Capture probe composition, kit and application

By designing a capture probe composition that specifically binds to EV membrane proteins and combining it with a solid-phase support, and by adjusting the pH value, the problems of low EV separation and purification efficiency and insufficient purity in the existing technology have been solved, achieving efficient and low-damage EV separation and purification.

CN120843502APending Publication Date: 2025-10-28NANTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511196082.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-26
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

Existing technologies struggle to efficiently and effectively separate extracellular vesicles (EVs) with high purity, especially in removing impurities of similar density or size. Furthermore, conventional methods for EV purification may damage vesicle activity or introduce toxic substances.

Method used

A capture probe composition consisting of membrane-binding molecules, polydeoxythymidine, and initiating nucleic acid fragments is used. It is combined with a solid-phase carrier such as magnetic beads to form a hairpin structure according to the Hoogsteen principle. The aptamer specifically binds to EV membrane proteins, and the capture and release are achieved by adjusting the pH value, avoiding damage.

Benefits of technology

It achieves highly specific and efficient EV separation and purification, reduces impurity interference, is easy to operate, has good reusability, and is suitable for large-scale applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843502A_ABST
    Figure CN120843502A_ABST
Patent Text Reader

Abstract

The invention discloses a capture probe composition, a kit and application. The composition comprises a membrane binding molecule, polydeoxythymidine, a connecting arm and a probe s1 which is formed by sequentially connecting an initiation nucleic acid fragment 1 with the sequence shown as SEQ ID NO: 1, the probe s2 is formed by sequentially connecting an initiation nucleic acid fragment 2 of which the sequence is shown as SEQ ID NO: 2, a connecting arm, polydeoxythymidine and a membrane binding molecule; the probe H contains nucleic acid fragments for triggering complementary pairing of a nucleic acid fragment 1 and a nucleic acid fragment 2, and can spontaneously form a hairpin-shaped structure; the solid-phase carrier is used for loading nucleic acid fragments which can be complementarily paired with the connecting arms of the probes s1 and s2 on the basis of a Hoogsteen principle. The composition can be specifically combined with extracellular vesicles to realize specific separation and purification; the operation is simple, convenient, rapid and soft, and the potential damage to extracellular vesicles is small; the magnetic beads are used as solid-phase carriers and can be repeatedly used for more than five times, so that the capturing efficiency is relatively high, the economical efficiency is good, and the potential of large-scale application is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to nucleic acid probes, and more particularly to a capture probe composition, kit, and application. Background Technology

[0002] Extracellular vesicles (EVs) are tiny vesicles with a lipid bilayer structure actively released by cells. They are widely distributed in body fluids and play a crucial role in intercellular communication, disease diagnosis, and treatment. To further study their functions and applications, efficient and high-purity isolation of EVs is a primary step. Currently, various isolation methods have been developed, mainly relying on their physical or biochemical properties, but all have significant limitations.

[0003] Traditional methods based on physical properties are widely used but face purity challenges. Ultracentrifugation (especially density gradient methods) can process large-volume samples, but it takes 9-19 hours and the equipment is expensive, making it difficult to scale up. Ultrafiltration utilizes pore size for rapid separation and is relatively inexpensive, but the applied force can easily cause vesicle rupture and it is difficult to remove small-particle impurities such as protein aggregates. Size exclusion chromatography (SEC) can better maintain the integrity and bioactivity of EVs and has high yields, but it also cannot effectively distinguish contaminants such as lipoproteins that are similar in size to EVs. For example, the precipitation method used in the commercial ExoQuick kit is simple to operate and has outstanding yields, but the precipitant is difficult to remove completely, and the residue can interfere with subsequent experimental analyses. Furthermore, these methods based on size or density differences share a common drawback: they cannot effectively remove protein polymers with densities or sizes similar to EVs, which seriously affects sample purity.

[0004] New technologies based on biochemical characteristics are gradually being used for the separation and purification of EVs: Microfluidic technology can integrate multiple separation principles to achieve rapid and efficient separation, but its throughput is extremely low, making it difficult to handle the large number of samples required for clinical or research purposes. Moreover, the equipment is sophisticated and expensive, limiting its widespread use in routine laboratories. Affinity capture methods utilize the specific binding of antibodies to EV surface markers (such as CD9 and CD63) to achieve highly specific enrichment. However, excessively strong antigen-antibody binding often makes it difficult to release the captured EVs without damage. Forcibly using high-salt or chemical dissociation solutions can damage vesicle activity, and the introduced toxic substances are difficult to remove, which greatly affects subsequent analysis and applications. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide a highly specific capture probe composition for efficient and high-purity extracellular vesicle capture; the second purpose is to provide a kit containing the capture probe composition and its application.

[0006] Technical solution: The capture probe composition of the present invention comprises:

[0007] The probe s1 is composed of a membrane-binding molecule, polydeoxythymidine, a linker arm, and a trigger nucleic acid fragment 1 with the sequence shown in SEQ ID NO: 1, which are sequentially linked together.

[0008] The probe s2 is composed of a trigger nucleic acid fragment 2 as shown in SEQ ID NO: 2, a linker arm, a polydeoxythymidine, and a membrane-binding molecule linked sequentially.

