Application of soybean RuBisCO activating enzyme family gene GmRCA11 in improvement of soybean quality
By overexpressing the GmRCA11 gene in soybeans, the problem of regulating soybean seed protein content and oil content was solved, thereby improving soybean quality.
Patent Information
- Application Number
- CN202510308586.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-10-28
AI Technical Summary
Existing technologies are insufficient to effectively increase the protein content and regulate the oil content of soybean seeds, thus affecting the improvement of soybean quality.
By overexpressing the soybean RuBisCO activator family gene GmRCA11 through genetic engineering, a recombinant expression vector was constructed and gene regulation was carried out in soybean. The expression of GmRCA11 was regulated by enhancing or inducible promoters, and combined with selective marker genes or phenotypic trait screening, the protein and oil content of soybean seeds were regulated.
It significantly increases the protein content of soybean seeds, regulates oil content, improves soybean quality, and achieves targeted modification of crop seed protein content.
Smart Images
Figure CN120843559A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering and relates to the application of a soybean RuBisCO activator gene GmRCA11 in improving soybean quality. Background Technology
[0002] Soybean [Glycine max (L.) Merr.] is an important food and oilseed crop, rich in protein and oil. Soy protein is one of the few plant proteins containing all the essential amino acids required by the human body, and its amino acid composition is close to that of animal protein, making it an ideal protein source for vegetarians, lactose-intolerant individuals, and those who need to control their cholesterol intake. Soy protein is widely used in the food industry, such as in meat substitutes, dairy substitutes, energy bars, and infant formula. With the increasing global demand for plant-based foods, the market demand for soy protein continues to rise, bringing significant economic benefits to agriculture and related industries.
[0003] RuBisCO activators are widely found in higher plants. Their function is to restore the catalytic activity of RuBisCO enzymes (ribulose-1,5-bisphosphate carboxylase / oxygenase) by removing inhibitors, thereby driving photosynthetic carbon assimilation (Salvucci et al., 1985). As chloroplast-localized proteins, the RCA family of proteins typically consists of two subunits, 45 kDa and 41 kDa, and possesses ATPase activity, capable of regulating the activation state of RuBisCO in response to temperature changes (Portis, 2003). Structurally, the N-terminus of RCA proteins contains a 58-amino acid signal peptide with a cleavage site located in a serine and threonine-rich region. This characteristic is closely related to their chloroplast localization and functional regulation.
[0004] Studies have shown that RCA family proteins play an indispensable role in plant photosynthesis. For example, overexpression of RCA-RBCS significantly enhances photosynthetic efficiency and biomass accumulation in rice under high-temperature stress (Qu et al., 2021). Similarly, overexpression of the RubisCO activator gene in cucumber not only promotes plant growth rate but also enhances its tolerance to low-temperature and low-light stress (Bi et al., 2017). These findings clearly demonstrate that RubisCO activators not only participate in the regulation of plant photosynthesis but also play an important role in plant growth, development, and stress responses.
[0005] The GmRCA11 (Glyma.11g221000) gene encodes a soybean RuBisCO activator protein family. This invention provides the application of GmRCA11 in improving soybean seed protein. Summary of the Invention
[0006] The purpose of this invention is to provide an application of the soybean RuBisCO activator family gene GmRCA11 in increasing the protein content of soybean seeds.
[0007] The objective of this invention can be achieved through the following technical solutions:
[0008] Application of the soybean RuBisCO activator protein encoding gene GmRCA11 in regulating soybean seed protein and oil content through genetic engineering; the nucleotide sequence of the soybean GmRCA11 protein encoding gene GmRCA11 is: SEQ ID NO.1.
[0009] The application of a recombinant expression vector containing the soybean GmRCA11 protein-coding gene GmRCA11 in regulating soybean seed protein and oil content through genetic engineering; the nucleotide sequence of the soybean GmRCA11 protein-coding gene GmRCA11 is: SEQ ID NO.1.
