Aptamer for identifying chemotactic factor CCL2 and application thereof

Abstract

The invention discloses a nucleic acid aptamer for identifying a chemotactic factor CCL2 and application of the nucleic acid aptamer. The nucleotide sequence of the nucleic acid aptamer for identifying the chemotactic factor CCL2 is as shown in SEQ ID NO: 1 or SEQ ID NO: 2. The nucleic acid aptamer for identifying the chemotactic factor CCL2 has the advantages of high specificity, small molecular weight, stable chemical property, easiness in storage and marking and the like, and can identify the chemotactic factor CCL2; meanwhile, the recognition strategy of the aptamer and the antibody sandwich can be effectively used for developing CCL2 detection reagents, test strips and kits with high sensitivity and wide linear range.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a nucleic acid aptamer that recognizes the chemokine CCL2 and its application. Background Technology

[0002] Chemokine CCL2 (CC chemokine ligand 2, also known as MCP-1) is an important member of the chemokine family. It is a potent inducer for monocytes / macrophages, basophils, activated T cells, and NK cells, and is mainly expressed and secreted by vascular endothelial cells, smooth muscle cells, neutrophils, monocytes / macrophages, fibroblasts, and B lymphocytes. The precursor CCL2 molecule consists of a signal peptide and a mature peptide. After removing the N-terminal signal peptide, the mature CCL2 protein contains only 76 amino acids with a molecular weight of approximately 9-15 kDa. Studies have shown that CCL2 is associated with various human infectious diseases (such as inflammation and sepsis). It can recruit inflammatory cells and induce infiltration during inflammation. CCL2 binds to its receptor CCR2, chemotactically activating immune cells to migrate to the site of inflammation, initiating and promoting inflammatory responses. Elevated CCL2 levels are often associated with diseases such as lupus nephritis, multiple sclerosis, acute pancreatitis, temporal arteritis, and rheumatoid arthritis. CCL2 upregulation can also be detected in some tumors such as gastric cancer, breast cancer, ovarian cancer, malignant glioma, and esophageal squamous cell carcinoma. Clinical studies on adult sepsis have confirmed that adult patients with sepsis and septic shock have significantly higher CCL2 levels than healthy individuals, and the severity of the disease is correlated with serum CCL2 levels. CCL2 can be used as an indicator for clinical assessment of the severity of sepsis. In addition, CCL2 also plays an indispensable role in diseases such as coronary atherosclerosis, ischemic stroke, immune vasculitis, diabetes and its complications.

[0003] Therefore, CCL2 is closely related to the assessment of various diseases and is an important target for human disease treatment intervention. It is expected to be gradually applied in clinical practice in the future, playing a crucial role in the diagnosis and treatment of related diseases. Currently, the mainstream detection platform for CCL2 is enzyme-linked immunosorbent assay (ELISA). This method has high sensitivity and specificity, but it has a long reaction time, low automation, narrow linear range, and poor precision, which cannot fully meet the requirements of clinical applications. Furthermore, other platforms used to detect CCL2, including Western blotting, flow cytometry, and liquid chromatography-mass spectrometry (LC-MS / MS), are limited by their complex operation, single sample requirements, and high equipment costs, making them difficult to popularize in clinical testing. Therefore, it is essential to establish a highly sensitive, specific, short-time, and inexpensive quantitative determination method for CCL2 to provide accurate diagnostic evidence for clinical practice.

[0004] Immunochromatography is a detection technique that uses nanoscale labeled probes as tracers and markers. It is not only simple to operate, rapid, highly specific, and stable, but also portable, and has been widely used in clinical diagnostics, food safety, drug testing, and environmental pollution control. Fluorescent immunochromatography, as a novel immunoassay technique, utilizes fluorescent microspheres to bind with antibodies to form fluorescently labeled antibodies, which are then detected through an antigen-antibody reaction. This technique retains the advantages of traditional colloidal gold immunochromatography—simple operation, fast detection speed, and portability—while also achieving accurate quantification of results through fluorescence tracing enhancement technology, making it a promising mainstream technique for rapid on-site detection. Currently, most fluorescent immunochromatographic techniques use antibodies as capture probes for target molecules. While these antibodies have high specificity, they are easily limited by antibody immunogenicity, long preparation cycles, high costs, large batch-to-batch variability, and poor stability. Therefore, to overcome the limitations of antibodies, researchers have begun to search for novel molecular probes that can specifically bind to target molecules.