[0009] Probe H contains nucleic acid fragments that are complementary to initiating nucleic acid fragment 1 and initiating nucleic acid fragment 2, and can spontaneously form a hairpin-shaped structure;

[0010] A solid-phase carrier of nucleic acid fragments whose load can be complementary to the linker arms of probes s1 and s2 based on the Hoogsteen principle;

[0011] The molar ratio of probes s1, s2, and H is 0.5-1.5:0.5-1.5:0.5-1.5. The membrane-binding molecules of probes s1 and s2 are independently selected from membrane structural lipids, membrane structural lipid analogs, or membrane protein aptamers, and at least one of them is a membrane protein aptamer.

[0012] Preferably, the linker sequence of probe s1 is 5'-TGTGTAAG-3', and the linker sequence of probe s2 is 5'-CTTACACA-3'.

[0013] Preferably, the polydeoxythymidine of probe s1 or s2 is composed of 10-20 deoxythymidines.

[0014] Preferably, the 3' ends of the probes s1 and s2 are modified with thionucleotides; more preferably, they are thiodeoxythymidine.

[0015] Preferably, the sequence of the probe H is as shown in SEQ ID NO: 14.

[0016] Preferably, the probe H is modified with a fluorescent group and a corresponding quenching group. The fluorescent group is any one of FAM, Cy5, Cy3, ROX, and TAMRA, and the quenching group is any one of BHQ1, BHQ2, and Dabcyl. More preferably, the sequence of the probe H is as shown in SEQ ID NO: 15, where the 17th position is a deoxythymidine modified with a BHQ1 quenching group, and the 37th position is a deoxythymidine modified with a FAM fluorescent group.

[0017] Preferably, the solid support is a magnetic bead or agarose bead with surface modified with N-hydroxysuccinimide or streptavidin, and the nucleic acid fragment loaded on the solid support is modified with an amino group or biotin at its 5' end.

[0018] Preferably, the 3' end of the nucleic acid fragment loaded on the solid-phase carrier is modified with a thionucleotide; more preferably, it is a thiodeoxyadenosine.

[0019] The kit described in this invention contains the aforementioned capture probe composition.

[0020] The application of the capture probe composition or kit described in this invention in capturing extracellular vesicles.

[0021] Preferably, the application steps include: mixing the capture probe composition or kit with the sample under acidic conditions, incubating, rinsing, and then eluting under neutral or weakly alkaline conditions to obtain extracellular vesicles.

[0022] Preferably, the acidic conditions are pH = 6.0-6.7, and the neutral or weakly alkaline conditions are pH = 7.2-8.0.

[0023] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The capture probe composition can specifically bind to the membrane proteins of extracellular vesicles through aptamers, thereby achieving specific separation and purification of extracellular vesicles. Compared with common separation and purification methods, it can effectively avoid interference from impurities; 2. The capture probe composition is based on solid-phase carrier and combines with the change of solution pH value for separation. The operation is simple, fast and gentle, and has little potential damage to extracellular vesicles; 3. Using magnetic beads as solid-phase carrier, extracellular vesicles can be repeatedly captured and released more than 5 times, with high capture efficiency, good economy, and potential for large-scale application. Attached Figure Description

[0024] Figure 1 Figure showing the particle size distribution of extracellular vesicles (EVs) purified by ultracentrifugation;

[0025] Figure 2 The results of the feasibility verification of the capture probe composition are shown in Figure A, where A is the fluorescence measurement results of the supernatant after capture under different EV and magnetic bead addition conditions, B is the fluorescence measurement results of the supernatant after capture under different capture pH conditions, and C is the fluorescence measurement results of the supernatant after release under different capture pH conditions.

[0026] Figure 3 The graph shows the results of verifying the reusability of the magnetic beads in the capture probe composition. In the graph, A is the fluorescence measurement result of the normalized capture supernatant, and B is the fluorescence measurement result of the normalized release supernatant.

[0027] Figure 4 A schematic diagram of the process for isolating and purifying EVs using the capture probe composition;

[0028] Figure 5 Transmission electron microscopy images of EVs purified by ultracentrifugation and EVs purified by the capture probe composition;

[0029] Figure 6To verify the bioactivity of EVs isolated and purified from the capture probe composition, A shows the results of laser confocal microscopy of cell endocytosis, B shows the cell migration at 0h and 24h after scratching, and C shows the statistical results of cell migration rate.

[0030] Figure 7 The graph shows the fluorescence assay results of EVs isolated and purified in PBS using the capture probe composition.

[0031] Figure 8 The fluorescence assay results of EV separation and purification of the capture probe composition in a complex environment containing serum are shown in the figure.

[0032] Figure 9 The images show the fluorescence measurement results of capture probe compositions designed based on different membrane-binding molecules for EV separation and purification. In the images, A shows the fluorescence measurement results after capture of the capture probe composition designed based on cholesterol and CD63, B shows the fluorescence measurement results after capture of the capture probe composition designed based on mucin 1 (MUC1) and CD63, and C shows the fluorescence measurement results after capture of the capture probe composition designed based on platelet-derived growth factor (PDGF) and CD63.

