bacillus oryzae* TCS004 (P < 0.05), while B, C, A×B, and A×C had some but insignificant effects (P > 0.05). The experimental results were analyzed using Design Expert 10.0 software, and a quadratic regression equation was fitted between the response value and the experimental factors: Y = 0.884 + 0.0088A - 0.0037B - 0.0025C - 0.005AB + 0.0025AC - 0.0075BC - 0.017A 2 -0.007B 2 -0.0145C 2 .
[0107] Contour plots and 3D surface plots were generated based on the regression equation. The results are shown below. Figure 13The results showed that the contour plot of the interaction between pH and time was elliptical, and the 3D surface plot was steep, indicating the strongest interaction; the contour plots of the interaction between pH and temperature, and between time and temperature were circular, and the 3D surface plots were stable, indicating relatively weaker interactions.
[0108] (vi) Response surface optimization verification experiment After response surface methodology optimization, a shake-flask fermentation verification experiment was conducted under optimal fermentation conditions. Using the inhibition rate of *Bacillus oryzae* TCS004 fermentation filtrate against *Alternaria alternata* under the initial fermentation conditions as a control, the inhibition rate of *Bacillus oryzae* TCS004 fermentation filtrate against *Alternaria alternata* under optimized fermentation conditions was determined. The determination method was the same as in Example 5.
[0109] Data analysis and regression equation solving using Design Expert 10.0 software revealed that the model has a maximum response value. The actual values of three factors were obtained through conversion: initial pH 8.3, culture temperature 26.6 ℃, and culture time 72.6 h. The predicted maximum response value Y, i.e., the inhibition rate, was 88.6%. To verify the accuracy of the model's predictions, the experiment was repeated three times under optimized fermentation conditions. The results showed that the Bacillus oryzae TCS004 fermentation filtrate had an inhibition rate of 89.77% against Alternaria alterniflora, exceeding the model's predicted value by 1.17%. The measured value was close to the predicted value from the regression equation, indicating that the mathematical model established in this study is reliable.
[0110] After single-factor optimization experiments and response surface methodology optimization, the optimal fermentation conditions for inhibiting Alternaria alternata fermentation filtrate against Alternaria were: 3.0% glucose, 4.0% soluble peanut meal, 30% liquid volume, initial pH 8.3, 4% inoculum size, culture temperature 26.6 ℃, rotation speed 140 rpm, and culture time 72.6 h. Under these optimal conditions, the inhibition rate of Bacillus oryzae TCS004 fermentation filtrate against Alternaria alternata was 89.77%, which was 13.21% higher than the inhibition rate before optimization. Figure 14 As shown, response surface methodology optimization can improve the antibacterial activity of fermentation filtrate against Alternaria alterniflora.
[0111] Example 7 This embodiment measures the antibacterial activity of Bacillus cereus TCS004 fermentation filtrate against Xanthomonas oryzae.
[0112] Test culture medium LB solid medium: 5.0 g yeast extract, 10.0 g tryptone, 10.0 g NaCl, 18.0 g agar powder, 1000 mL distilled water.
[0113] LB liquid medium: 5.0 g yeast extract, 10.0 g tryptone, 10.0 g NaCl, 1000 mL distilled water.
[0114] Improved fermentation medium (the fermentation-optimized medium in Example 6): 30.0 g glucose, 40.0 g soluble peanut cake powder, 1000 mL distilled water.
[0115] Test methods Take 100 μL of *Bacillus oryzae* TCS004 bacterial suspension from a thawed glycerol tube and spread it onto an LB agar plate. Incubate in the dark at 28 °C for 24 h. After streaking the plate three times, incubate in the dark at 28 °C for 48 h for later use.
[0116] Pick 2-3 single colonies of *Bacillus oryzae* TCS004 using a sterile inoculation loop and transfer them to 100 / 250 mL of LB liquid medium. Incubate at 28 °C and 180 rpm for 14 h to obtain the seed culture. Inoculate the seed culture at a volume fraction of 4% into 75 / 250 mL of modified fermentation medium and incubate at 26.6 °C and 140 rpm for 72.6 h to obtain the fermentation broth.