[0005] Nucleic acid aptamers are single-chain oligonucleotides that can fold into specific three-dimensional conformations and bind with target molecules with high affinity and specificity through various interactions (such as hydrogen bonds, van der Waals forces, and electrostatic forces). They are typically isolated using Systematic Evolutionary Ligand Expansion (SELEX) technology and are known as "chemical antibodies." Compared to antibodies, nucleic acid aptamers offer unique advantages such as small size, low cost, ease of chemical synthesis, precise modification, good programmability, and high biocompatibility. They also eliminate the need for animal immunization, feeding, protein extraction, and purification processes. Furthermore, they can specifically bind to various target molecules, including metal ions, amino acids, proteins, and cells. Therefore, nucleic acid aptamers hold immense potential in biochemical analysis, environmental monitoring, basic medicine, and new drug synthesis. Based on these characteristics, using nucleic acid aptamers as recognition and detection probes, leveraging their high affinity, high specificity, and high recognition efficiency, to develop CCL2 detection products can provide technical support for early disease diagnosis, clinical medication, and prognostic monitoring, demonstrating significant clinical value.

[0006] In view of this, the present invention is hereby proposed. Summary of the Invention

[0007] The purpose of this invention is to provide a nucleic acid aptamer for recognizing the chemokine CCL2 and its application. The nucleic acid aptamer of this invention can specifically recognize the chemokine CCL2 and has high affinity, so that the product prepared to recognize / detect the chemokine CCL2 has the characteristics of high detection sensitivity and wide linear range.

[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:

[0009] The first aspect of the present invention provides a nucleic acid aptamer for recognizing the chemokine CCL2, wherein the nucleotide sequence of the nucleic acid aptamer for recognizing the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0010] A second aspect of the present invention provides the application of the above-described nucleic acid aptamer for recognizing the chemokine CCL2 in the preparation of products for detecting or recognizing the chemokine CCL2.

[0011] Preferably, the product includes test strips, reagent kits, and detection reagents.

[0012] A third aspect of the present invention provides a test strip for detecting or identifying the chemokine CCL2, the test strip comprising a backing plate, a nitrocellulose membrane, a sample pad, an absorbent pad, and a binding pad;

[0013] The binding pad includes a nucleic acid aptamer labeled with quantum dot microspheres that recognizes the chemokine CCL2.

[0014] Preferably, the method for preparing the nucleic acid aptamer labeled with the quantum dot microspheres that recognizes the chemokine CCL2 includes:

[0015] Avidin-modified nucleic acid aptamers that recognize the chemokine CCL2 were coupled with streptavidin-modified quantum dot microspheres.

[0016] Preferably, the nucleotide sequence of the nucleic acid aptamer that recognizes the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0017] Preferably, the nitrocellulose membrane is provided with a detection line and a quality inspection line;

[0018] The detection line is coated with a nucleic acid aptamer or a first monoclonal antibody that recognizes the chemokine CCL2.

[0019] The quality control line is coated with a second monoclonal antibody that recognizes the chemokine CCL2.

[0020] Preferably, the nucleic acid aptamer for recognizing chemokine CCL2 on the binding pad has a different nucleotide sequence than the nucleic acid aptamer for recognizing chemokine CCL2 coated on the detection line.

[0021] A fourth aspect of the present invention provides a detection reagent for detecting or identifying the chemokine CCL2, the detection reagent comprising a nucleic acid aptamer that identifies the chemokine CCL2.

[0022] Preferably, the nucleotide sequence of the nucleic acid aptamer that recognizes the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0023] Compared with the prior art, the beneficial effects of the present invention include at least the following:

[0024] The nucleic acid aptamer for recognizing the chemokine CCL2 of this invention has advantages such as high specificity, small molecular weight, chemical stability, and ease of storage and labeling, and can recognize the chemokine CCL2. At the same time, the recognition strategy of sandwiching the above-mentioned nucleic acid aptamer with an antibody can be effectively used to develop CCL2 detection reagents, test strips and kits with high sensitivity and wide linear range. Attached Figure Description

[0025] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0026] Figure 1 The results of flow cytometry analysis of the binding ability of the secondary library in Embodiment 2 of the present invention;

[0027] Figure 2 The surface plasmon resonance analysis of the binding affinity between CCL2-6 and CCL2-11 in Example 3 of this invention;

[0028] Figure 3 This is an example of surface plasmon resonance analysis of different epitopes of CCL2-6 and CCL2-11 binding proteins in Example 4 of the present invention;

[0029] Figure 4 This is a graph showing the detection effect of the test strip used to detect or identify the chemokine CCL2 in Example 8 of the present invention on the CCL2 antigen standard;

[0030] Figure 5 This is a graph showing the detection effect of the test strip used to detect or identify the chemokine CCL2 in Example 9 of the present invention on the CCL2 antigen standard. Detailed Implementation

[0031] The embodiments of the technical solution of the present invention will be described in detail below with reference to the examples. The following embodiments are only used to illustrate the technical solution of the present invention more clearly, and are therefore only examples, and should not be used to limit the scope of protection of the present invention.

