Targeting 4-1BB aptamer and application thereof in preparation of antitumor drugs

Abstract

The invention belongs to the field of antitumor drugs, and particularly relates to a targeted 4-1BB aptamer and application of the targeted 4-1BB aptamer in preparation of antitumor drugs. A target 4-1BB nucleic acid aptamer is obtained through screening, the sequence of the target 4-1BB nucleic acid aptamer is shown as SEQ ID No.1, and the target 4-1BB nucleic acid aptamer is specifically 5 '-CACGCATAACATGTATGGACTGCTCGGGATTGCGG ATTTACATTCGTTATGCGTG-3', the sequence of the target 4-1BB nucleic acid aptamer is shown as SEQ ID No.1, and the sequence of the target 4-1BB nucleic acid aptamer is shown as SEQ ID No.1. The nucleic acid aptamer has a good application effect in preparation of anti-tumor drugs. The capacity of the aptamer for inhibiting mouse Hepa1-6 subcutaneous tumor is superior to that of mouse 4-1BB agonist antibody drugs with the same total mass. The obvious hepatotoxicity and visceral toxicity are not found; growth of mouse Hepa1-6 liver in-situ cancer can be inhibited, and the proportion of CD8 + T cells in T cells in the liver can be increased.

Description

Technical Field

[0001] This invention belongs to the field of antitumor drugs, specifically relating to a 4-1BB aptamer and its application in the preparation of antitumor drugs. Background Technology

[0002] Nucleic acid aptamers are single-stranded DNA or RNA molecules that can specifically bind to targets, obtained through SELEX screening. 4-1BB (CD137, TNFRSF9) is expressed on activated NK cells or T cells and is an immune co-stimulatory molecule. 4-1BB agonists can stimulate T cell proliferation and promote cytokine secretion, thereby improving the level of anti-tumor immune response. The 4-1BB agonist antibodies urerumab and utomilumab have shown therapeutic effects in lymphoma patients. At doses >1 mg / kg, urerumab has inflammatory hepatotoxicity. Utomilumab has superior safety, but its efficacy is worse than that of urerumab (Chester C, Sanmamed MF, Wang J, et al. Immunotherapy targeting 4-1BB:mechanistic rationale, clinical results, and future strategies[J]. Blood, 2018, 131(1):49-57). The genetically engineered antibody LVGN6051 developed by Lijin Biotechnology in China has strong immune activation ability and low toxicity (Daud A, Albany C, Velcheti V, et al. First-in-human, phase 1a dose finding of LVGN6051CD137 / 4-1BB agonistic antibody with or without pembrolizumab in patients with advanced solid tumors[J].J Clin Oncol, 2023, 41(16):2525). 4-1BB agonist aptamer drugs have also been developed. M12-3 dimmer, developed by Mcnamara et al., is a 4-1BB dimeric RNA aptamer drug that targets 4-1BB and has the ability to activate T cells in vitro and fight tumors in vivo (Mcnamara JO, Kolonias D, Pastor F, et al. Multivalent 4-1BB binding aptamers costimulate CD8+ T cells and inhibit tumor growth in mice[J]. J ClinInvest, 2008, 118(1):376-86).

[0003] In most studies, it is generally believed that bivalent antibodies or bivalent nucleic acid aptamers are required to induce cross-linking reactions at the target site, thereby activating the target and triggering downstream cascade reactions. However, due to the uneven distribution of target molecules on the cell surface, in areas with dense target distribution, monovalent antibodies can induce cross-linking reactions of target molecules, thereby triggering signaling cascade reactions. To make immunotherapy more effective, it is necessary to maximize the anti-tumor response at the tumor site. In 2006, Zhang et al. induced a tumor-killing immune response in tumor-bearing mice by inoculating them with a whole-cell tumor vaccine expressing anti-4-1BB scFv (Single-Chain Fragment Variable) (Zhang H, Knutson KL, Hellstrom KE, et al. Antitumor efficacy of CD137 ligation is maximized by the use of a CD137 single-chain Fv-expressing whole-cell tumor vaccine compared with CD137-specific monoclonal antibody infusion[J]. Mol Cancer Ther, 2006, 5(1):149-155). Similarly, in 2007, Yang et al. used an adenovirus vector to encode anti-4-1BBscFv in ID8 cells. Injecting these cells into established B16 melanoma cells altered the unfavorable immune microenvironment, induced tumor regression, and significantly prolonged the survival of mice (Yang Y, Yang S, Ye Z, et al. Tumor cells expressing anti-CD137 scFv induce a tumor-destructive environment[J]. Cancer Res, 2007, 67(5):2339-44.). In 2020, Bagheri successfully activated T cells isolated from human peripheral blood using anti-4-1BB scFv (agheri S, Safaie E, Yousefi M, et al. Targeting the 4-1BB costimulatory molecule through single chain antibodies promotes the human T-cell response[J]. CellMol Biol Lett, 2020, 25:28.).