[0033] Figure 10 The images show the fluorescence assay results of capture probe compositions designed based on different membrane-binding molecules for EV separation and purification in a complex environment containing serum. In the images, A shows the fluorescence assay results after capture of the capture probe composition designed based on cholesterol and CD63, B shows the fluorescence assay results after capture of the capture probe composition designed based on mucin 1 (MUC1) and CD63, and C shows the fluorescence assay results after capture of the capture probe composition designed based on platelet-derived growth factor (PDGF) and CD63. Detailed Implementation

[0034] The technical solution of the present invention will be further described below.

[0035] Example 1: Probe Design and Synthesis

[0036] 1. Design and synthesis of probe s1

[0037] (1) Using the epithelial cell adhesion molecule (EpCAM) aptamer with the sequence shown in SEQ ID NO: 3 as the membrane binding molecule, polydeoxythymidine (T) as 16T, the fragment with the sequence shown in 5'-TGTGTAAG-3' as the linker arm, and the fragment with the sequence shown in SEQ ID NO: 1 as the initiating nucleic acid fragment 1, the probe eps1 with the sequence 5'-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTGTTTTTTTTTTTTTTTTTTTTTTGTGTAAGCCGATTCGCAA-3' (SEQ ID NO: 4) was synthesized;

[0038] (2) Using the epithelial cell adhesion molecule aptamer with the sequence shown in SEQ ID NO: 3 as the membrane binding molecule, polydeoxythymidine (T) is 16T, the fragment with the sequence shown in 5'-TGTGTAAG-3' is used as the linker arm, the fragment with the sequence shown in SEQ ID NO: 1 is used as the initiating nucleic acid fragment 1, and thiodeoxythymidine is linked after the initiating nucleic acid fragment 1 to synthesize the probe eps1-s with the sequence 5'-CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGC CTGTTTTTTTTTTTTTTTTTTTGTGTAAGCCGATTCGCAA*T*T*T*T-3' (SEQ ID NO: 5), where * indicates thiomodification of the phosphate backbone;

[0039] (3) Using cholesterol as a membrane-bound molecule, polydeoxythymidine (T) is 16T, a fragment with the sequence 5'-TGTGTAAG-3' is used as a linker arm, a fragment with the sequence SEQ ID NO: 1 is used as the initiating nucleic acid fragment 1, and thiodeoxythymidine is linked after the initiating nucleic acid fragment 1 to synthesize a cholesterol-coupled probe chols1-s with the sequence 5'-Cholesterol-TTTTTTTTTTTTTTTTTGTGTAAGCCGATTCGCAA*T*T*T*T-3' (SEQ ID NO: 6), where * indicates thiomodification of the phosphate backbone;

[0040] (4) Using the mucin 1 (MUC1) aptamer with the sequence shown in SEQ ID NO: 7 as the membrane binding molecule, polydeoxythymidine (T) is 16T, the fragment with the sequence shown in 5'-TGTGTAAG-3' is used as the linker arm, the fragment with the sequence shown in SEQ ID NO: 1 is used as the initiating nucleic acid fragment 1, and thiodeoxythymidine is linked after the initiating nucleic acid fragment 1 to synthesize the probe mucs1-s with the sequence 5'-GCAGTTGATCCTTTGGATACCCTGGTTTTTTTTTTTTTTTTTTG TGTAAGCCGATTCGCAA*T*T*T*T-3' (SEQ ID NO: 8), where * indicates thiomodification of the phosphate backbone;

[0041] (5) Using the platelet-derived growth factor (PDGF) aptamer with the sequence shown in SEQ ID NO: 9 as the membrane-bound molecule, polydeoxythymidine (T) is 16T, the fragment with the sequence shown in 5'-TGTGTAAG-3' is used as the linker arm, the fragment with the sequence shown in SEQ ID NO: 1 is used as the initiating nucleic acid fragment 1, and thiodeoxythymidine is linked after the initiating nucleic acid fragment 1 to synthesize the probe pds1-s with the sequence 5'-CAGGCTACGGCACGTAGAGCATCACCATGATCCTG TTTTTTTTTTTTTTTTTT TGTGTAAGCCGATTCGCAA*T*T*T*T-3' (SEQ ID NO: 10), where * indicates thiomodification of the phosphate backbone.

[0042] 2. Design and synthesis of probe S2

[0043] (1) Using the fragment shown in SEQ ID NO: 2 as the initiating nucleic acid fragment 2, the fragment shown in 5'-CTTACACA-3' as the linker arm, the polydeoxythymidine (T) as 16T, and the CD63 aptamer shown in SEQ ID NO: 11 as the membrane binding molecule, the probe 63s2 with the sequence 5'-CGCTTCTACACTATTCTTACACATTTTTTTTTTTTTTTTTTCACCCCACCTCGCTCCCGT GACACTAATGCTA-3' (SEQ ID NO: 12) was synthesized.

[0044] (2) Using the fragment shown in SEQ ID NO: 2 as the initiating nucleic acid fragment 2, the fragment shown in 5'-CTTACACA-3' as the linker arm, the polydeoxythymidine (T) as 16T, the CD63 aptamer shown in SEQ ID NO: 12 as the membrane-binding molecule, and thiodeoxythymidine linked to the CD63 aptamer fragment to synthesize the probe 63s2-s with the sequence 5'-CGCTTCTACACTATTCTTACACATTTTTTTTTTTTTTTTCACCCCA CCTCGCTCCCGTGACACTAATGCTA*T*T*T*T-3' (SEQ ID NO: 13), where * indicates thiomodification of the phosphate backbone.