[0032] It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning as understood by those skilled in the art to which this invention pertains.

[0033] This invention provides a nucleic acid aptamer for recognizing the chemokine CCL2. The nucleotide sequence of the nucleic acid aptamer for recognizing the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO: 2. The sequence shown in SEQ ID NO: 1 is CACGCATAACTACGCACGTTAGTGGCAGTGTTGGTGGGATGTGTGGTTAT GCGTG; the sequence shown in SEQ ID NO: 2 is CACGCATAACCGGGAGCGTTGGTCGTCATATCTTCGCAGAAGGGCAGTTA TGCGTG.

[0034] The nucleic acid aptamer for recognizing the chemokine CCL2 of this invention has advantages such as high specificity, small molecular weight, chemical stability, and ease of storage and labeling, and can recognize the chemokine CCL2. At the same time, the recognition strategy of sandwiching the above-mentioned nucleic acid aptamer with an antibody can be effectively used to develop CCL2 detection reagents, test strips and kits with high sensitivity and wide linear range.

[0035] Another embodiment of the present invention provides the application of the above-mentioned nucleic acid aptamer for recognizing chemokine CCL2 in the preparation of products for detecting or recognizing chemokine CCL2.

[0036] In some embodiments, the product includes test strips, kits, and detection reagents.

[0037] Another embodiment of the present invention provides a test strip for detecting or identifying the chemokine CCL2, the test strip comprising a backing plate, a nitrocellulose membrane, a sample pad, an absorbent pad, and a binding pad;

[0038] The binding pad includes a nucleic acid aptamer labeled with quantum dot microspheres that recognizes the chemokine CCL2.

[0039] This invention does not strictly limit the preparation method of the nucleic acid aptamer for recognizing the chemokine CCL2 labeled with quantum dot microspheres. Those skilled in the art can prepare it according to conventional methods in the field. In one embodiment, the preparation method of the nucleic acid aptamer for recognizing the chemokine CCL2 labeled with quantum dot microspheres includes:

[0040] Avidin-modified nucleic acid aptamers that recognize the chemokine CCL2 were coupled with streptavidin-modified quantum dot microspheres.

[0041] In this invention, the nucleic acid aptamer in the binding pad that includes quantum dot microspheres labeled to recognize the chemokine CCL2 can be one type (e.g., a nucleic acid aptamer with a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2) or multiple types (e.g., a combination of nucleic acid aptamers with nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2).

[0042] In one embodiment, the nucleotide sequence of the nucleic acid aptamer that recognizes the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0043] In one embodiment, the nitrocellulose membrane is provided with a detection line and a quality inspection line;

[0044] The detection line is coated with a nucleic acid aptamer or a first monoclonal antibody that recognizes the chemokine CCL2.

[0045] The quality control line is coated with a second monoclonal antibody that recognizes the chemokine CCL2.

[0046] In one embodiment, the nucleic acid aptamer for recognizing chemokine CCL2 on the binding pad has a different nucleotide sequence than the nucleic acid aptamer for recognizing chemokine CCL2 coated on the detection line.

[0047] In another embodiment of the present invention, a detection reagent for detecting or identifying the chemokine CCL2 is provided, the detection reagent comprising a nucleic acid aptamer that identifies the chemokine CCL2.

[0048] In one embodiment, the nucleotide sequence of the nucleic acid aptamer that recognizes the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0049] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0050] Example 1

[0051] This embodiment describes a method for recognizing nucleic acid aptamers of the chemokine CCL2, the method comprising:

[0052] (1) Preparing to screen the initial library:

[0053] The initial library used in this embodiment consists of a 20nt primer fragment fixed at both ends (the front nucleic acid sequence is shown in SEQ ID NO: 3, and the back nucleotide sequence is shown in SEQ ID NO: 4) and a 40nt random fragment in the middle, with a total length of 80nt, specifically: GACGGCACTCGACGCATTAC-(N)40-CTCAAGGGTCCTAGGGAGCC; the initial library was diluted with phosphate buffer to a concentration of 10μM.