[0004] In summary, the reported APT-4-1BB is a double-stranded RNA molecule, which has the disadvantages of high synthesis cost, unstable chemical properties and easy degradation; and the reported 4-1BB antibody agonists have the disadvantages of high cost, large batch-to-batch variability, unstable chemical properties and high toxicity. Summary of the Invention

[0005] In view of the shortcomings of the currently reported 4-1BB antibody agonists, such as high cost, large batch-to-batch variability, unstable chemical properties, and high toxicity, this application has obtained a 4-1BB-targeting nucleic acid aptamer through screening. This nucleic acid aptamer has good application effects in the preparation of anti-tumor drugs.

[0006] The technical solution of this application is as follows:

[0007] In a first aspect, this application provides a 4-1BB aptamer, wherein the 4-1BB aptamer is APT-4-1BB, and the sequence is shown in SEQ ID No.1, specifically 5'-CACGCATAACATGTATGGGACTGCTCGGGATTGCGGATTTACATTCGTTAT GCGTG-3'.

[0008] Secondly, this application provides the application of the above-mentioned targeting 4-1BB nucleic acid aptamer in the preparation of antitumor drugs.

[0009] As a specific embodiment of this application, the targeted 4-1BB nucleic acid aptamer and human 4-1BB protein can bind at the cellular level.

[0010] As a specific embodiment of this application, the half-life of the targeted 4-1BB nucleic acid aptamer in fetal bovine serum is 5.951 h, and the half-life in mouse serum is 7.622 h.

[0011] As a specific embodiment of this application, the targeted 4-1BB nucleic acid aptamer can be enriched at the tumor site.

[0012] As a specific embodiment of this application, the targeted 4-1BB nucleic acid aptamer can be enriched at the tumor site in a mouse Hepa1-6 subcutaneous tumor model.

[0013] As a specific embodiment of this application, the tumor includes subcutaneous tumors and / or carcinoma in situ.

[0014] As a specific embodiment of this application, the targeted 4-1BB aptamer APT-4-1BB increases the proliferation of T lymphocytes by 15% or more within 72 hours.

[0015] As a specific embodiment of this application, the targeted 4-1BB nucleic acid aptamer can increase the proportion of CD8+ T cells in T cells.

[0016] As a specific embodiment of this application, the targeted 4-1BB nucleic acid aptamer did not show significant hepatotoxicity or visceral toxicity.

[0017] Beneficial effects

[0018] 1. APT-4-1BB, which has a high affinity for human 4-1BB protein, was obtained through screening. Its sequence is shown in SEQ ID No.1, specifically 5'-CACGCATAACATGTATGGGACTGCTCGGGATTGCGGAT TTACATTCGTTATGCGTG-3'.

[0019] 2. APT-4-1BB can bind to human 4-1BB protein at the cellular level.

[0020] A CHO-4-1BB overexpressing cell line was constructed, and a CHO-CON cell line not expressing the 4-1BB fragment was constructed using the same lentiviral infection method as a negative control. Flow cytometry demonstrated that APT-4-1BB specifically binds to the CHO-4-1BB overexpressing cell line.

[0021] 3. Serum stability of APT-4-1BB

[0022] APT-4-1BB has a half-life of 5.951 h in fetal bovine serum and 7.622 h in mouse serum.

[0023] 4. APT-4-1BB can accumulate at the tumor site.

[0024] APT-4-1BB-Alexa 647 was enriched at tumor sites in a mouse Hepa1-6 subcutaneous tumor model.

[0025] 5. APT-4-1BB has immunostimulatory capabilities at the cellular level.