[0045] 3. Design and synthesis of probe H

[0046] (1) Based on the initiating nucleic acid fragments of the aforementioned probes s1 and s2, a probe H0 with the sequence 5'-TTGCGAATCGGTAGTGTAGAAGCGCTCCATCGCTTCTACACTACCGAT-3' (SEQ ID NO: 14) was designed and synthesized;

[0047] (2) Based on the initiating nucleic acid fragments of the aforementioned probes s1 and s2, a probe H1 with the sequence 5'-TTGCGAATCGGTAGTG / iBHQ1-dT / AGAAGCGCTCCATCGCTTC / i6FAM-dT / ACACTA CCGAT-3' (SEQ ID NO: 15) was designed and synthesized. The 17th position of the probe is a deoxythymidine modified with a BHQ1 quenching group, and the 37th position is a deoxythymidine modified with a FAM fluorescent group.

[0048] 4. Design and synthesis of nucleic acid fragments loaded on solid-phase supports

[0049] Based on the s1 probe connector fragment shown in sequence 5'-TGTGTAAG-3' and the s2 probe connector fragment shown in sequence 5'-CTTACACA-3', the following were designed and synthesized according to the Hoogsteen pairing principle:

[0050] (1) A solid-phase carrier loaded with the nucleic acid fragment Bio8 with biotin conjugated at the 5' end as shown in the sequence 5'-biotin-TATATATAATACAGAGAATGTGT-3' (SEQ ID NO: 16);

[0051] (2) The nucleic acid fragment NH8 is loaded on a solid-phase carrier with a 5'-terminal amino-modified sequence as shown in 5'-NH2-TATATATAATACAGAGAATGTGT*A*A*A*A-3' (SEQ ID NO: 17), where * indicates thiomodification of the phosphate backbone.

[0052] 5. Design and synthesis of signal amplification probes

[0053] Based on the sequences of probes H0 and H1 mentioned above, probe H2 for fluorescence signal amplification was designed and synthesized with the sequence 5'-CGCTTCTACACTACCG ATTCGCAATATCGGTAGTGTAGAAGCGATGGAG-3' (SEQ ID NO: 18).

[0054] All the probes were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0055] Example 2: Preparation of solid-phase supports loaded with nucleic acid fragments

[0056] 1. Preparation of solid-phase supports for loading nucleic acid fragments based on biotin-streptavidin binding

[0057] Take 50 μL of streptavidin-modified magnetic bead stock solution (22308-1, Suzhou Beaver Biotechnology Co., Ltd.) with a magnetic bead concentration of 10 mg / mL and a particle size of 300 nm, add 100 μL of phosphate buffer (PBS), place it on a magnetic rack, and discard the PBS after magnetic separation. Repeat twice.

[0058] Then, 20 μL of 100 μM probe Bio8, 200 μL of PBS, and 1 μL of 1% Tween-20 were added sequentially, and the reaction was carried out at room temperature for 2 hours.

[0059] After the reaction, the magnetic beads were separated and washed three times with 0.05% phosphate-Tween buffer (PBST). The separated magnetic beads were then resuspended in 500 μL of PBS to obtain MB-bio8 magnetic bead suspension, which was stored at 4°C.

[0060] 2. Preparation of solid-phase supports based on amino-N-hydroxysuccinimide binding to loaded nucleic acid fragments

[0061] Take 100 μL of NHS-modified magnetic bead stock solution (70703-1, Suzhou Beaver Biotechnology Co., Ltd.) with a magnetic bead concentration of 10 mg / mL and a particle size of 2 μm, place it in a magnetic rack, discard the supernatant after magnetic separation, and wash 3 times with the Washing Buffer component in the kit.

[0062] Then, 15 μL of 100 μM probe NH8 and 200 μL of the Coupling Buffer component from the kit were added sequentially, and the reaction was carried out at room temperature for 3 h.

[0063] After the reaction, the magnetic beads were separated and washed three times with deionized water. 500 μL of 3M ethanolamine was added and reacted with the magnetic beads at room temperature for 2 h to block the unbound NHS groups. After the reaction, the magnetic beads were separated and washed three times with PBS. The magnetic beads were then resuspended in 500 μL of PBS to obtain the NHS-bio8 magnetic bead suspension, which was stored at 4 °C.

[0064] Example 3: Preparation of Extracellular Vesicle (EV) Suspension

[0065] (1) HepG2 cells were seeded in 10cm cell culture dishes and cultured in DMEM cell culture medium at 37°C and 5% CO2. After the cell confluence reached 80%, the cells were digested with trypsin and seeded into 15cm cell culture dishes. After the cells were cultured in DMEM cell culture medium at 37°C and 5% CO2 until the cell confluence reached 80%, the original culture medium was replaced with fetal bovine serum-free (FBS) DMEM cell culture medium and cultured for another 72 hours.

[0066] (2) Collect the culture supernatant. First, centrifuge at 1000×g for 5 min and recover the supernatant to remove cells. Then, centrifuge at 5000×g for 10 min and recover the supernatant to remove large cell debris. Finally, centrifuge at 10000×g for 20 min to remove large vesicles and recover the supernatant. Finally, centrifuge at 120000×g for 1 h at 4℃ and resuspend the bottom precipitate with PBS to obtain EV suspension.