[0054] (2) Nucleic acid aptamer screening:

[0055] Take 300 μl of carboxylated magnetic beads (Invitrogen, Dynabeads) TM MyOne TM Carboxylic Acid (#65012) was washed four times with 500 μL of ultrapure water. The magnetic beads were then hooked with a magnet, and the supernatant was discarded. Equal volumes of 100 μL each of prepared NHS (N-hydroxysuccinimide; 0.5 M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.5 M aqueous solution) were mixed and added to the magnetic beads. The beads were incubated at room temperature for 60 min to activate the carboxyl groups on the surface. Afterward, the beads were washed once with DPBS buffer and set aside for use.

[0056] Take 50 μg of CCL2 protein (Thermo Fisher, concentration 0.5 mg / mL), add 200 μL of sodium acetate solution (10 mM), mix well, and add to the activated magnetic beads as described above. Incubate at room temperature for 2 h on a vertical mixer. The CCL2 protein will couple to the surface of the magnetic beads through the amino groups on its surface.

[0057] After coupling is complete, place the coupling tube on a magnetic rack, discard the supernatant, wash once with DPBS buffer, take 200 μl of ethanolamine and add it to the magnetic beads. Incubate at room temperature for 40 minutes on a vertical mixer to block unreacted activation sites on the surface of the magnetic beads. Then place it on a magnetic rack, discard the blocking solution, wash three times with 200 μl of DPBS buffer, and finally dissolve in 200 μl of DPBS buffer.

[0058] Preparation of reverse screening magnetic beads: Other interfering proteins, such as human serum albumin, BSA, and His, are coupled to the magnetic beads. The steps and concentrations for coupling the reverse screening proteins are the same as those for coupling CCL2 protein. The concentration of human serum albumin is 2 mg / mL, the concentration of bovine serum albumin is 1 mg / mL, and the concentration of His is 0.5 mg / mL.

[0059] Library dissolution and renaturation: Take a 1 OD random single-stranded nucleotide library, centrifuge at 10,000 rpm for 3 minutes, add PBS buffer to dissolve, denature in a 95℃ metal bath for 10 minutes, then cool on ice for 5 minutes, and place at room temperature for 20 minutes to form a stable conformation.

[0060] Library and magnetic bead incubation: A certain amount of reverse screening magnetic beads were washed with PBS buffer. The treated library was added to the reverse screening magnetic beads, along with a certain amount of herring sperm DNA and sodium chloride solution. After mixing, the mixture was incubated at room temperature for a period of time in a vertical mixer. The mixture was then placed on a magnetic rack, and the supernatant was collected for positive screening with CCL2 protein magnetic beads. The first round involved only positive screening. From the second round onwards, reverse screening with magnetic beads was performed before positive screening targeting CCL2 protein. After both positive and reverse screening, 200 μL of ddH2O was added to the magnetic beads, and the mixture was incubated in a 95°C metal bath for 10 minutes. The mixture was then cooled on ice for a period of time, and the supernatant was magnetically aspirated as product 1.

[0061] As the number of screening rounds increases, so does the screening pressure. For example, the amount and type of magnetic beads used for reverse screening, as well as the incubation time, are gradually increased, while the amount of CCL2 protein magnetic beads used and the incubation time are gradually decreased. The amount of library input is also gradually reduced. The concentration of sodium chloride in the incubation system is also gradually increased in each round. To further increase the screening pressure, human serum is added starting from the fifth round.

[0062] qPCR monitoring of reaction progress: Using the nucleic acid molecules in product 1 as templates, qPCR was performed for amplification. The method is as follows: 2 μL of the positive and negative screening products were added to 18 μL of qPCR mix and mixed well. qPCR amplification was performed for 30 cycles, and the data were analyzed.

[0063] Massive PCR amplification: Determine the amplification cycle number based on qPCR data, and add the remaining positive screening product to the PCR mix to amplify the corresponding cycle number.

[0064] Preparation of single-stranded DNA: PCR amplification yields double-stranded DNA, which needs to be prepared as ssDNA for the next round of screening. Since one strand of the double-stranded DNA obtained after PCR amplification is modified with biotin, this experiment uses magnetic beads labeled with streptavidin to capture the double-stranded DNA through the interaction of streptavidin and biotin. Then, the target single-stranded DNA is dissociated by the denaturing effect of NaOH. The specific experimental steps are as follows:

[0065] Incubation with streptavidin magnetic beads: Take 100 μL of streptavidin magnetic beads, wash twice with PBS, add double-stranded DNA solution, incubate at room temperature for 60 min, place on a magnetic rack, wash twice with PBS, add 100 μL of NaOH solution (0.01 M), and then magnetically aspirate the supernatant as the library for the next round of screening.