[0026] Because human and mouse 4-1BB proteins share 56% homology, the biological function of APT-4-1BB was tested using mouse spleen lymphocytes via CFSE lymphocyte proliferation assays and intracellular staining. APT-4-1BB stimulation increased T lymphocyte proliferation by approximately 15% within 72 hours and significantly increased the proportion of CD8+ T cells among T cells. Figure 6 APT-4-1BB stimulation can increase the secretion level of IFN-γ in CD8+ T cells.

[0027] 6. APT-4-1BB inhibits the growth of Hepa1-6 subcutaneous tumors in mice.

[0028] APT-4-1BB treatment inhibited the growth of Hepa1-6 subcutaneous tumors in mice, increased the content of CD8+ T cells in tumor-infiltrating lymphocytes, and decreased the ratio of CD4+ T cells to CD8+ T cells in tumor-infiltrating lymphocytes. APT-4-1BB showed superior inhibitory effects on Hepa1-6 subcutaneous tumors in mice compared to an equivalent total weight of mouse 4-1BB agonist antibody drugs. No significant hepatotoxicity or visceral toxicity was observed with APT-4-1BB.

[0029] 7. APT-4-1BB can inhibit the growth of Hepa1-6 liver carcinoma in situ in mice and increase the proportion of CD8+ T cells in T cells in the liver. Attached Figure Description

[0030] Figure 1 (A) APT-4-1BB binds to 4-1BB protein at the cellular level; (B) Prediction of the two-dimensional molecular structure of APT-4-1BB;

[0031] Figure 2 Serum half-life assay for APT-4-1BB; (A) Detection of the half-life of APT-4-1BB in fetal bovine serum using agarose gel electrophoresis; (B) Processing fetal bovine serum assay images using Imagej and calculating the serum half-life of the drug using Graphpad. 2 (C) Detection of the half-life of APT-4-1BB in mouse serum using agarose gel electrophoresis; (D) Processing mouse serum detection images using Imagej and calculating the drug serum half-life (R0.99) using Graphpad. 2 >0.99);

[0032] Figure 3 To determine the in vivo biodistribution of APT-4-1BB-Alexa 647; (A) Mice were intraperitoneally injected with 1.5 μg of APT-NC-AlexaFluor 647 or 1.5 μg of APT-4-1BB-AlexaFluor 647, and sacrificed 2 h later. In Vitro Imager (IVIS) was used to image the internal organs and tumors of the mice; (B) The significance of the data was analyzed using a two-tailed, two-sample t-test of equal variance using GraphPad (*p<0.05, **p<0.01, ***p<0.001).

[0033] Figure 4 The proliferation of mouse T lymphocytes was detected by flow cytometry after 72 hours of treatment with APT-4-1BB.

[0034] Figure 5 The percentage of CD8+ T cells in T lymphocytes after APT-4-1BB stimulation;

[0035] Figure 6 To detect the biological function of APT-4-1BB in the CFSE lymphocyte proliferation assay; (A) APT-4-1BB stimulation significantly increased the proportion of T cells in lymphocytes; (B) APT-4-1BB stimulation significantly increased T cell proliferation; (C) Proliferation of mouse CD8+ T lymphocytes; (D) APT-4-1BB stimulation significantly increased CD8+ T cell proliferation; (E) APT-4-1BB stimulation significantly decreased the CD4+ / CD8+ T cell ratio. The data were analyzed for significance using a two-tailed, two-sample, equal variance t-test with GraphPad (*p<0.05, **p<0.01, ***p<0.001).

[0036] Figure 7 To detect the IFN-γ secretion of mouse T lymphocytes after 72 h of APT-4-1BB stimulation with intracellular staining, flow cytometry was used to detect the IFN-γ secretion of mouse T lymphocytes.

[0037] Figure 8 The effect of APT-4-1BB stimulation on IFN-γ secretion in mouse T cells was detected using intracellular staining. Specifically, (A) APT-4-1BB stimulation significantly increased IFN-γ secretion levels in T cells; (B) APT-4-1BB stimulation significantly increased IFN-γ secretion levels in CD8+ T cells; (C) IFN-γ secretion in purified mouse CD8+ T lymphocytes after 72 h of APT-4-1BB treatment was detected by flow cytometry; and (D) APT-4-1BB stimulation significantly increased IFN-γ secretion levels in purified CD8+ T cells. The data were analyzed for significance using a two-tailed, two-sample, equal-variance t-test with GraphPad (*p<0.05, **p<0.01, ***p<0.001).

