Method for enhancing tobacco nicotine synthesis level

Abstract

The invention relates to the technical field of plant biology, in particular to a method for enhancing nicotine synthesis level of tobacco, which comprises the following steps: simultaneously overexpressing an arginine decarboxylase gene NtADC1 (SEQ ID NO: 13) and a transcription factor gene NtMYC2 (SEQ ID NO: 14), transforming tobacco, and hybridizing to obtain a co-expression plant. Experiments show that the nicotine content of a coexpression plant after topping reaches 310% of that of a wild type, and is obviously higher than that of a single-gene overexpression plant (NtMYC2 overexpression is improved by 35%, and NtADC1 overexpression is improved by 5%). The method solves the technical bottleneck that in the prior art, the nicotine increasing amplitude is less than 40%, and a new scheme is provided for high-nicotine tobacco breeding.

Description

Technical Field

[0001] This invention relates to the field of plant biotechnology, and more specifically to a method for enhancing the synthesis level of nicotine in tobacco. Background Technology

[0002] Nicotine is the main alkaloid in tobacco, accounting for approximately 90%–95% of the total alkaloid content. It is a key substance determining the commercial value of tobacco and a crucial factor influencing the quality and aroma of tobacco leaves. Nicotine possesses highly effective insecticidal activity and can effectively alleviate Alzheimer's disease, making it of great development value in the fields of biopesticides and biomedicine. Research on the regulation of nicotine synthesis in tobacco has significant application value.

[0003] Nicotine molecules consist of a pyrrolidine ring and a pyridine ring, synthesized in the roots of tobacco and transported to the above-ground parts via the xylem. The pyrrolidine ring of nicotine is closely related to putrescine produced by the nitrogen metabolism pathway. Arginine and ornithine in the nitrogen metabolism pathway are converted into putrescine under the catalysis of arginine decarboxylase (ADC) and ornithine decarboxylase (ODC), respectively. The synthesis of nicotine from putrescine also requires the participation of multiple enzymes, including N-methyltransferase (PMT), N-methylputrescine oxidase (MPO), quinolinate phosphoribosyltransferase (QPT), berberine bridging enzyme (BBL), and PIP family isoflavone reductase (A622). The gene expression of nicotine synthesis and the aforementioned nicotine synthases in tobacco are induced by the hormone jasmonic acid. Transcription factors such as NtMYC2, NtMYB305, and NtERF189 are involved in the jasmonic acid-mediated regulation of nicotine synthesis. However, the expression of NtMYC2, NtMYB305 and NtERF189 transcription factors can only increase the nicotine content of tobacco by about 40%, and cannot achieve a higher level of enhancement.

[0004] Therefore, it is necessary to provide a method to enhance the level of nicotine synthesis in tobacco. Summary of the Invention

[0005] To address the aforementioned technical problems, the purpose of this invention is to provide a method for enhancing nicotine synthesis in tobacco, effectively increasing the nicotine content. This invention is the first to discover and propose a method for enhancing nicotine synthesis in tobacco by co-expressing the arginine decarboxylase NtODC1 and the transcription factor NtMYC2. This method enhances the function of the upstream putrescine synthesis pathway through NtADC1 overexpression and utilizes NtMYC2 overexpression to provide activation and regulatory functions, thereby achieving a significant increase in nicotine content in tobacco. This provides a new approach and method for cultivating high-nicotine tobacco.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a method for enhancing the level of nicotine synthesis in tobacco by simultaneously overexpressing the arginine decarboxylase gene NtADC1 and the transcription factor gene NtMYC2 in tobacco plants; the nucleotide sequence of the NtADC1 gene is shown in SEQ ID NO:13, and the nucleotide sequence of the NtMYC2 gene is shown in SEQ ID NO:14.

[0007] Furthermore, expression vectors for the NtADC1 gene and the NtMYC2 gene were constructed. The expression vectors were transformed into Agrobacterium and co-expressed plants were obtained through hybridization.

[0008] Furthermore, the method for preparing the expression vector of the NtADC1 gene includes: The NtADC1 gene was inserted into the NotI and AscI double restriction sites of pENTR-D-TOPO (purchased from Thermo Fisher, catalog number K240020) to obtain the pENTR-D-TOPO-NtADC1 vector. The pENTR-D-TOPO-NtADC1 vector was then ligated to the plant expression vector pMDC-attR-Flag (the nucleotide sequence of which is shown in SEQ ID NO.16) via a gateway to obtain the pMDC-NtADC1-Flag vector. pMDC-attR-Flag is a binary vector obtained by replacing the CaMV35S promoter of pMDC32-HPB (GenBank accession number FJ172534.1) with a 2×CaMV35S promoter and adding a Flag tag coding sequence to the end of the attR region.