[0066] The magnetic bead method was repeated for nine rounds, with each operation using the secondary library obtained from the previous operation as the starting nucleic acid library. After screening, flow cytometry was used to detect changes in the recognition ability of the DNA single-stranded library for CCL2 protein. When the recognition ability of the DNA single-stranded library for CCL2 protein met the requirement—that is, the binding ability of the screened DNA single-stranded library to the target protein was higher than that of the initial library used in the screening—[the screening was considered successful]. Figure 1 In the figure, pool1, pool3, pool5, pool7, and pool9 represent the libraries obtained in rounds 1, 3, 5, 7, and 9, respectively. It can be seen that the library obtained in round 9 has a much higher affinity for the target than that obtained in round 1, meeting the sequencing requirements. The obtained libraries were then analyzed by high-throughput sequencing.

[0067] 3. Analysis and identification of nucleic acid aptamers obtained after multiple screenings: After high-throughput sequencing analysis of the enriched library products, several sequences were selected for synthesis by Sangon Biotech, and affinity was detected using a surface plasmon resonance instrument.

[0068] After testing and verification, two nucleic acid aptamers with ideal binding ability to CCL2 protein were identified and named CCL2-6 (its nucleotide sequence is shown in SEQ ID NO: 1) and CCL2-11 (its nucleotide sequence is shown in SEQ ID NO: 2), respectively. Specifically, the nucleotide sequence (5'-3') of SEQ ID NO: 1 is CACGCATAACTACGCACGTTAGTGGCAGTGTTGGTGGGATGTGTGGTTAT GCGTG; the nucleotide sequence (5'-3') of SEQ ID NO: 2 is CACGCATAACCGGGAGCGTTGGTCGTCATATCTTCGCAGAAGGGCAGTTA TGCGTG.

[0069] Example 2

[0070] This embodiment demonstrates the ability of a secondary library obtained through flow cytometry to recognize CCL2. The operational steps are as follows:

[0071] (1) Preparation of flow cytometry samples:

[0072] Take 5 μL of CCL2 magnetic beads into 1.5 mL centrifuge tubes, place them on a magnetic rack, wash twice with PBS, add 50 pmol sDNA library, and incubate at room temperature for 1 h; after incubation, place them on a magnetic rack, wash twice with PBS, and then add 200 μL of PBS to prepare a suspension.

[0073] (2) Results of flow cytometry analysis are as follows: Figure 1As shown, pool1, pool3, pool5, pool7, and pool9 represent the secondary libraries obtained from the first, third, fifth, seventh, and ninth rounds of screening, respectively.

[0074] Depend on Figure 1 It can be seen that the secondary library obtained in the ninth round has a better binding affinity for CCL2 than the secondary library obtained in the first round. The secondary libraries obtained in the fifth, seventh, and ninth rounds have similar binding affinity for CCL2, indicating that the libraries are basically fully enriched, marking the end of the screening process.

[0075] Example 3

[0076] This embodiment describes the detection of the affinity between nucleic acid aptamers and CCL2 based on surface plasmon resonance (SPR):

[0077] The selected nucleic acid aptamers were characterized using surface plasmon resonance (SPR) to assess their affinity and specificity for CCL2. The specific procedures included the following:

[0078] (S1) Preparation of nucleic acid aptamer samples;

[0079] (S2) Preparation of test samples and control groups;

[0080] (S3) Affinity and specificity detection.

[0081] The specific operation of diluting the nucleic acid aptamers in step (S1) is as follows: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their affinity was tested. The nucleic acid aptamers SEQ ID NO.1 and SEQ ID NO.2 obtained from multiple screenings were diluted with PBS to 800 nM, 400 nM, 200 nM, 100 nM, 50 nM, and 25 nM, respectively.

[0082] The specific procedures for preparing the detection group in step (S2) are as follows: CCL2 is coupled to channel 2 on the surface of the CM5 chip. Then, 50 μL of a mixture of equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.5 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.5 M aqueous solution) is injected to activate the chip at a flow rate of 5 μL / min. The CCL2 protein is diluted with sodium acetate at pH 4.5 to a final concentration of 50 μg / mL and then injected at a flow rate of 5 μL / min, with a CCL2 coupling amount of 2000 Ru. After injection, 50 μL of 1 M ethanolamine is injected to block the chip at a flow rate of 5 μL / min. The preparation of the control group is identical to the detection group except that the protein coupling step is omitted; the activation and blocking steps are exactly the same.

