Application of LOX2 gene in reduction of tobacco pigment content

By overexpressing the LOX2 gene in tobacco, the content of lutein, β-carotene, zeaxanthin, and neoxanthin was reduced, solving the problem of low degradation efficiency of tobacco pigments in existing technologies and improving the content and quality of aroma substances in tobacco leaves.

CN120843587APending Publication Date: 2025-10-28YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511238032.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-01
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively degrade lutein, β-carotene, azadirachtin, and neoxanthin in tobacco, which affects the formation of tobacco aroma compounds and the quality of tobacco leaves.

Method used

By constructing a LOX2 gene overexpression vector, the LOX2 gene was overexpressed in tobacco using transgenic technology, thereby reducing the content of lutein, β-carotene, zeaxanthin, and neoxanthin, resulting in a high-aroma tobacco variety.

Benefits of technology

It significantly reduced the content of lutein, β-carotene, azadirachtin, and neoxanthin in tobacco, and improved the content and quality of aroma substances in tobacco leaves.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843587A_ABST
    Figure CN120843587A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant genetic engineering, and relates to application of an LOX2 gene in reducing the content of tobacco pigment. According to the invention, a tobacco lipoxygenase 2 coding gene is obtained from tobacco by using a homologous cloning technology, and an overexpression vector of the gene is constructed and transformed into a tobacco plant to obtain the tobacco plant overexpressed by the LOX2 gene. Through detection of the LOX2 gene overexpression tobacco plant, the xanthophyll content of the transgenic plant is lower than 22% of a control group, the beta-carotene content of the transgenic plant is lower than 21% of the control group, the violaxanthin content of the transgenic plant is lower than 23% of the control group, and the neoxanthin content of the transgenic plant is lower than 20% of the control group. Therefore, the LOX2 gene has an important application prospect in the aspect of tobacco pigment degradation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology and relates to a... LOX2 Application of genes in reducing tobacco pigment content. Background Technology

[0002] Tobacco is a leaf-based economic crop, and its quality determines the usability of tobacco leaves. The aroma compounds in tobacco are key components that constitute the unique flavor of tobacco and its products (such as cigarettes). These aroma compounds not only affect the sensory experience of tobacco but also significantly influence consumer preferences and acceptance. Tobacco aroma compounds mainly originate from the chemical components of the tobacco plant itself, as well as byproducts generated during tobacco processing and combustion. The chemical components in tobacco and tobacco smoke are extremely diverse, including a wide variety of aroma compounds; according to literature reports, the total number of chemical components in tobacco and tobacco smoke can reach several thousand. The formation and accumulation of tobacco aroma compounds are regulated by multiple genes that participate in various pathways of tobacco sugar metabolism and terpene metabolism, playing a crucial role in the production of tobacco aroma compounds.

[0003] Studies have shown that LOX expression is highly correlated with plant growth and development, volatile substance production, and stress response. Further research indicates that higher lipoxygenase activity leads to greater degradation of carotenoids such as lutein, β-carotene, xanthophyll, and neoxanthophyll. Since the production of aroma compounds in tobacco leaves is closely related to the degree of plastid pigment degradation, improving tobacco pigment degradation is of great significance for cultivating high-aroma tobacco varieties. Summary of the Invention

[0004] The purpose of this invention is to provide a LOX2 The application of genes in reducing tobacco pigment content, where the tobacco pigments referred to are lutein, β-carotene, zeaxanthin, and neoxanthin.

[0005] This invention is achieved through the following technical solution: A sort of LOX2 The application of genes in reducing tobacco pigment content, the LOX2 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the application is through overexpression. LOX2 Genes were used to obtain tobacco varieties with reduced levels of lutein, β-carotene, zeaxanthin, and neoxanthin.

[0006] Among them, utilizing LOX2 The method for preparing new transgenic plant varieties involves overexpression using transgenic technology and transient expression technology. LOX2 Genes were used to obtain new varieties of transformed plants with reduced contents of lutein, β-carotene, zeaxanthin, and neoxanthin.