[0038] Figure 9 APT-4-1BB treatment inhibited the growth of Hepa1-6 subcutaneous tumors in mice; (A) APT-NC, APT-4-1BB, IgG, or anti-mouse 4-1BB antibody were administered intraperitoneally starting on day 8 after tumor inoculation; (BF) APT-4-1BB treatment significantly inhibited tumor growth without affecting mouse body weight; (GJ) Serum biochemical analysis showed that APT-4-1BB treatment did not exhibit significant hepatotoxicity or nephrotoxicity. Data were analyzed for significance using a two-tailed, two-sample, equal-variance t-test via GraphPad (*p<0.05, **p<0.01, ***p<0.001).

[0039] Figure 10APT-4-1BB treatment increased the proportion of CD8+ T cells in tumor-infiltrating lymphocytes; (AF) APT-4-1BB treatment significantly inhibited tumor growth without affecting mouse body weight or visceral mass; (G) APT-4-1BB treatment significantly increased the proportion of T cells in lymphocytes, the proportion of CD8+ T cells in T cells, and the CD4+ / CD8+ T cell ratio; (H) Flow cytometry analysis of mouse spleen lymphocytes showed no significant immunotoxicity of APT-4-1BB. Data significance analysis was performed using a two-tailed, two-sample, equal-variance t-test with GraphPad (*p<0.05, **p<0.01, ***p<0.001).

[0040] Figure 11 Immunohistochemical staining of tumor sections showed that APT-4-1BB treatment increased the proportion of CD8+ T cells in tumor-infiltrating lymphocytes; (AB) CD8 immunohistochemical staining of tumor sections and image analysis using Imagej showed that APT-4-1BB treatment significantly increased the proportion of CD8+ T cells in tumor-infiltrating lymphocytes; (C) H&E staining of visceral sections showed that APT-4-1BB treatment did not show significant visceral toxicity. Data significance analysis was performed using a two-tailed, two-sample, equal-variance hypothesis t-test with GraphPad (*p<0.05, **p<0.01, ***p<0.001).

[0041] Figure 12 APT-4-1BB treatment inhibited the development of Hepa1-6-luc in situ carcinoma in mice; (AB) IVIS imaging showed that APT-4-1BB treatment significantly inhibited the development of hepatic in situ carcinoma in mice; (C) APT-4-1BB treatment significantly increased the proportion of CD8+ T cells in T lymphocytes. Data significance analysis was performed using a two-tailed, two-sample, equal-variance t-test with GraphPad (*p<0.05, **p<0.01, ***p<0.001).

[0042] Figure 13 For SPR assay, the affinity between APT-4-1BB and 4-1BB protein showed a KD value of 3.579E. - 8 M;

[0043] Figure 14 This refers to the timeline for in vivo animal treatment experiments. Detailed Implementation

[0044] Example 1:

[0045] Screening of ssDNA aptamers that specifically bind to 4-1BB protein

[0046] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences:

[0047] A random single-stranded DNA library was used to screen single-stranded DNA sequences as shown in SEQ ID No. 2, specifically 5'-TCCAGCACTCCACGCATAACGTTATGCGTGCGACGGTGAA-3';

[0048] The sequence described above contains a 36-nucleotide sequence following the 20th base C at the 5' end. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0049] Primer information is shown in Table 1, synthesized by Nanjing GenScript Biotech Co., Ltd.

[0050] Table 1 Primers and their sequences

[0051]

[0052] In the primer names, FP represents the forward primer, RP represents the reverse primer, the 19 A's at the 5' end of the RP-polyA sequence represent the polyA tail composed of 19 adenosine nucleotides (A), and the "Spacer 18" linking to the 19th A at the 5' end of the RP-polyA sequence represents the 18-atom hexaethylene glycol intermediate arm.

[0053] The primers were prepared into 100 μM stock solutions using DPBS buffer and stored at -20°C for later use.

[0054] 2. Magnetic bead screening method

[0055] 1) Immobilization of 4-1BB protein with carboxyl magnetic beads

[0056] Take 50 μL of carboxylated magnetic beads (Invitrogen, Dynabeads) TM MyOne TM Carboxylic Acid (#65012) was washed four times with 200 μL of ultrapure water. The magnetic beads were then hooked using a magnet, and the supernatant was removed. Equal volumes of prepared NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) were mixed and added to the magnetic beads. The mixture was incubated at 25°C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads. The magnetic beads were then washed twice with ultrapure water and set aside for use.