[0010] When constructing plant expression vectors using GmRCA11, any enhancing or inducible promoter can be added before the transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector can be modified, such as by adding selective marker genes (GUS gene, GFP gene, etc.) or antibiotic resistance genes (gentamicin markers, kanamycin markers, hygromycin markers, etc.) that can be expressed in plants. From a safety perspective, for transgenic plants, no selective marker genes may be added, and transformed plants can be screened directly based on phenotypic traits.
[0011] The plant expression vector carrying the GmRCA11 of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant hosts to be transformed can be monocotyledonous plants such as rice, wheat, and corn, or dicotyledonous plants such as tobacco, Arabidopsis thaliana, and soybean.
[0012] Beneficial effects:
[0013] In this invention, GmRCA11 belongs to the RuBisCO activator family. RNA-seq tissue expression analysis revealed that GmRCA11 is primarily expressed at higher levels in young leaves. Figure 2 Subcellular localization showed that the GmRCA11 protein is mainly located in chloroplasts. Figure 3Using the overexpression vector PBA002-GmRCA11, the GmRCA11 gene of this invention was overexpressed, which can regulate the protein and oil content of soybean seeds. Compared with the control Jack, the GmRCA11 overexpression material showed a significant increase in seed protein content. This invention discloses the efficacy of this gene in regulating plant seed development. By directionally modifying the seed protein content of crops, the seed protein content of crops can be increased. Attached Figure Description
[0014] The present invention will be further described below with reference to the accompanying drawings and embodiments.
[0015] Figure 1 Cloning of the GmRCA11 gene
[0016] Primers were designed based on the GmRCA11 sequence information predicted by the Phytozome website. Using leaf cDNA from Jack material as a template, PCR amplification yielded a 1332 bp DNA fragment. Sequencing analysis confirmed that the sequence information of this fragment matched the predicted sequence from the Phytozome website, indicating that this 1332 bp fragment represents the GmRCA11 gene. The markers were 5k, 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp, and 5000bp.
[0017] Figure 2 Tissue expression analysis of the GmRCA11 gene.
[0018] Tissue expression analysis using RNA-seq data from Soybase.
[0019] Figure 3 Subcellular localization of GmRCA11
[0020] Figure 4 Bar strip detection of GmRCA11 overexpression in soybean plants
[0021] 1 represents the recipient material; 2-4 represent three T0 generation transgenic lines, respectively.
[0022] Figure 5 Expression analysis of GmRCA11 in overexpression and receptor Jack material Detailed Implementation
[0023] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, and to the data. These embodiments are merely illustrative and are not intended to limit the scope of the invention in any way. In the following embodiments, various processes and methods not described in detail are conventional methods known in the art. Primers used are indicated upon their first appearance, and subsequent use of the same primers will use the same indication as their initial indication.
[0024] Example 1: Cloning and Identification of Soybean GmRCA11 and its Encoding Gene
[0025] Primers were designed based on the GmRCA11 sequence information predicted by the phytozome website, and PCR amplification was performed using Jack's leaf cDNA as a template.
[0026] Upstream primer GmRCA11-F: CACAGCCTCATTCATGGTCAC;
[0027] Downstream primer GmRCA11-R: AGAATGTTACACGCAAGTCCC.
[0028] The GmRCA11 gene was amplified from total cDNA in soybean leaf organs using RT-qPCR. Soybean leaf tissue was collected, ground in a mortar, and added to a 1.5 mL EP tube containing lysis buffer. After thorough shaking, the mixture was transferred to a glass homogenizer. The homogenized tissue was then transferred to another 1.5 mL EP tube, and total RNA was extracted using a plant total RNA extraction kit (TIANGEN DP404). The quality of the total RNA was assessed by formaldehyde denaturing gel electrophoresis, and the RNA content was measured using a spectrophotometer. Using the obtained total RNA as a template, reverse transcription was performed according to the instructions of the reverse transcription kit provided by Takara to synthesize the first strand of cDNA. PCR amplification was then performed. The PCR reaction system consisted of 2 μl cDNA (0.05 μg), 2 μl each of forward and reverse primers (10 μM), 25 μl 2×PhantaMax Buffer, 1 μl dNTP (10 mM), and 1 U Phanta Max Super-Fidelity DNA polymerase (Vazyme), with the volume made up to 50 μl with ultrapure water. The PCR program was as follows: performed on a Bio-RAD PTC200 PCR instrument, with the following program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 45 s, for a total of 35 cycles; then terminated with a final extension at 72℃ for 5 min, and stored at 4℃. The PCR product was recovered and cloned into the TA vector. Sequencing yielded the cDNA sequence SEQ ID NO.1 of the soybean gene GmRCA11, with a full length of 1332 bp, encoding the 444 amino acids shown in SEQ ID NO.2.