[0009] Furthermore, the method for preparing the expression vector of the NtMYC2 gene includes: The NtMYC2 gene was inserted into the NotI and AscI double restriction sites of pENTR-D-TOPO to obtain the pENTR-D-TOPO-NtMYC2 vector. The CDS fragment of the NtMYC2 gene was then ligated into the plant expression vector pBin19-attR-HA (the nucleotide sequence of which is shown in SEQ ID NO.15) via a gateway to obtain the pBin19-NtMYC2-HA vector. Specifically, pBin19-attR-HA is a binary vector obtained by replacing the YFP tag coding sequence of pBin19 35S attR-YFP (GenBank accession number AY995145.1) with the HA tag coding sequence.

[0010] In a second aspect, the present invention provides an expression vector combination comprising: The pMDC-attR-Flag vector was constructed by ligating the gene shown in SEQ ID NO:13. pMDC-NtADC1-Flag carrier, The gene shown in SEQ ID NO:14 was constructed by ligating the pBin19-attR-HA vector. pBin19-NtMYC2-HA vector.

[0011] In a third aspect, the present invention provides engineered bacteria containing the aforementioned expression vector combination.

[0012] In a fourth aspect, the present invention provides a tobacco cultivation system comprising: An expression cassette containing the NtADC1 gene shown in SEQ ID NO:13; An expression cassette containing the NtMYC2 gene shown in SEQ ID NO:14; The expression box is operatively connected to a plant promoter.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention overcomes the bottleneck of nicotine biosynthetic flux by achieving the following through dual-gene synergistic regulation (NtADC1 enhances substrate supply + NtMYC2 activates the synthase group): (1) The nicotine content was significantly increased by 210% after topping; (2) The yield of active ingredients in biological pesticides increased by 3.1 times; (3) Stable inheritance and no growth inhibition, plant height / biomass showed no significant difference. Attached Figure Description

[0014] Figure 1 Diagram of transgenic plant cultivation; Figure 2 The results of qPCR identification analysis of transgenic lines overexpressing NtMYC2 (MYC2-OE2, MYC2-OE5, MYC2-OE7) and transgenic lines overexpressing NtADC1 (ADC1-OE1, ADC1-OE3, ADC1-OE6) were presented. Figure 3 Results of qPCR identification of hybrid tobacco lines (Hyb-1, Hyb-2, Hyb-3) overexpressing NtMYC2 and NtADC1; Figure 4 Nicotine content in tobacco leaves before topping; Figure 5Nicotine content in leaves two weeks after topping. Detailed Implementation

[0015] The technical solutions of this invention will be clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0016] The terminology and product sources involved in this invention are explained as follows: NtODC1: Ornithine decarboxylase; NtMYC2: transcription factor; NtADC1: Arginine decarboxylase.

[0017] Tobacco variety TN90: derived from commercially available varieties.

[0018] Example 1 1. Extraction of total RNA The tobacco variety TN90 was selected and cultured in 1 / 2 MS or MS liquid medium. It was cultured for 15-20 days in a greenhouse with a temperature of 23℃ and a photoperiod of 14 h light / 10 h dark. Then, 0.1-0.2 g of roots were weighed, thoroughly ground with liquid nitrogen, and total RNA was extracted using Trizol (purchased from Invitrogen), a plant RNA extraction reagent.