[0067] Take 25 μL of the obtained EV suspension, add 4 mL of PBS buffer, mix well, and then use a nanoparticle tracking analyzer (NTA) to determine its particle size and concentration. The results are as follows: Figure 1 The maximum concentration corresponds to a particle size of 134.6 nm and a concentration of 2.5 × 10⁻⁶. 11 per mL.

[0068] Example 4: Feasibility verification of the capture probe composition

[0069] 1. EV content in the supernatant after EV capture by the capture probe composition

[0070] (1) Take 10 μL of the MB-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads, and mix them with 2 μL of 10 μM probe eps1, 2 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H1, 2 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0071] The pH of PBS was adjusted to 6.5 using 0.5M acetic acid, and the PBS was used to make up the previous system to 40 μL. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated to obtain the supernatant.

[0072] (2) Referring to the above experimental steps, three control groups were set up respectively: no EV suspension, no MB-bio8 magnetic bead suspension, and no EV suspension and MB-bio8 magnetic bead suspension. Finally, the supernatant of the group without EV suspension (no EV), the supernatant of the group without MB-bio8 magnetic bead suspension (EV control), and the supernatant of the group without EV suspension and MB-bio8 magnetic bead suspension (no EV and magnetic beads) were obtained.

[0073] (3) Take 20 μL of the supernatant obtained in steps 1 and 2 above, mix it with 75 μL of PBS, 2 μL of 10 μM probe H2 and 2 μL of 10 μM probe H1 prepared in the above example, incubate at 37°C for 5 min, then add 1 μL of 250 mM MgCl2, react at 37°C in the dark for 1 h, and then measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector.

[0074] The results are as follows Figure 2 As shown in Figure A, the fluorescence intensity in the supernatant decreased significantly after capture by the capture probe composition, indicating that the method can effectively capture EVs.

[0075] 2. EV content in the suspension after EV capture by the capture probe composition at different pH levels

[0076] (1) Take 10 μL of the MB-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads, and mix them with 2 μL of 10 μM probe eps1, 2 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H1, 2 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0077] The pH of PBS was adjusted to 6.5 using 0.5M acetic acid, and the PBS was used to make up the previous system to 40 μL. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated to obtain the supernatant after capture at pH 6.5.

[0078] Meanwhile, the separated magnetic beads were washed twice with PBS at pH 6.5, resuspended in 20 μL of PBS at pH 7.4, and reacted at 37 °C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain the supernatant after release at pH 6.5.

[0079] (2) Referring to the above experimental steps, without adding 12.5mM acetic acid, and using PBS with pH=7.4 in all steps, the supernatant after capture with pH=7.4 and the supernatant after release with pH=7.4 were finally obtained.

[0080] (3) Take 20 μL of the capture supernatant obtained in steps 1 and 2 above, mix it with 75 μL of PBS, 2 μL of 10 μM probe H2 and 2 μL of 10 μM probe H1 prepared in the above example, incubate at 37°C for 5 min, then add 1 μL of 250 mM MgCl2, react at 37°C in the dark for 1 h, and then measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector;

[0081] Take 20 μL of the supernatant obtained in steps 1 and 2 above, and mix it with 72.5 μL of PBS, 1 μL of 10 μM probe eps1, 1 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H2, and 2 μL of 10 μM probe H1 prepared in the above example. After incubation at 37°C for 5 min, add 1.5 μL of 250 mM MgCl2 and react at 37°C in the dark for 1 h. Then, measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector.

[0082] The fluorescence intensity detection results of the supernatant after capture are as follows: Figure 2 As shown in B, the fluorescence intensity detection results of the supernatant after release are as follows: Figure 2 As shown in Figure C, the results indicate that the capture probe composition can capture EVs more effectively under weakly acidic conditions (pH = 6.5), while under physiologically neutral conditions (pH = 7.4), it is more conducive to the release of captured EVs. Furthermore, this result suggests that pH level can act as a switch for capturing and releasing EVs.

[0083] 4. Reusability of magnetic beads in the capture probe composition

[0084] (1) Take 10 μL of MB-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads and mix them with 2 μL of 10 μM probe eps1, 2 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H1, 8 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0085] The pH of PBS was adjusted to 6.5 using 0.5M acetic acid, and the PBS was used to make up the previous system to 40 μL. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated to obtain the supernatant after the first capture.

[0086] Meanwhile, the separated magnetic beads were washed twice with PBS at pH 6.5, resuspended in 20 μL of PBS at pH 7.4, and reacted at 37 °C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain the supernatant after the first release.

[0087] (2) Repeat the above experimental steps 6 times to finally obtain the supernatant after the 2nd to 7th capture and release;

[0088] (3) According to the aforementioned experimental steps, replace the MB-bio8 magnetic bead suspension with PBS to obtain the supernatant control after capture; replace the EV suspension with PBS to obtain the supernatant control after release.