[0007] Further, obtaining tobacco varieties with reduced contents of lutein, β-carotene, xanthophyll, and neoxanthophyll includes the following steps: constructing LOX2 Gene overexpression vectors were introduced into tobacco, and after screening and identification, tobacco varieties with reduced contents of lutein, β-carotene, zeaxanthin, and neoxanthin were obtained.

[0008] Furthermore, the construction LOX2 Gene overexpression vectors include the following steps: using tobacco cDNA as a template, PCR amplification to obtain... LOX2 Gene fragments are inserted into the starting vector and then screened and identified.

[0009] Furthermore, the primers for the PCR amplification are as follows: LOX2 -F:ATGTTGAAGCCTCAGCTTCATCA; LOX2 -R:AATGGAAATGCTATAAGGTAC.

[0010] Furthermore, the launch carrier is pCAMBIA sup1300.

[0011] Furthermore, the tobacco is K326.

[0012] Beneficial technical effects of the present invention: This invention utilizes homologous cloning technology to obtain a tobacco lipoxygenase 2 ( ) from tobacco. LOX2 The gene encoding the gene was constructed, and an overexpression vector for this gene was created and transformed into tobacco plants to obtain... LOX2 Tobacco plants with overexpressed genes. Through the analysis of... LOX2 Detection of tobacco plants with overexpressed genes revealed significantly reduced levels of lutein, β-carotene, zeaxanthin, and neoxanthin in the transgenic plants. This fully demonstrates... LOX2 This gene is involved in the degradation of lutein, β-carotene, xanthophyll, and neoxanthophyll in tobacco. This lays the foundation for creating tobacco varieties that efficiently degrade carotenoid content through genetic engineering. Attached Figure Description

[0013] Figure 1 The relative content of xanthophyll in the middle leaves of the transgenic tobacco T1 generation plants in Example 3 of this invention (where CT is the control tobacco K326, OE#LOX2-1 and OE#LOX2-2 are two transgenic tobacco K326 lines that overexpress LOX2, each material has 3 biological replicates, and different lowercase letters indicate significant differences from the control at the 0.05 level). Figure 2The relative content of β-carotene in the middle leaves of the T1 generation transgenic tobacco plants in Example 3 of this invention (where CT is the control tobacco K326, OE#LOX2-1 and OE#LOX2-2 are two transgenic tobacco K326 lines that overexpress LOX2, each material has 3 biological replicates, and different lowercase letters indicate significant differences from the control at the 0.05 level). Figure 3 The relative content of purpuric xanthophyll in the middle leaves of the T1 generation transgenic tobacco plants in Example 3 of this invention (where CT is the control tobacco K326, OE#LOX2-1 and OE#LOX2-2 are two transgenic tobacco K326 lines that overexpress LOX2, each material has 3 biological replicates, and different lowercase letters indicate significant differences from the control at the 0.05 level). Figure 4 The relative content of neoxanthin in the middle leaves of the transgenic tobacco line T1 in Example 3 of this invention (where CT is the control tobacco K326, OE#) LOX2 OE#LOX2-1 and OE#LOX2-2 are two transgenic tobacco K326 lines that overexpress LOX2. Each material has three biological replicates. Different lowercase letters indicate significant differences from the control at the 0.05 level. Detailed Implementation

[0014] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0015] Conversely, this invention encompasses any substitutions, modifications, equivalent methods, and solutions made within the spirit and scope of the invention as defined in the claims. Furthermore, to provide a better understanding of the invention, certain specific details are described in detail below. However, those skilled in the art will fully understand the invention even without these detailed descriptions.

[0016] The degradation of lutein, β-carotene, xanthophyll, and neoxanthophyll in tobacco leaves yields aroma compounds. Therefore, creating tobacco materials with fully degraded pigments through genetic engineering is a crucial goal for improving tobacco quality. Based on this, the present invention provides... LOX2 Application of genes in reducing tobacco pigment content.