[0019] Cloning of CDS fragments of NtMYC2 and NtADC1 Using the extracted total RNA as a template, cDNA was synthesized by reverse transcription of the RNA sample using a reverse transcription kit (TaKaRa PrimeScript™ II 1stStrand cDNA Synthesis Kit, model: 6210B). Primers were designed based on the CDS sequences of transcription factors NtMYC2 and NtADC1. The primer sequences are shown below: NtMYC2-F: CAACTGTTTGTGCTGGGTTTATGGA (SEQ ID NO. 1); NtMYC2-R:TAGCGTGTTCAGCAACTCTGGATG (SEQ ID NO. 2); NtADC1-F: ACAGAAGAAGAGATGCCGGCCCTAG (SEQ ID NO.3); NtADC1-R: CACTTCAAGCAGTGCAATAGGACCA (SEQ ID NO.4); Using cDNA as a template, and NtMYC2-F / NtMYC2-R and NtADC1-F / NtADC1-R as primers, PCR amplification was performed using a high-fidelity enzyme (Vazyme 2 × Phanta® Max Master Mix (Dye Plus), model: P525-02). The PCR program was as follows: 94℃ pre-denaturation for 2-4 min; 94℃ denaturation for 30-40 s; 58℃ annealing for 30-40 s; 72℃ extension for 30-50 s; 33-35 cycles; 72℃ incubation for 5-10 min. PCR reaction system and reaction conditions: Table 1 composition Manufacturer volume 2 × Phanta® Max Master Mix Vazyme 25 μL Primer F Sangon 1 μL Primer R Sangon 1 μL cDNA 1 μL <![CDATA[ddH2O]]> 22 μL The PCR products amplified in the above steps were separated by 1%~1.5% agarose gel electrophoresis, and then gel extraction was performed using a gel extraction kit (Vazyme FastPure Gel DNA Extraction Mini Kit, model: DC301-01) to obtain the CDS fragments of NtMYC2 and NtADC1. 2. Construction of overexpression vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag The obtained CDS fragments of NtMYC2 and NtADC1 were ligated into the T vector pMD18-T, respectively. Positive single colonies were identified by colony PCR and sequencing. Primers containing restriction enzyme sites were then designed, as follows: NtMYC2-Etr5: AAACCGCGGATGACTGATTACAGCTTACCC (SEQ ID NO.5); NtMYC2-Etr3: GCGTGTTTCAGCAACTCTGG (SEQ ID NO.6) NtADC1-Etr5: AAACCGCGGATGCCGGCCCTAGGTTGTTG (SEQ ID NO.7) NtADC1-Etr3: AGCAGTGCAATAGGACCAAA (SEQ ID NO.8) Positive single colonies of NtMYC2 and NtADC1 containing the correctly ligated pMD18-T vector were expanded and cultured, and plasmids were extracted (Vazyme FastPure Plasmid Mini Kit, model: DC201-01). Using this plasmid as a template, and the aforementioned NtMYC2-Etr5 / NtMYC2-Etr3 and NtADC1-Etr5 / NtADC1-Etr3 as primers, PCR amplification was performed using a high-fidelity enzyme. The PCR program was as follows: 94℃ pre-denaturation for 2-4 min; 94℃ denaturation for 30-40 s; 62℃ annealing for 30-40 s; 72℃ extension for 30-50 s; 33-35 cycles; 72℃ incubation for 5-10 min. PCR reaction system and reaction conditions: Table 2 composition Manufacturer volume 2 × Phanta® Max Master Mix Vazyme 25 μL Primer Etr5 Sangon 1 μL Primer Etr3 Sangon 1 μL Plasmid Self-owned 1 μL <![CDATA[ddH2O]]> 22 μL The PCR products amplified in the above steps were separated by 1%-1.5% agarose gel electrophoresis. Then, the gel was excised and recovered using a gel extraction kit (Vazyme FastPure Gel DNA Extraction Mini Kit, model: DC301-01) to obtain gene fragments of transcription factors containing restriction enzyme sites. The gene fragments and the entry vector pENTR-D-TOPO (purchased from Thermo Fisher, catalog number K240020) were then digested with NotI and AscI, respectively. Finally, the gene fragments were ligated into the pENTR-D-TOPO vector.

[0020] Then, the LR reaction was performed using the Gateway vector system (purchased from Invitrogen). The CDS fragments of the NtMYC2 and NtADC1 genes were ligated into the plant expression vectors pBin19-attR-HA (nucleotide sequence shown in SEQ ID NO.15) and pMDC-attR-Flag (nucleotide sequence shown in SEQ ID NO.16), respectively. The LR reaction products were then transformed into competent Escherichia coli DH5α (Sangon). Colony PCR was performed for identification, and the overexpression vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag plasmids were extracted for later use (Vazyme FastPure PlasmidMini Kit, model: DC201-01).

[0021] LR reaction system and reaction conditions: Table 3 composition Manufacturer volume pENTR-D-TOPO, an introductory carrier for targeted fragments Invitrogen 10-15 μL pBin19-attR-HA or pMDC-attR-Flag vector Self-owned 1-2 μL 1×TE Buffer Sangon 2-3 μL LR Clonase™ Invitrogen 2 μL Reaction conditions: 25~28℃

[0022] 3. Obtaining genetically modified tobacco plants The *E. coli* plasmids obtained above, the overexpression vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag, were transformed into *Agrobacterium* via heat shock, and then infected into tobacco leaves using the leaf disc method. The specific steps are as follows: (1) Agrobacterium expressed by the transformation vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag were streaked on YEB solid medium containing kanamycin and rifampicin, respectively, and cultured at 28°C for 2-3 days. Single-clone Agrobacterium colonies were inoculated into 5-8 ml of YEB liquid medium containing kanamycin and rifampicin by pipetting, and then placed in a shaker at 28°C and 200 rpm for 2-3 days. The culture was then transferred to 50-80 ml of YEB liquid medium containing kanamycin and rifampicin and cultured overnight. The next day, the 50-80 ml of YEB liquid medium was centrifuged at 800 rpm for 10 min and resuspended in 40-50 ml of fresh YEB liquid medium for later use.