[0089] (4) Take 20 μL of the supernatant obtained from the first to seventh captures and the supernatant control after capture and release obtained from steps 1, 2 and 3 above, and mix them with 75 μL of PBS, 2 μL of 10 μM probe H2 and 2 μL of 10 μM probe H1 prepared in the above example. After incubating at 37°C for 5 min, add 1 μL of 250 mM MgCl2 and react at 37°C in the dark for 1 h. Then measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector and perform homogenization calculation based on the fluorescence intensity of the supernatant control after capture.

[0090] Take 20 μL of the supernatant obtained from steps 1 and 2 above after each of the 1st to 7th releases, and mix it with 72.5 μL of PBS, 1 μL of 10 μM probe eps1, 1 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H2, and 2 μL of 10 μM probe H1 prepared in the previous example. After incubation at 37°C for 5 min, add 1.5 μL of 250 mM MgCl2 and react at 37°C in the dark for 1 h. Then, measure the fluorescence intensity using an EnSpire 2300 multi-label microplate analyzer and normalize it according to the fluorescence intensity of the supernatant control after release.

[0091] The fluorescence intensity detection results of the supernatant after capture are as follows: Figure 3 As shown in Figure A, the fluorescence intensity detection results of the supernatant after release are as follows: Figure 3 As shown in B, during the 7 repeated captures, the fluorescence value generated by the uncaptured EVs gradually increased, and the fluorescence value generated by the EVs upon re-release gradually decreased. Moreover, the trend of change increased from the 6th capture, meaning that the magnetic beads in the capture probe composition can repeatedly capture and release EVs at least 5 times.

[0092] Example 5: Characterization and performance analysis of EVs obtained by separation and purification using the capture probe composition

[0093] A schematic diagram of the process for separating and purifying EVs using the capture probe composition is shown below. Figure 4 As shown.

[0094] 1. Morphological characterization of EVs before and after separation and purification

[0095] (1) Take 10 μL of MB-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads and mix them with 2 μL of 10 μM probe eps1, 2 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H1, 5 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0096] The pH of PBS was adjusted to 6.5 using 0.5M acetic acid, and the PBS was used to make up the previous system to 40 μL. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated, and the magnetic beads were washed twice with PBS at pH 6.5. The mixture was then resuspended in 20 μL of PBS at pH 7.4 and reacted at 37°C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain the purified EV suspension.

[0097] (2) Take 10 μL of the EV suspension obtained in Example 2 and the EV suspension obtained above, and drop them onto the copper grid respectively. After standing for 5 min, remove the excess liquid with filter paper. Take 10 μL of 3% uranium acetate and drop it onto the copper grid. After standing for 1 min, remove the excess liquid with filter paper. Repeat the uranium acetate staining once. After air drying, copper grids with EV before loading separation and purification (EV) and EV after loading separation and purification (released EV) are obtained and observed by transmission electron microscopy (TEM).

[0098] The results are as follows Figure 5 As shown, the isolated and purified EV is not significantly different in morphology from the EV obtained in Example 2, indicating that the isolated and purified EV also has a complete spherical vesicle structure.

[0099] 2. Bioactivity analysis of the obtained EVs

[0100] (1) Take 20 μL of the NHS-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads, and mix them with 10 μL of 10 μM probe eps1-s, 10 μL of 10 μM probe 63s2-s, 10 μL of 10 μM probe H0, 50 μL of EV suspension, 0.71 μL of 125 mM acetic acid, 5 μL of 250 mM MgCl2 and 0.5 μL of 5 mM DiO prepared in the previous example;

[0101] The pH of PBS was adjusted to 6.5 using 0.5M acetic acid, and the PBS was used to make up the previous system to 200 μL. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated, and the magnetic beads were washed twice with PBS at pH 6.5. The mixture was then resuspended in 50 μL of PBS at pH 7.4 and reacted at 37°C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain the EV suspension purified by this method.

[0102] (2) Following the above experimental steps, replace the EV suspension with PBS to obtain the control group suspension;

[0103] (3) The EV suspension and control group suspension separated and purified by this method were mixed with 200 μL of DMEM medium, filtered through a 0.22 μm filter membrane for sterilization, and then added to a confocal culture dish for culturing HepG2 cells. The mixture was cultured at 37℃ and 5% CO2 for 8 h.

[0104] Wash the cells three times with PBS, add 100 μL of Hoechst staining solution diluted in DMEM medium, stain at 37°C in the dark for 10 min, wash three times with PBS, add 300 μL of PBS to cover the cells, and observe using a laser confocal microscope.

[0105] (4) Take another 24-well plate containing HepG2 cells with a density of 90%, discard the culture medium, wash the cells twice with PBS and make a scratch of about 600 μm, then rinse twice with PBS to remove the exfoliated cells.

[0106] Add 500 μL of DMEM to each of the EV suspension obtained above based on H0 and the control group suspension, then filter with a 0.22 μm filter membrane for sterilization, and culture the cells at 37℃ and 5% CO2 for 24 h, and record the changes in scratch width at 0 and 24 h.

[0107] Confocal microscopy images such as Figure 6 As shown in Figure A, the isolated and purified EVs were intracytosed into the cytoplasm of HepG2 cells, exhibiting strong green fluorescence; the control group, on the other hand, only showed weak green background fluorescence.

[0108] Scratch width image as Figure 6 As shown in BC, after 24 hours of culture, the migration rate of HepG2 cells with the addition of isolated and purified EV was 0.238, while the migration rate of the control group was only 0.1, indicating that the isolated and purified EV maintained good biological activity.