[0017] The present invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments, experimental examples and comparative examples are all commercially available.

[0018] Unless otherwise specified, the following examples were conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or as recommended by the manufacturer's instructions.

[0019] Example 1: LOX2 Acquisition of genes In this embodiment, RNA was extracted from tobacco tissue, reversed into cDNA, and used as a template for PCR amplification. LOX2 The gene (nucleotide sequence as shown in SEQ ID NO.1) is implemented as follows: 1. LOX2 Determination of gene sequence According to Arabidopsis AtLOX2 Gene sequence searches in the NCBI database yielded homologous genes in tobacco. LOX2 Sequence, and use this sequence to design gene cloning primers: LOX2 -F:ATGTTGAAGCCTCAGCTTCATCA (as shown in SEQ ID NO.2); LOX2 -R: AATGGAAATGCTATAAGGTAC (shown in SEQ ID NO.3).

[0020] 2. PCR amplification RNA was extracted from tobacco K326 leaf tissue, reverse transcribed to obtain first-strand cDNA, and used as a template to perform primer transcription. LOX2 -F / LOX2 -R is used for PCR amplification, and the PCR products are recovered and purified.

[0021] The PCR amplification reaction system used was the Phusion high-fidelity amplification enzyme reaction system, which consisted of 200 ng cDNA, 10 μL of 5×Phusion HF reaction buffer, 1 μL of 10 mM dNTP, 2 U of Phusion® High-Fidelity DNA Polymerase, 1 μL each of 10 μM forward and reverse primers, and water added to a final volume of 50 μL.

[0022] The PCR amplification reaction was performed on a Mastercycler® Pro amplification instrument with the following reaction program: 98°C for 5 minutes; 98°C for 30 seconds, 55°C for 30 seconds, 72°C for 3 minutes, 35 cycles; extension at 72°C for 10 minutes.

[0023] 3. Ligation of purified PCR products with vectors The purified PCR product from step 2 was ligated to the vector. The ligation system and specific process are as follows: Mix 4 μL of purified product, 1 μL of salt solution, and 1 μL of PCR®-BluntⅡ-TOPO (Invitrogen), and incubate at 25°C for 30 min. Transform the ligated vector into *E. coli* DH5α using heat shock, add LB liquid medium, shake, and then plate onto LB agar plates containing 100 mg / L kanamycin for overnight incubation. Pick colonies for further culture, extract plasmid, and perform PCR detection. Screen for positive clones and sequence them. Save the correctly sequenced plasmids for subsequent operations.

[0024] Example 2: LOX2 Obtaining tobacco plants with overexpressed genes In this embodiment, the PCR®-BluntII-TOPO vector was used as the intermediate vector and pCAMBIA sup1300 was used as the expression vector backbone to construct... LOX2 Gene overexpression vectors were transformed into Agrobacterium, which then infected tobacco plants. The resulting samples were screened and identified. LOX2 The specific procedures for gene overexpression in tobacco plants are as follows: 1. LOX2 Construction of gene overexpression vectors (1) LOX2 Acquisition of gene fragments The primers were constructed as follows: LOX2 -Pst Ⅰ-F: 5'-agaaagcttctgcagATGTTGAAGCCTCAGCTTCATCA-3' (shown in SEQ ID NO.4); LOX2 -Kpn I-R: 5'-gctcaccatggtaccAATGGAAATGCTATAAGGTAC-3' (shown in SEQ ID NO. 5).

[0025] LOX2 In -PstⅠ-F, ctgcag is the PstⅠ restriction site. LOX2 The ggtacc site in -KpnⅠ-R is the KpnⅠ restriction site.

[0026] With LOX2PCR amplification was performed using TOPO plasmid DNA from a gene-positive clone as a template. The PCR reaction volume was 50 μL, specifically: 200 ng DNA, 10 μL of 5×Phusion HF reaction buffer, 1 μL of 10 mM dNTPs, 2 U of Phusion® High-Fidelity DNA Polymerase, and 10 μM of... LOX2 -Pst I-F primers, LOX2 Add 1 μL of each of the Kpn I-R primers and bring the volume to 50 μL with water.