[0057] Take 10 μL of 0.5 mg / mL 4-1BB protein (Essential), add 90 μL of pH 4.0 sodium acetate solution, mix well, and then add to the activated magnetic beads. Incubate at 25°C on a vertical mixer for 30 min. The 4-1BB protein will couple to the surface of the magnetic beads through the amino groups on its surface.

[0058] After coupling, place the coupling tube on a magnetic rack, discard the supernatant, and add 100 μL of 1M ethanolamine (pH 8.5) to the magnetic beads. Incubate at 25°C on a vertical mixer for 10 min to block unreacted activation sites on the surface of the magnetic beads. Place the tube on a magnetic rack and discard the blocking solution. Wash the magnetic beads four times with 200 μL of DPBS and label them MB-4-1BB.

[0059] 2) Library variation

[0060] Take a 1 OD random single-stranded nucleotide library, centrifuge at 14000 rpm for 3 min, dissolve the library in DPBS buffer to 10 μM, and aliquot into PCR tubes for renaturation. The process is as follows: set the PCR instrument program to 95℃ for 10 min, then 4℃ for 5 min, and then 25℃ for 5 min.

[0061] 3) Reverse screening

[0062] Back-screening was performed using magnetic beads conjugated with BSA protein (labeled MB-BSA). The method for conjugating BSA protein was the same as that for conjugating 4-1BB protein. Before each round of positive screening targeting 4-1BB protein, back-screening with BSA-conjugated magnetic beads was performed. The back-screening steps were as follows: After renaturation, the single-stranded nucleotide library was incubated with 50 μL of MB-BSA magnetic beads at 25°C for 30 min on a vertical rotator. The library was then placed on a magnetic rack, and the supernatant was collected. The supernatant was then used for positive screening with MB-4-1BB magnetic beads.

[0063] 4) Positive screening

[0064] The filtered library was added to 50 μL LMB-4-1BB magnetic beads and incubated at 25°C for 60 min on a vertical mixer. The mixture was then placed on a magnetic rack, the supernatant was discarded, and the magnetic beads were retained. The beads were washed four times with 200 μL L PBS. After washing, the magnetic beads were added to 200 μL of ultrapure water and incubated in a water bath for 10 min. The supernatant was collected and labeled Elution.

[0065] 5) Preparation of single chains

[0066] Using the nucleic acid molecules in Elution as templates, PCR amplification was performed. The amplification conditions were as follows: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles, and storage at 4℃. The PCR mix formulation is shown in Table 2.

[0067] Table 2 PCRmix formulation

[0068]

[0069]

[0070] The amplification products were concentrated and purified with n-butanol: All PCR products were collected in 15 mL conical centrifuge tubes, and 5 volumes of n-butanol were added. The mixture was vortexed to ensure thorough mixing. The tubes were centrifuged at 9000 rpm for 5 minutes at 25°C. The supernatant (n-butanol) was discarded, and the concentrated PCR amplification products were obtained. TBE / urea denaturing buffer was added at a 1:1 volume ratio, and the mixture was boiled for denaturation for 10 minutes. All samples were subjected to urea-denaturing polyacrylamide gel electrophoresis at 400 V until bromophenol blue reached the bottom of the gel, separating the elongated FAM-labeled strands from the inverted strands. The FAM-labeled strands were recovered by cutting the gel and transferring the gel strip to a 1.5 mL EP tube. The strip was then crushed, and 1 mL of ddH2O was added. The gel was boiled for 10 minutes to transfer the ssDNA from the gel to a solution. The gel fragments were removed by centrifugation, and the supernatant was retained. The supernatant was purified with n-butanol using the same method as above. Once the DNA single strands are obtained, they are dialyzed overnight using a 3KD dialysis bag and can then be used as the library for the next round of screening.

[0071] 3. Multiple rounds of screening

[0072] The magnetic bead method was repeated for 6 rounds of screening. Each operation used the secondary library obtained in the previous operation as the starting nucleic acid library. During the screening process, SPR was used to detect the change in the recognition ability of the DNA single-stranded library for 4-1BB protein. When the recognition ability of the DNA single-stranded library for 4-1BB protein met the requirements, that is, the binding ability of the screened DNA single-stranded library to the target was higher than that of the library used in the initial screening, the obtained product was cloned and sequenced to obtain the nucleic acid aptamer.