[0029] Example 2: Subcellular localization of GmRCA11
[0030] Subcellular localization was performed using transient expression of *Nicotiana benthamiana* (Tobacco Benzoinus 'Ben's tobacco'). The vector used was pAN580, and the primers were GmRCA11-F: acaaatctatctctctcgagATGGCTGCCTCCGTCTCCA, and GmRCA11-R: gctcaccatggatccAGATTGGAAGAAAGTTCCCCT. After PCR amplification and confirmation of the target band, the gel was excised and the recovered product was ligated into the vector via homologous recombination to construct the subcellular localization vector pAN580-GmRCA11 (gene at the N-terminus of GFP). This vector was then used to infect *Nicotiana benthamiana*. After expression and culturing for 48 hours, the protein was localized by laser confocal microscopy (Zeiss, LSM780) and observed with green fluorescence. The results are shown below. Figure 3 As shown, the empty vector plasmid was distributed throughout the cell, and the GmRCA11:GFP fusion protein was distributed in the chloroplasts and fused with the auto-red fluorescence of the chloroplasts, indicating that GmRCA11 may function in the chloroplasts.
[0031] Example 3: Expression analysis of GmRCA11 in overexpressed soybean materials
[0032] RNA was extracted from the leaves of the recipient material Jack and the overexpression lines OE-RCA11-1 and OE-RCA11-3, and converted into cDNA for RT-qPCR analysis.
[0033] Total RNA extraction was performed as in Example 1. The soybean constitutive expression gene Tubulin was used as an internal reference gene, with amplification primers: Tubulin forward primer sequence: GGAGTTCACAGAGGCAGAG, Tubulin reverse primer sequence: CACTTACGCATCACATAGCA. Real-time quantitative PCR analysis was performed using cDNA from the recipient and transgenic soybean leaves as templates. The amplification primers for GmRCA11 were: GmRCA11-qPCR-F: CAGCTCCCAGTTCATCCTTC, GmRCA11-qPCR-R: GGCAAGACCCTTCCATCTGT. Results showed that the expression level of GmRCA11 was significantly increased in the overexpression material.
[0034] Example 4: Genetic Engineering Applications of GmRCA11
[0035] The CDS region sequence of the GmRCA11 gene was constructed into the overexpression vector PBA-002 to obtain the GmRCA11-PBA002 overexpression vector. The upstream primer was PBA002-GmRCA11-F: cgcgccgggcccaggcctacgcgtATGGCTGCCTCCGTCTCCA; the downstream primer was PBA002-GmRCA11-R: atcggggaaattcgagctctcaAGATTGGAAGAAAGTTCCCCT. Soybean genetic transformation experiments were then performed. The PBA002-GmRCA11 vector was transformed into Agrobacterium tumefaciens strain EHA105 using a freeze-thaw method.
[0036] Soybean seeds with no surface defects, plump grains, and uniform size and color of seed coat were selected and sterilized in a fume hood. Sterilization was performed using chlorine gas generated from the chemical reaction HCl(conc.) + NaClO → Cl2↑ + NaOH (conc. hydrochloric acid and sodium hypochlorite in a volume ratio of approximately 1:10). In the experiment, 120 ml of NaClO was placed in an Erlenmeyer flask. The soybeans, placed in a petri dish, were then placed in a desiccator, and the Erlenmeyer flask was placed in the center of the desiccator and covered. 15 ml of concentrated HCl was then slowly added from above the desiccator through a separatory funnel. The sterilization time was 7 hours.