[0109] Example 6: Efficiency of EV separation and purification by the capture probe composition under different environments

[0110] 1. Efficiency of EV separation and purification in PBS

[0111] (1) Take 10 μL of MB-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads and mix them with 2 μL of 10 μM probe eps1, 2 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H1, 3 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0112] The pH of PBS was adjusted to 6.5 using 0.5M acetic acid, and the PBS was used to make up the previous system to 40 μL. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated, and the magnetic beads were washed twice with PBS at pH 6.5. The mixture was then resuspended in 20 μL of PBS at pH 7.4 and reacted at 37°C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain the purified EV suspension.

[0113] (2) Referring to the above experimental steps, without adding magnetic beads, 3, 2.5, 2, 1.5 or 0 μL of the EV suspension prepared in the above examples were added to the reaction system respectively, and finally control group EV suspensions with different concentration gradients were obtained.

[0114] Take 20 μL each of the purified EV suspension obtained in steps 1 and 2 above and the control group EV suspension, and mix them with 72.5 μL PBS, 1 μL of 10 μM probe eps1, 1 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H2, and 2 μL of 10 μM probe H1 prepared in the above example. After incubation at 37°C for 5 min, add 1.5 μL of 250 mM MgCl2 and react at 37°C in the dark for 1 h. Then, measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector.

[0115] The results are as follows Figure 7 As shown, with EV suspension concentration and corresponding fluorescence intensity as independent variables, the standard curve equation for EV suspension concentration-fluorescence intensity was obtained by fitting: Y = 5269 × X + 2535, R 2 =0.968. Substituting the fluorescence intensity value generated by the isolated and purified EV into the calculation, the capture efficiency of the capture probe composition in the PBS system is 79%.

[0116] 2. Efficiency of EV isolation and purification in complex systems (serum)

[0117] (1) Take 10 μL of the NHS-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads, and mix them with 2 μL of 10 μM probe eps1-s, 2 μL of 10 μM probe 63s2-s, 2 μL of 10 μM probe H1, 3 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0118] The above system was supplemented to 40 μL with 20% exosome-free serum diluted with PBS at pH 6.5. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated, washed twice with PBS at pH 6.5, resuspended in 50 μL of PBS at pH 7.4, and reacted at 37°C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain the purified EV suspension.

[0119] (2) Referring to the above experimental steps, without adding magnetic beads, 3, 2.5, 2, 1.5 and 0 μL of the EV suspension prepared in the above example were added to the reaction system respectively, and finally control group EV suspensions with different concentration gradients were obtained;

[0120] Take 20 μL each of the purified EV suspension obtained in steps 1 and 2 above and the control group EV suspension, and mix them with 72.5 μL PBS, 1 μL of 10 μM probe eps1, 1 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H2, and 2 μL of 10 μM probe H1 prepared in the above example. After incubation at 37°C for 5 min, add 1.5 μL of 250 mM MgCl2 and react at 37°C in the dark for 1 h. Then, measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector.

[0121] The results are as follows Figure 8 As shown, with EV suspension concentration and corresponding fluorescence intensity as independent variables, the standard curve equation for EV suspension concentration-fluorescence intensity was obtained by fitting: Y = 5860 × X + 3052, R 2 =0.998. Substituting the fluorescence intensity value generated by the isolated and purified EV into the calculation, the capture efficiency of the capture probe composition in the complex system containing serum is 72.6%.

[0122] Example 7: Efficiency of different capture probe compositions in separating and purifying EVs

[0123] 1. Capture probe compositions designed based on different membrane-binding molecules for EV separation and purification

[0124] (1) Take 5 μL of MB-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads and mix them with 2 μL of 10 μM probe chols1-s or probe mucs1-s or probe pds1-s, 2 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H1, 2 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0125] The pH of PBS was adjusted to 6.5 using 0.5M acetic acid, and the PBS was used to make up the previous system to 40 μL. The mixture was stirred evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated, and the magnetic beads were washed twice with PBS at pH 6.5. The mixture was then resuspended in 20 μL of PBS at pH 7.4 and reacted at 37°C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain EV suspensions purified based on chols1-s, EV suspensions purified based on mucs1-s, and EV suspensions purified based on pds1-s.

[0126] (2) Referring to the above experimental steps, based on each s1 probe, six control groups were set up respectively: no EV suspension added, no s1 probe added, no s2 probe added, no H1 probe added, no pH adjustment = 6.5, and no MgCl2 added. Finally, the EV suspensions separated and purified from the corresponding control groups were obtained.

[0127] Take 20 μL each of the purified EV suspension obtained in steps 1 and 2 above and the control group EV suspension, and mix them with 72.5 μL PBS, 1 μL of 10 μM probe chols1-s or probe mucs1-s or probe pds1-s prepared in the above example, 1 μL of 10 μM probe 63s2, 2 μL of 10 μM probe H2, and 2 μL of 10 μM probe H1. After incubating at 37 °C for 5 min, add 1.5 μL of 250 mgCl2 and react at 37 °C in the dark for 1 h. Then, measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector.