[0083] The specific operation for affinity and specificity detection in step (S3) is as follows: Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore T200), the kinetic detection parameters are set. The diluted nucleic acid aptamer samples from step S1 flow sequentially through the channel. The procedure for each aptamer is as follows: injection 30 μL / min * 2 min, dissociation 30 μL / min * 3 min, regeneration with 1M NaCl 30 μL / min * 0.5 min. The diluted nucleic acid aptamers are then injected sequentially, and the characterization results are as follows: Figure 2 As shown;

[0084] Depend on Figure 2 As can be seen, each curve is the curve after subtracting channel 1 from channel 2, indicating the binding ability of the corresponding nucleic acid aptamer to the target CCL2. SPR detection results show that nucleic acid aptamers SEQ ID NO.1 and SEQ ID NO.2 have a strong binding affinity to CCL2, and the KD value characterization results are shown in Table 1;

[0085] Table 1

[0086]

[0087]

[0088] Example 4

[0089] This embodiment demonstrates the use of surface plasmon resonance (SPR) to detect different CCL2 epitopes using nucleic acid aptamer assemblies.

[0090] (1) Dilute nucleic acid aptamers SEQ ID NO.1 and SEQ ID NO.2 to saturation concentration with PBS buffer. The saturation concentration is determined based on the affinity test results.

[0091] (2) CCL2 was coupled to the second channel on the surface of the CM5 chip. Then, 50 μL of a mixture of equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.5 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.5 M aqueous solution) was injected to activate the chip at a flow rate of 5 μL / min. CCL2 was diluted with sodium acetate at pH 4.5 to a final concentration of 50 μg / mL and then injected at a flow rate of 5 μL / min. The CCL2 coupling amount was 2000 Ru. After the injection was completed, ethanolamine was injected to block the chip at a flow rate of 5 μL / min, with 50 μL injected. The first channel was treated in the same way as above, except that the protein coupling step was not performed. The activation and blocking steps were exactly the same, and it served as a control channel.

[0092] (3) Use a surface plasmon resonance spectrometer to set the kinetic detection parameters. The diluted SEQ ID NO.1 nucleic acid aptamer sample from step 1 flows through the channel, and then the diluted SEQ ID NO.2 nucleic acid aptamer is injected. The procedure is as follows: injection 30 μL / min*2 min, dissociation 30 μL / min*3 min, regeneration 1M NaCl 30 μL / min*0.5 min.

[0093] (4) Detection data such as Figure 3 As shown;

[0094] Depend on Figure 3 It can be seen that SEQ ID NO.1 reached saturation after injection, and the curve showed a significant rise after the addition of SEQ ID NO.2; the SPR epitope analysis results showed that nucleic acid aptamers SEQ ID NO.1 and SEQ ID NO.2 can bind to different sites of CCL2.

[0095] Example 5

[0096] This embodiment describes the preparation of quantum dot microspheres labeled with CCL2 nucleic acid aptamers:

[0097] 1) Quantum dot microspheres modified with streptavidin (QD@SA)

[0098] Take 50 μL of carboxylated quantum dot microspheres (QD), and add 150 μL of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC), 150 μL of N-hydroxysuccinimide (NHS), 17.4 μL of morpholine ethanesulfonic acid buffer, and 12.6 μL of streptavidin. Incubate overnight at room temperature; collect the precipitate by centrifugation; wash the precipitate twice with TBST; finally, resuspend in 20 μL of ultrapure water to obtain QD@SA, store at 4℃ for subsequent use. Carboxylated quantum dot microspheres were purchased from Xi'an Qiyue Biotechnology Co., Ltd. The EDC concentration was 64 mM. The NHS concentration was 87 mM. The morpholine ethanesulfonic acid buffer concentration was 0.01 M, pH 6. The streptavidin concentration was 1 mg / mL. Centrifugation conditions were 4℃, 10000 rpm, 5 min.

[0099] 2) Preparation of QD@SA-labeled CCL2 aptamers

[0100] Take 20 μL of the prepared QD@SA, add 10-100 nM CCL2 aptamer, and incubate at room temperature for 1 h; centrifuge to collect the precipitate; then wash the precipitate twice with triple-distilled water; finally, resuspend in 50 μL of ultrapure water to obtain the QD@SA-labeled CCL2 aptamer, store at 4℃ for subsequent use. The biotin-modified aptamer was purchased from Shanghai Sangon Biotech. After dissolving the powder in ultrapure water, the concentration of the biotin-modified aptamer was determined using a UV spectrophotometer each time it was used. The nucleic acid sequences of the CCL2 aptamer are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0101] Example 6

[0102] This embodiment is a test strip (nucleic acid aptamer-antibody mixed sandwich method) for detecting or identifying the chemokine CCL2. The test strip includes a backing plate, a nitrocellulose membrane, a sample pad, an absorbent pad, and a binding pad.