[0117] The fermentation broth of Bacillus cereus TCS004 was centrifuged at 4 ℃ and 12,000 rpm for 20 min. The supernatant was then filtered three times through a 22 μm microporous membrane to obtain the fermentation filtrate.
[0118] Remove the glycerol tubes of plant pathogenic bacteria from the -80 ℃ freezer, take 60 μL and spread it on LB solid plates. After 24 h, take a single colony and streak it. After three subcultures, take 2-3 single colonies and inoculate them into 100 mL / 250 mL LB liquid medium. Incubate at 28 ℃ and 180 rpm for 24 h to obtain the fermentation broth of plant pathogenic bacteria.
[0119] The inhibitory effect of Bacillus cereus TCS004 fermentation filtrate on plant pathogenic bacteria was determined using a simplified tube-disc method. 100 μL of plant pathogenic bacteria fermentation broth was evenly spread on LB agar plates. An 8 mm diameter well was punched in the center of each LB agar plate, and 50 μL of Bacillus cereus TCS004 fermentation filtrate was added to the well using a pipette. An LB agar plate containing 50 μL of sterile water was used as a control. The experiment was repeated three times.
[0120] Depend on Figure 15It can be seen that after adding Bacillus oryzae TCS004 fermentation filtrate to the wells of LB solid medium, a clear transparent inhibition zone was formed after Xanthomonas oryzae was coated around it and cultured, indicating that it has good antibacterial activity against this plant pathogen.
Claims
1. A type of Bacillus cereus TCS004, characterized in that, Its accession number is CGMCC NO.25850.
2. The application of Bacillus cereus TCS004 as described in claim 1 in nitrogen fixation, with accession number CGMCCNO.25850.
3. The application of Bacillus cereus TCS004 as described in claim 1 in siderogenic carriers, with accession number CGMCCNO.25850.
4. The use of Bacillus cereus TCS004 as described in claim 1 in the prevention and control of plant pathogenic fungi or bacteria, or in the preparation of microbial preparations for the prevention and control of plant pathogenic fungi or bacteria.
5. The application according to claim 4, characterized in that, The plant pathogenic fungi mentioned include *Marssonina coronaria*, *Macrophoma kawatsukai*, *Diaporthe citri*, *Monilinia laxa*, *Alternaria alternata*, *Colletotrichum fructicola*, *Septoria cucurbitacearum*, *Alternaria solani*, *Fusarium solani*, *Botrytis cinerea*, *Fusarium equiseti*, *Curvularia lunata*, *Alternaria mali* (apple-specific type), *Colletotrichum gloeosporioides*, *Fusarium incarnatum*, and *Botryosphaeria*. The fungi mentioned include *C. dothidea*, *Colletotrichum sublineolum*, *Fusarium oxysporum f.sp. vasinfectum*, *Colletotrichum siamense*, *Rhizoctonia solani*, *Fusarium graminearum*, *Sclerotinia sclerotiorum*, and *Phytophthora capsici*; the plant pathogenic bacteria mentioned include *Xanthomonas oryzae*.
6. A microbial preparation, characterized in that, The bacterium glutamate containing the Bacillus cereus TCS004 as described in claim 1 has the accession number CGMCC NO.25850.
7. The application of glucose as a carbon source in the Bacillus cereus TCS004 fermentation medium as described in claim 1, with accession number CGMCC NO.25850.
8. The application of peanut cake powder or peptone as a nitrogen source in the Bacillus cereus TCS004 fermentation medium as described in claim 1, with accession number CGMCC NO.25850.
9. A Bacillus cereus TCS004 fermentation medium according to claim 1, with accession number CGMCCNO.25850, characterized in that, It contains 1.0%-5.0% glucose, 1.00%-8.0% soluble peanut cake powder, 1000 mL distilled water, and an initial pH of 8-8.5; preferably, it contains 3.0% glucose, 4% soluble peanut cake powder, and 1000 mL distilled water.
10. The process for fermenting and culturing *Bacillus cereus* TCS004 in the fermentation medium according to claim 9, characterized in that, The liquid volume ratio is 28%-32% (75mL / 250mL), the inoculum size is 3.8%-4.2%, the culture temperature is 26-27℃, the rotation speed is 135-145rpm, and the culture time is 72-73h.