[0128] The results are as follows Figure 9 As shown, when the system is intact, capture probe compositions based on different membrane-binding molecules can effectively separate and purify EVs.

[0129] 2. Efficiency of EV separation and purification in complex systems (serum) using capture probe compositions designed based on different membrane-binding molecules.

[0130] (1) Take 30 μL of the NHS-bio8 magnetic bead suspension prepared in Example 2, separate the magnetic beads, and mix them with 2 μL of 10 μM probe chols1-s or probe mucs1-s or probe pds1-s, 2 μL of 10 μM probe 63s2-s, 2 μL of 10 μM probe H1, 2 μL of EV suspension, 1 μL of 12.5 mM acetic acid and 1 μL of 250 mM MgCl2 prepared in the previous example;

[0131] The above system was supplemented to 40 μL with 20% exosome-free serum, and mixed evenly at 4°C in the dark for 40 min. After the reaction, the magnetic beads were separated, washed twice with PBS of pH 6.5, resuspended in 50 μL of PBS of pH 7.4, and reacted at 37°C for 20 min to release the EVs captured by the magnetic beads. After the reaction, the magnetic beads were separated to obtain the purified EV suspension.

[0132] (2) Referring to the above experimental steps, based on each s1 probe, 2, 1.6, 1.4, 1.2, 1 or 0 μL of the EV suspension prepared in the above examples were added to the reaction system without adding magnetic beads, and finally control group EV suspensions with different concentration gradients were obtained.

[0133] Take 50 μL each of the purified EV suspension obtained in steps 1 and 2 above and the control group EV suspension, and mix them with 72.5 μL PBS, 1 μL of 10 μM probe chols1-s or probe mucs1-s or probe pds1-s prepared in the above example, 1 μL of 10 μM probe 63s2-s, 2 μL of 10 μM probe H2, and 2 μL of 10 μM probe H1. After incubating at 37 °C for 5 min, add 1.5 μL of 250 mgCl2 and react at 37 °C in the dark for 1 h. Then, measure the fluorescence intensity using an EnSpire 2300 multi-label microplate detector.

[0134] The results are as follows Figure 10 As shown, with EV suspension concentration and corresponding fluorescence intensity as independent variables, the standard curve equation for the EV suspension concentration-fluorescence intensity based on the chols1-s+63s2-s capture probe composition is Y=4665×X+8409, R 2 =0.974, the capture efficiency of the capture probe composition is calculated to be 46%; the standard curve equation of EV suspension concentration-fluorescence intensity based on mucs1-s+63s2-s is Y=5225×X+6673, R 2 =0.978, the capture efficiency of the capture probe composition is calculated to be 49%; the standard curve equation of EV suspension concentration-fluorescence intensity based on pds1-s+63s2-s is Y=6683×X+4899, R 2 =0.979, and the capture efficiency of the capture probe composition can be calculated to be 54%.

Claims

1. A capture probe composition, characterized in that, include: The probe s1 is composed of a membrane-binding molecule, polydeoxythymidine, a linker arm, and a trigger nucleic acid fragment 1 with the sequence shown in SEQ ID NO: 1, which are sequentially linked together. The probe s2 is composed of a trigger nucleic acid fragment 2 as shown in SEQ ID NO: 2, a linker arm, a polydeoxythymidine, and a membrane-binding molecule linked sequentially. Probe H contains nucleic acid fragments that are complementary to initiating nucleic acid fragment 1 and initiating nucleic acid fragment 2, and can spontaneously form a hairpin-shaped structure; A solid-phase carrier of nucleic acid fragments whose load can be complementary to the linker arms of probes s1 and s2 based on the Hoogsteen principle; Among them, the membrane-binding molecules of probes s1 and s2 are independently selected from membrane structural lipids, membrane structural lipid analogs or membrane protein aptamers, and at least one of them is a membrane protein aptamer.

2. The capture probe composition according to claim 1, characterized in that, The connector sequence of probe s1 is 5'-TGTGTAAG-3', and the connector sequence of probe s2 is 5'-CTTACACA-3'.

3. The capture probe composition according to claim 1, characterized in that, The polydeoxythymidine of probe s1 or s2 is composed of 10-20 deoxythymidines.

4. The capture probe composition according to claim 1, characterized in that, The 3' ends of the probes s1 and s2 are modified with thionucleotides.

5. The capture probe composition according to claim 1, characterized in that, The probe H is modified with a fluorescent group and a corresponding quenching group.

6. The capture probe composition according to claim 1, characterized in that, The solid support is a magnetic bead or agarose bead with surface modified with N-hydroxysuccinimide or streptavidin, and the nucleic acid fragment loaded on the solid support is modified with an amino group or biotin at its 5' end.

7. The capture probe composition according to claim 1, characterized in that, The nucleic acid fragment loaded on the solid-phase support is modified with thionucleotides at its 3' end.

8. A reagent kit, characterized in that, The composition comprising the capture probe according to any one of claims 1-7.

9. The use of a capture probe composition according to any one of claims 1-7 or a kit according to claim 8 in capturing extracellular vesicles.

10. The application according to claim 9, characterized in that, The application steps include: mixing the capture probe composition or kit with the sample under acidic conditions, incubating, rinsing, and then eluting under neutral or weakly alkaline conditions to obtain extracellular vesicles.