[0103] The binding pad includes quantum dot microspheres labeled with CCL2 nucleic acid aptamers (the nucleic acid aptamer sequence is SEQ ID NO.1) prepared in Example 5;

[0104] The nitrocellulose membrane is equipped with detection lines and quality inspection lines;

[0105] The detection line is coated with a first monoclonal antibody that recognizes the chemokine CCL2.

[0106] The quality control line is coated with a second monoclonal antibody that recognizes the chemokine CCL2.

[0107] The preparation method of the above test strips includes:

[0108] 1) Sample pad and conjugate pad pretreatment:

[0109] Sample pad pretreatment: Immerse the glass fiber in the sample pad treatment solution, let it stand for 30 minutes, then remove it, drain the water, and allow it to air dry for later use. The sample pad treatment solution has a pH of 7.0 and contains 0.1M Tris-HCl, 0.5wt% PVP, 1wt% casein, 3wt% sucrose, 0.1wt% Tween 20, and 0.02wt% Proclin 300.

[0110] Binding pad pretreatment: impregnate glass fiber at a dilution ratio of 1:1, wherein the buffer pH is 7.0 and contains 0.1M Tris-HCl buffer, 1% wt BSA, 0.5% wt PVP, 0.5% wt PEG, and 5% wt sucrose; the blocking time is 12h.

[0111] 2) Spraying conditions

[0112] The nitrocellulose membrane, conjugate pad, sample pad, and absorbent pad were assembled sequentially on a PVC board. Then, the QD@SA-labeled CCL2 aptamer was sprayed onto the conjugate pad using a coating machine at a spray volume of 4 μL / cm.

[0113] 3) Film application conditions

[0114] Place the test strip in the appropriate position on the film application machine to prepare antibody solutions for the detection line and control line. The first and second monoclonal antibodies were both purchased from Thermo Fisher.

[0115] The antibody solution used for membrane etching in this invention undergoes the following steps: the protein is diluted to a certain concentration and placed in a dialysis bag, then dialyzed sequentially in a low-concentration solution (0.005 mol / L NaCl, pH 7.0) and triple-distilled water. The antibody concentration used for the detection line and control line is 0.5 mg / mL.

[0116] Example 7

[0117] This embodiment is a test strip (nucleic acid aptamer-nucleic acid aptamer sandwich method) for detecting or identifying the chemokine CCL2. The test strip includes a backing plate, a nitrocellulose membrane, a sample pad, an absorbent pad, and a binding pad.

[0118] The binding pad includes quantum dot microspheres labeled with CCL2 nucleic acid aptamers (the nucleic acid aptamer sequence is SEQ ID NO: 2) prepared in Example 5;

[0119] The nitrocellulose membrane is equipped with detection lines and quality inspection lines;

[0120] The detection line is coated with a nucleic acid aptamer that recognizes the chemokine CCL2 (the nucleic acid aptamer sequence is SEQ ID NO: 1);

[0121] The quality control line is coated with a second monoclonal antibody that recognizes the chemokine CCL2.

[0122] The preparation method of the above test strips includes:

[0123] 1) Sample pad and conjugate pad pretreatment:

[0124] Sample pad pretreatment: Immerse the glass fiber in the sample pad treatment solution, let it stand for 30 minutes, then remove it, drain the water, and allow it to air dry for later use. The sample pad treatment solution has a pH of 7.0 and contains 0.1M Tris-HCl, 0.5wt% PVP, 1wt% casein, 3wt% sucrose, 0.1wt% Tween 20, and 0.02wt% Proclin 300.

[0125] Binding pad pretreatment: impregnate glass fiber at a dilution ratio of 1:1, wherein the buffer pH is 7.0 and contains 0.1M Tris-HCl buffer, 1% wt BSA, 0.5% wt PVP, 0.5% wt PEG, and 5% wt sucrose; the blocking time is 12h.

[0126] 2) Spraying conditions

[0127] The nitrocellulose membrane, conjugate pad, sample pad, and absorbent pad were assembled sequentially on a PVC board. Then, the QD@SA-labeled CCL2 aptamer was sprayed onto the conjugate pad using a coating machine at a spray volume of 4 μL / cm.

[0128] 3) Film application conditions

[0129] Place the test strip in the appropriate position on the membrane application machine to prepare antibody solutions (second monoclonal antibody, purchased from Thermo Fisher) for the detection line (nucleic acid aptamer) and control line.