[0073] 4. After six rounds of screening, the nucleic acid aptamers obtained were analyzed and identified. The enriched library products were then cloned and sequenced. Several sequences were selected and synthesized by Shanghai Sangon Biotech, and their affinity was tested. Subsequent testing revealed one sequence with strong binding ability. After truncation, the nucleic acid aptamer shown below was obtained and named APT-4-1BB.

[0074] The APT-4-1BB sequence is shown in SEQ ID No. 1, and the sequence (5'-3') is as follows:

[0075] CACGCATAACATGTATGGGACTGCTCGGGATTGCGGATTTACATTCGTT ATGCGTG.

[0076] Example 2: Verification of the binding of APT-4-1BB to 4-1BB protein at the cellular level

[0077] A CHO-4-1BB overexpressing cell line and a control CHO-CON cell line (infected with a virus packaged with an empty vector plasmid) were constructed. To visualize the binding of the nucleic acid aptamers to cells, a FAM group (synthesized by Sangon Biotech) was attached to the 3' end of the aptamers. The CHO-4-1BB overexpressing cell line and the CHO-CON cell line were stained with IgG-APC, anti-human 4-1BB antibody APC, APT-NC-FAM, and APT-4-1BB-FAM, respectively, and detected by flow cytometry. Results are shown below. Figure 1 The results showed that APT-4-1BB-FAM and anti-human-4-1BB antibody APC had the same staining trend, that is, the staining intensity in CHO-4-1BB cells was significantly higher than that in CHO-CON cell lines. Figure 1 A) indicates that APT-4-1BB can specifically bind to CHO-4-1BB cells. Figure 1 B shows a schematic diagram of the two-dimensional structure of APT-4-1BB, which contains 56 bases.

[0078] Example 3: Serum stability assay of APT-4-1BB

[0079] APT-4-1BB at a concentration of 2 μM was incubated in 1640 medium containing 10% fetal bovine serum or fresh mouse serum. Incubation was performed at 37°C for 0 min, 30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 24 h, and 48 h, respectively, followed by immediate heating at 95°C for 5 min to terminate enzyme activity. The resulting solutions were subjected to agarose gel electrophoresis, and the results were analyzed using ImageJ software. The results are shown below. Figure 2 As shown, agarose gel electrophoresis was used to detect APT-4-1BB in fetal bovine serum (FBS). Figure 2 A) or mouse serum ( Figure 2 The half-life in C), such as Figure 2 B,APT-4-1BB has a half-life of 5.951 h in fetal bovine serum, such as Figure 2 The half-life of D,APT-4-1BB in mouse serum is 7.622 h.

[0080] Example 4: Biodistribution detection of APT-4-1BB

[0081] To visualize the distribution of nucleic acid aptamers in mice, an AlexaFluor 647 group (synthesized by Sangon Biotech) was attached to the 3' end of the aptamers. C57 / BL6 mice inoculated with Hepa1-6 subcutaneous tumors were intraperitoneally injected with either 1.5 μg APT-NC-Alexa Fluor 647 or 1.5 μg APT-4-1BB-AlexaFluor 647. Two hours later, internal organs and tumors were harvested for IVIS imaging. The results are as follows: Figure 3 The results showed that APT-4-1BB-Alexa Fluor 647 could accumulate at tumor sites.

[0082] Example 5: Biological function detection of APT-4-1BB

[0083] Two hours in advance, the bottom of a 96-well plate was coated with CD3e antibody. A 1.25 mg / mL CD3e antibody solution was prepared, and 50 μL of the solution was added to each well of the 96-well plate. The plate was then incubated at 37°C for 2 hours.

[0084] The extraction of mouse spleen lymphocytes and the sorting process of CD8+ T cells are as described above.

[0085] Prepare a 2 mL, 10 μM CFSE solution. Mix the cell suspension and CFSE solution at a 1:1 ratio, bringing the final CFSE concentration to 5 μM. The total chromosome volume is 4 mL. Stain at room temperature in the dark for 10 min. Add 10 mL of complete culture medium to release unbound CFSE. Centrifuge, discard the supernatant, and wash twice with 5 mL of complete culture medium.