[0037] Seed germination: After sterilization, the seeds are thoroughly blown to disperse the chlorine gas in a clean bench and then vertically inserted into the pre-prepared solidified SG4 germination medium, ensuring that the medium covers half of the seed hilum.
[0038] Inoculation: Add approximately 120 ml of YEB liquid culture medium containing antibiotics Kan and Rif to an Erlenmeyer flask, add 1.5 ml of bacterial culture, and incubate at 28°C and 200 rpm until OD reaches the target value. 600 =0.9.
[0039] Agrobacterium infection: Centrifuge the shaken bacterial suspension at 5000 rpm for 10 min at room temperature, discard the supernatant, then add co-culture medium (CCM) to two centrifuge tubes and vortex to resuspend, adjusting the OD600 to 0.6. Five days after soybean seed germination, remove part of the hypocotyl, leaving 5-10 mm. Then cut the seed along the cotyledons and hypocotyl, remove the true leaves, and gently make several incisions along the hypocotyl direction at the cotyledon node. Pour the treated explants and the suspended bacterial suspension into a sterilized jar and co-culture at 28℃ and 120 rpm for 30-40 min. Finally, remove the explants, cotyledon side down, and place them on a solid co-culture medium (CCM) lined with filter paper. Place 14 explants per dish and incubate in the dark at 25℃ for 5 days.
[0040] Induction of shoot clusters: After co-culturing for 5 days, explants were sterilized with sterile water and Wash-Liquid. Excessively long hypocotyls were removed, leaving approximately 5-10 mm. The explants were inserted at a 45° angle with the growing point upward into SIM solid medium without glufosinate, 8 per plate, and cultured at 26°C under light for 15 days. After 15 days, large buds and part of the hypocotyl were removed. Explants that had developed shoot clusters were then transferred to SIM solid medium supplemented with 6 mg / L glufosinate for selection and cultured for another 15 days.
[0041] Elongation: Remove the cotyledons, dead leaves, and part of the hypocotyl from the explants that are not completely dead, and replace them with SEM solid medium containing 4 mg / L glufosinate for 15 days. Repeat this process every 15 days, removing dead leaves and part of the hypocotyl, replacing the medium with fresh SEM solid medium, and gradually decreasing the concentration of glufosinate.
[0042] Rooting: When the bud of the explant grows to about 6cm, cut off the bottom, make a cross-shaped cut at the bottom of the stem, and transfer it to rooting medium RM for culture. The induced roots will be visible after about 10 days.
[0043] Hardening off: Pour an appropriate amount of sterile water into the bottle and incubate at 26°C under light for about 5 days. Transplanting: When the number and length of roots are suitable, separate the tissue culture seedlings from the culture medium, transplant them into sterilized soil, and place them in an artificial incubator for growth (16h light / 8h darkness, 25°C).
[0044] Three strains were tested using bar test strips in the T0 generation. Two strains with stable expression were obtained by indoor propagation to the T2 generation. GmRCA11 expression was analyzed: GmRCA11-qPCR-F: CAGCTCCCAGTTCATCCTTC, GmRCA11-qPCR-R: GGCAAGACCCTTCCATCTGT. The expression level of the GmRCA11 gene was significantly increased in both strains. Figure 5 Compared with the recipient material Jack, the two strains showed significantly higher seed protein content and significantly lower oil content (Table 1).
[0045] Table 1
[0046]
[0047] The significance of the difference was tested using t-tset (*P<0.05; **P<0.01).
Claims
1. Application of soybean GmRCA11 protein-encoding gene GmRCA11 in regulating plant seed protein content; the nucleotide sequence of the soybean GmRCA11 protein-encoding gene GmRCA11 is: SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, Overexpression of the soybean GmRCA11 gene increases the protein content of soybean seeds.
3. The application according to claim 1, characterized in that... By promoting the expression of the soybean GmRCA11 protein-encoding gene GmRCA11, the protein content of soybean seeds can be increased.
4. Application of the PBA002 overexpression vector containing the soybean GmRCA11 protein-coding gene GmRCA11 in improving the protein content of soybean seeds; the nucleotide sequence of the soybean GmRCA11 protein-coding gene GmRCA11 is: SEQ ID NO.1.