[0027] PCR reactions were performed on a Mastercycler® Pro amplification instrument with the following program: 98°C for 5 minutes; 98°C for 30 seconds, 55°C for 30 seconds, 72°C for 3 minutes, 35 cycles; extension at 72°C for 10 minutes.

[0028] (2) Recover the target fragment and connect it to the TOPO carrier. The PCR product was recovered and purified, and then ligated to the TOPO vector using a kit. The specific ligation procedure is as described in Example 1.

[0029] (3) Overexpression vector pCAMBIA sup1300- LOX2 Construction Plasmids with correct sequencing were digested with Pst I / Kpn I, and the fragments were recovered from the gel after gel electrophoresis for later use.

[0030] Enzyme digestion was performed using the empty pCAMBIA sup1300 vector: pCAMBIA sup1300 was double-digested with Pst I / Kpn I to obtain the vector fragment, which was then recovered via gel digestion. The target fragment was inserted into pCAMBIA sup1300 using the ClonExpress Ultra One Step Cloning Kit. The reaction was as follows: the total reaction volume was 10 μL, containing 4 μL of the gel-recovered product containing the target fragment, 1 μL of the pCAMBIA sup1300 (Pst I / Kpn I double-digested) vector, 1 μL of 10× buffer, 1 μL of homologous recombinase, and 3 μL of sterile double-distilled water. The mixture was incubated at room temperature for 2 hours, transformed into competent E. coli cells, cultured with medium and shaken, and then plated onto LB agar plates containing 100 mg / L kanamycin for overnight culture. Plasmids were extracted for PCR and enzyme digestion assays to verify the successful construction of the overexpression vector containing the target gene fragment.

[0031] 2. Agrobacterium-mediated transformation Agrobacterium competent cells were removed from a -80°C freezer, thawed on ice, and then the recombinant expression vector pCAMBIA sup1300- was added. LOX24 μL; quick freeze in liquid nitrogen for 1 minute, transfer to a 37°C water bath for 5 minutes, then to an ice bath for 2 minutes, add 1 mL of LB liquid medium to the mixture, and incubate at 28°C and 220 rpm for 3-4 hours; spread the culture on LB solid medium containing 100 mg / L kanamycin and 25 mg / L rifampicin, and incubate upside down at 28°C for 2-3 days, where Agrobacterium clones containing the target vector can be seen.

[0032] 3. Introducing overexpression vectors into tobacco and culturing transgenic plants. a. Select Agrobacterium clones containing the target vector, streak them on LB plates containing kanamycin and rifampin, and incubate at 28°C for 2-3 days; scrape off the streaks and inoculate them into MS medium containing spectinomycin and rifampin, incubate at 28°C with shaking at 220 rpm, and infect when the bacterial concentration reaches OD=0.5-0.8. b. Place tobacco leaves in a 500mL wide-mouth bottle, add an appropriate amount of 75% ethanol, and rinse for 1 minute; discard the ethanol, add 0.1% HgCl2 solution, and shake on a shaker at room temperature for 15-30 minutes; discard the solution and rinse 6 times with sterile water; c. Remove tobacco (K326) leaves, wash off surface liquid with sterile absorbent paper, cut sterile leaves into 1cm×1cm pieces with scissors, place the cut tobacco leaves into a sterile MS liquid culture medium suspension containing the target carrier, and let stand for 15-20 minutes; remove the tobacco leaves, absorb excess bacterial solution with sterile filter paper, and incubate in the dark at 25°C for two days in MS medium containing 6-BA (6-benzylaminopurine, 0.02mg / L) and NAA (naphthaleneacetic acid, 2mg / L); transfer the tobacco leaves to differentiation medium, with the cut surface in contact with the medium. The differentiation medium is MS medium containing 6-BA (0.5mg / L), NAA (0.1mg / L), kanamycin (100mg / L), and cephalosporin (500mg / L). Subculture every 2-3 weeks. Callus tissue gradually forms at the cut surface, and finally, buds differentiate. d. Cut off the buds that have grown to 3-5cm, transfer them to MS medium to induce rooting, remove the transgenic plants from the rooting medium after rooting, wash the medium with tap water, and transplant them into sterile nutrient soil. e. Transgenic plants LOX2 Gene-specific primers were used for PCR verification to identify transgenic positive plants.