[0086] Resuspend the cells in T-cell culture medium and adjust the cell concentration to 5 × 10⁻⁶. 6 Add 10 ng / mL of recombinant IL-2 protein to each well, along with 200 μL of cell suspension and 200 nM aptamer.

[0087] The preparation method for 50mLT cell culture medium is shown in Table 3.

[0088] Table 4. T cell culture medium formulation

[0089] name volume FBS heat-inactivated at 56℃ for 30 minutes 15mL 1MHEPES (PH 7.4) 1mL 55mM β-mercaptoethanol 16.7μL Penicillin-streptomycin 500μL 1640 to 50mL

[0090] The 96-well plate was placed in a 37°C, 5% CO2 incubator and incubated for 72 hours.

[0091] The effects of APT-4-1BB on the proliferation and typing of mouse T cells were detected by flow cytometry.

[0092] In addition, intracellular staining was used to examine the effect of APT-4-1BB on IFN-γ secretion levels in mouse CD8+ T cells sorted by magnetic beads. Figure 4-6 As shown, APT-4-1BB stimulation can increase T lymphocyte proliferation by approximately 15% within 72 hours and significantly increase the proportion of CD8+ T cells among T cells. Figure 7 , 8 APT-4-1BB stimulation can increase the secretion level of IFN-γ in CD8+ T cells.

[0093] Example 6: APT-4-1BB treatment of mouse subcutaneous tumor model

[0094] Male C57 / BL6 mice aged 4–5 weeks were selected and divided into 4 groups. Tumors were inoculated on day 0. Starting from day 8, mice were intraperitoneally injected every two days with 100 μL PBS, 30 μg APT-4-1BB (100 μL liquid solution), or 30 μg nonsense sequence control (100 μL liquid solution). On days 8 and 14, mice were injected with either IgG (100 μg) or anti-mouse 4-1BB antibody (100 μg), as detailed below. Figure 9 .

[0095] The APT-NC-FAM nonsense sequence is shown in SEQ ID No. 7, (5'-3') as follows:

[0096] CACGCATAACCCCACGCACTGCATTGGCAGGCTGGTGATGACGTGAGTTATGCGTG.

[0097] Table 3 Anti-mouse 4-1BB antibody and IgG.

[0098]

[0099] like Figure 9 APT-4-1BB treatment can inhibit the growth of Hepa1-6 subcutaneous tumors in mice.

[0100] Male C57 / BL6 mice aged 4–5 weeks were selected. Hepa1-6 subcutaneous tumors were implanted into the right back of each C57 / BL6 mouse, with 100 μL of cell suspension (containing 4 × 10⁶ cells) injected into the right back of each mouse. 6 (cells). Mice were inoculated with tumors on day 0. Starting from day 8, they were intraperitoneally injected with 100 μL PBS, 30 μg APT-4-1BB, or 30 μg nonsense sequence control every two days.

[0101] Two weeks later, the mice were euthanized by cervical dislocation. Spleen immune cells and tumor-infiltrating lymphocytes were extracted from the mice, and T-cell and NK-cell typing was performed using flow cytometry. Mouse serum was collected, and biochemical analysis was used to detect visceral toxicity of APT-4-1BB. Mouse viscera were collected, sectioned, and stained with hematoxylin and eosin (HE) to detect visceral toxicity. Mouse tumors were collected, sectioned, and subjected to CD8 immunohistochemical staining. Figure 10 APT-4-1BB treatment increases the proportion of CD8+ T cells in tumor-infiltrating lymphocytes. For example... Figure 11 Immunohistochemical staining of tumor sections showed that APT-4-1BB treatment increased the proportion of CD8+ T cells in tumor-infiltrating lymphocytes. APT-4-1BB showed superior inhibition of mouse Hepa1-6 subcutaneous tumors compared to an equivalent total weight of mouse 4-1BB agonist antibody drugs. No significant hepatotoxicity or visceral toxicity was observed with APT-4-1BB.