[0130] The antibody solution used for membrane etching in this invention undergoes the following steps: the protein is diluted to a certain concentration and placed in a dialysis bag, then dialyzed sequentially in a low-concentration solution (0.005 mol / L NaCl, pH 7.0) and triple-distilled water. The concentration of the nucleic acid aptamer live antibody used for the detection line and control line is 0.5 mg / mL.

[0131] Example 8

[0132] This example is an evaluation of the detection efficacy of the test strip (nucleic acid aptamer-antibody mixed sandwich method) for detecting or recognizing the chemokine CCL2 in Example 6 against the CCL2 antigen standard:

[0133] Add a drop of buffer solution containing CCL2 antigen standard to the sample pad of the test strip, let it stand for 15 minutes, and then read the signal detected by the CCL2 fluorescence test strip using a dry fluorescence immunoassay analyzer. The CCL2 antigen standard was purchased from Thermofisher. The dry fluorescence immunoassay analyzer was purchased from Suzhou Hemai Precision Instruments Co., Ltd.

[0134] Under 365nm UV excitation, fluorescent test strips were used to detect CCL2 antigen standards at concentrations of 0 pg / mL, 50 pg / mL, 100 pg / mL, and 500 pg / mL. The results are as follows: Figure 4 As shown;

[0135] Depend on Figure 4 The test results show that the test strip can specifically recognize CCL2 protein, which also indicates that the nucleic acid aptamer-antibody sandwich method has good recognition and detection capabilities for CCL2 protein.

[0136] Example 9

[0137] This example evaluates the detection efficacy of the test strip (nucleic acid aptamer-nucleic acid aptamer sandwich method) for detecting or identifying the chemokine CCL2 in Example 7 against the CCL2 antigen standard:

[0138] At the sample pad of the test strip, a buffer solution containing CCL2 antigen standard was added. After standing for 15 minutes, the signal detected by the CCL2 fluorescence test strip was read using a dry fluorescence immunoassay analyzer. The CCL2 antigen standard was purchased from Thermofisher. The dry fluorescence immunoassay analyzer was purchased from Suzhou Hemai Precision Instruments Co., Ltd.

[0139] Under 365nm UV excitation, the fluorescent test strips detected CCL2 antigen standards at concentrations of 0 ng / mL, 1 ng / mL, 10 ng / mL, and 100 ng / mL as follows: Figure 5 As shown.

[0140] Depend on Figure 5 The test results show that the test strip can specifically identify CCL2 protein, which also indicates that the nucleic acid aptamer-nucleic acid aptamer sandwich method has good recognition and detection capabilities for CCL2 protein.

[0141] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. A nucleic acid aptamer that recognizes the chemokine CCL2, characterized in that, The nucleotide sequence of the nucleic acid aptamer that recognizes the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

2. The use of the nucleic acid aptamer for recognizing chemokine CCL2 as described in claim 1 in the preparation of products for detecting or recognizing chemokine CCL2.

3. The application according to claim 2, characterized in that, The products include test strips, kits, and testing reagents.

4. A test strip for detecting or identifying the chemokine CCL2, characterized in that, The test strip includes a backing plate, a nitrocellulose membrane, a sample pad, an absorbent pad, and a binding pad; The binding pad includes a nucleic acid aptamer labeled with quantum dot microspheres that recognizes the chemokine CCL2.

5. The test strip according to claim 4, characterized in that, The preparation method of the nucleic acid aptamer labeled with the quantum dot microspheres that recognizes the chemokine CCL2 includes: Avidin-modified nucleic acid aptamers that recognize the chemokine CCL2 were coupled with streptavidin-modified quantum dot microspheres.

6. The test strip according to claim 4, characterized in that, The nucleotide sequence of the nucleic acid aptamer that recognizes the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

7. The test strip according to claim 4, characterized in that, The nitrocellulose membrane is equipped with detection lines and quality inspection lines; The detection line is coated with a nucleic acid aptamer or a first monoclonal antibody that recognizes the chemokine CCL2. The quality control line is coated with a second monoclonal antibody that recognizes the chemokine CCL2.

8. The test strip according to claim 7, characterized in that, The aptamer for recognizing chemokine CCL2 on the binding pad has a different nucleotide sequence than the aptamer for recognizing chemokine CCL2 coated on the detection line.

9. A detection reagent for detecting or identifying the chemokine CCL2, characterized in that, The detection reagent includes a nucleic acid aptamer that recognizes the chemokine CCL2.

10. The detection reagent according to claim 8, characterized in that, The nucleotide sequence of the nucleic acid aptamer that recognizes the chemokine CCL2 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

Images