[0033] Example 3: Overexpression LOX2 Detection of carotenoid content in tobacco Transgenic T1 generation OE# strains grown in greenhouse pots LOX2 And control CT. The middle leaves (leave 9-12) were taken, and the contents of lutein, β-carotene, zeaxanthin and neoxanthin were determined by liquid chromatography.

[0034] Liquid phase conditions: The chromatographic column used was a YMC C30 (3 μm, 100 mm × 2.0 mm i.d.). The mobile phases were: Phase A was methanol / diethyl ether (v / v 1:3, v / v) with 0.1% formic acid; Phase B was methyl tert-butyl ether. The gradient elution program was: 0 min A / B 100:0 (v / v), 3 min 100:0 (v / v), 5 min 30:70 (v / v), 9 min 5:95 (v / v), 10 min 100:0 (v / v), and 11 min 100:0 (v / v). The flow rate was 0.8 mL / min; the column temperature was 28°C; and the sample loading was 2 μL.

[0035] Mass spectrometry conditions The atmospheric pressure chemical ionization source (APCI) is set at 350°C with a curtain gas (CUR) pressure of 25 psi. In the Q-Trap6500+, each ion pair is scanned and detected based on optimized declustering potential (DP) and collision energy (CE).

[0036] The results are as follows Figure 1 , Figure 2 , Figure 3 and Figure 4 As shown in the figure, the transgenic lines had 22% lower lutein content, 21% lower β-carotene content, 23% lower xanthophyll content, and 20% lower neoxanthophyll content than the control, indicating that the transgenic lines were overexpressed... LOX2 The gene can efficiently degrade tobacco leaves' lutein, β-carotene, azadirachtin, and neoxanthin.

[0037] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A kind LOX2 The application of genes in reducing tobacco pigment content is characterized by, The LOX2 The nucleotide sequence of the gene is shown in SEQ ID NO.1; the application is through overexpression. LOX2 Genes were used to obtain tobacco varieties with reduced levels of lutein, β-carotene, zeaxanthin, and neoxanthin.

2. The one according to claim 1 LOX2 The application of genes in reducing tobacco pigment content is characterized by, The method for obtaining tobacco varieties with reduced contents of lutein, β-carotene, zeaxanthin, and neoxanthin includes the following steps: constructing LOX2 Gene overexpression vectors were introduced into tobacco, and after screening and identification, tobacco varieties with reduced contents of lutein, β-carotene, zeaxanthin, and neoxanthin were obtained.

3. The one according to claim 2 LOX2 The application of genes in reducing tobacco pigment content is characterized by, The construction LOX2 Gene overexpression vectors include the following steps: using tobacco cDNA as a template, PCR amplification to obtain... LOX2 Gene fragments are inserted into the starting vector and then screened and identified.

4. The one according to claim 3 LOX2 The application of genes in reducing tobacco pigment content is characterized by, The primers for the PCR amplification are as follows: LOX2 -F:ATGTTGAAGCCTCAGCTTCATCA; LOX2 -R:AATGGAAATGCTATAAGGTAC。 5. The one according to claim 3 LOX2 The application of genes in reducing tobacco pigment content is characterized by, The launch vehicle is pCAMBIA sup1300.

6. The method according to any one of claims 1 to 5 LOX2 The application of genes in reducing tobacco pigment content is characterized by, The tobacco is K326.