[0102] Example 7: APT-4-1BB treatment of mouse carcinoma in situ

[0103] Female C57 / BL6 mice aged 4–5 weeks were selected. Mice were anesthetized via intraperitoneal injection of 1% sodium pentobarbital at a dose of 50 mg / kg. A longitudinal incision of approximately 1 cm was made below the xiphoid process of the mouse, the abdominal cavity was opened, and 50 μL of a mixture of stromal colloid cell suspension (containing 3 × 10⁻⁶ cells) was slowly injected into the left lobe of the liver. 6 (One cell), slowly withdraw the needle. Suture the peritoneum and cortex separately. Perform IVIS imaging on days 4, 9, and 13 after tumor implantation. Intraperitoneally inject mice with 40 mg / kg of fluorescein sodium solution, and gas anesthetize the mice 5 minutes later. Monitor tumor growth in mice using in vivo imaging.

[0104] Tumor treatment. Based on imaging results on day 4, mice were divided into three groups. Starting from day 5, they were intraperitoneally injected every two days with 100 μL PBS, 30 μg APT-4-1BB, or 30 μg nonsense sequence control. Imaging was performed on days 9 and 14 to monitor tumor growth. On day 14, mice were euthanized by cervical dislocation. Spleen immune cells and liver lymphocytes were extracted from the mice, and T cell and NK cell typing was performed using flow cytometry. Mouse serum was collected to detect visceral toxicity. Mouse viscera were collected, sectioned, and stained with hematoxylin and eosin (HE) to detect visceral toxicity.

[0105] like Figure 12 As shown, APT-4-1BB can inhibit the growth of Hepa1-6 liver carcinoma in situ in mice and increase the proportion of CD8+ T cells in T cells in the liver.

[0106] Example 7: SPR detection of the affinity between APT-4-1BB and 4-1BB protein

[0107] protein coupling

[0108] 1. The test used Cytiva's CM5 chip, and the instrument model was Biacore T200;

[0109] 2. Channel usage is as follows: FC=1 is used for activation and blocking only, and is used as a control channel; FC=2 is used to dilute protein 4-1bb with sodium acetate at pH 5.5, and to couple it using NHS and EDC, with a protein coupling amount of 700RU.

[0110] Monoclonal KD detection

[0111] 1. Sample preparation: The aptamer was serially diluted with DPBS at 500 nM to obtain 7 concentration gradients before testing.

[0112] 2. Injection procedure: Injection binding for 3 min, dissociation for 3 min, flow rate 30 μL / min. Regenerate with 15 mM NaOH for 20 s, flow rate 30 μL / min, and stabilize for 60 s after regeneration.

[0113] 3. KD detection of clone 4-1BB-1#: Clones 1 with different concentration gradients were injected sequentially from low to high concentration. The results after subtracting channel 1 from channel 2 were fitted using analysis software. The fitted result was KD = 3.579E. -8 M. For example Figure 13 SPR assay was used to detect the affinity between APT-4-1BB and 4-1BB protein, and the results showed that the KD value between them was 3.579E. -8 M.

Claims

1. A targeting 4-1BB nucleic acid aptamer, characterized in that, The targeted 4-1BB aptamer is APT-4-1BB, with the sequence shown in SEQ ID No. 1, specifically 5'-CACGCATAACATGTATGGG ACTGCTCGGGATTGCGGATTTACATTCGTTATGCGTG-3'.

2. The application of the 4-1BB aptamer as described in claim 1 in the preparation of antitumor drugs.

3. The application according to claim 2, characterized in that, The targeted 4-1BB aptamer can bind to human 4-1BB protein at the cellular level.

4. The application according to claim 2 or 3, characterized in that, The 4-1BB aptamer described above has a half-life of 5.951 h in fetal bovine serum and 7.622 h in mouse serum.

5. The application according to claim 2 or 3, characterized in that, The 4-1BB aptamer can be enriched at the tumor site.

6. The application according to claim 5, characterized in that, The 4-1BB aptamer can be enriched at the tumor site in the mouse Hepa1-6 subcutaneous tumor model.

7. The application according to claim 2 or 3, characterized in that, The tumors mentioned include subcutaneous tumors and / or carcinoma in situ.

8. The application according to claim 2 or 3, characterized in that, The aforementioned 4-1BB aptamer APT-4-1BB increases T lymphocyte proliferation by 15% or more within 72 hours.

9. The application according to claim 2 or 3, characterized in that, The aforementioned targeting of the 4-1BB aptamer can increase the proportion of CD8+ T cells in T cells.

10. The application according to claim 2 or 3, characterized in that, No significant hepatotoxicity or visceral toxicity was observed with the 4-1BB aptamer.

Images