[0023] (2) Select leaves of TN90 tobacco variety that have grown for 60-80 days and cut them into pieces of about 1 cm. 2 Small leaflets were prepared and immersed in 40-50 ml of YEB liquid suspension for 5-7 min. Leaves infected with Agrobacterium tumefaciens pBin19-NtMYC2-HA were then transferred to MS solid medium containing kanamycin, cephalosporins, and 6-BA. Leaves infected with Agrobacterium tumefaciens pMDC-NtADC1-Flag were also transferred to MS solid medium containing kanamycin, cephalosporins, and 6-BA. The plants were cultured in a greenhouse at 23°C with a photoperiod of 14 h light / 10 h dark for 2-3 months. After the infected leaves produced regenerated seedlings, the seedlings were transferred to 1 / 2 MS solid medium containing only cephalosporins and cultured in the same greenhouse for another 1-2 months to obtain T0 generation transgenic tobacco plants overexpressing NtMYC2 and NtADC1. Figure 1 (As shown).

[0024] Example 2: Identification of transgenic plants The transgenic tobacco plants overexpressing pBin19-NtMYC2-HA and pMDC-NtADC1-Flag were cultured in a greenhouse until flowering, then self-pollinated, and T1 generation seeds were harvested. Subsequently, the tobacco seeds overexpressing NtMYC2 and NtADC1 were sown on MS medium containing kanamycin and hygromycin, respectively, and cultured until resistant seedlings emerged for transgenic plant identification.

[0025] Following the same RNA extraction method described above, leaf RNA was extracted from wild-type tobacco TN90 and transgenic tobacco plants, and reverse transcribed into cDNA. qPCR primers were designed based on the CDS sequences of NtMYC2 and NtADC1. Primer sequences are as follows: qNtMYC2-F:TTAGCTGTTTCTTCTCCTGCTTAT (SEQ ID NO.9); qNtMYC2-R: AACAAACGATTGGGTCATGGAA (SEQ ID NO. 10); qNtADC1-F:AATGGTGGTGGTGGTGGTGATG (SEQ ID NO. 11); qNtADC1-R: GCTGTGTGGGCTATCGCTCTG (SEQ ID NO. 12).

[0026] qPCR amplification was performed using qPCR enzyme (Vazyme ChamQ Universal SYBR qPCR Master Mix, model: Q711-02). The qPCR program was as follows: pre-denaturation at 94℃~96℃ for 5~6 min; denaturation at 94℃~96℃ for 20~40 s, annealing at 58℃~60℃ for 30~40 s, extension at 72℃ for 30~50 s, for 40~45 cycles.

[0027] qPCR reaction system and reaction conditions: Table 4 composition Manufacturer volume 2 × ChamQ Universal SYBR qPCR Master Mix Vazyme 12.5 μL qNtMYC2-F Sangon 1 μL qNtMYC2-R Sangon 1 μL cDNA 1 μL <![CDATA[ddH2O]]> 9.5 μL The qPCR identification results of the NtMYC2 overexpressing transgenic lines (MYC2-OE2, MYC2-OE5, MYC2-OE7) and the NtADC1 overexpressing transgenic lines (ADC1-OE1, ADC1-OE3, ADC1-OE6) are as follows: Figure 2 As shown.

[0028] Figure 2 qPCR results showed that the expression levels of NtMYC2 in the transgenic lines MYC2-OE2, MYC2-OE5, and MYC2-OE7 overexpressing NtMYC2 were all higher than those in the control group. Similarly, the expression levels of NtADC1 in the transgenic lines ADC1-OE1, ADC1-OE3, and ADC1-OE6 overexpressing NtADC1 were also higher than those in the control group. These results indicate that the three transgenic lines overexpressing NtMYC2 and the three transgenic lines overexpressing NtADC1 obtained according to this protocol are all positive plants.

[0029] Example 3: Hybrid Tobacco Breeding and Identification 1. Breeding of hybrid tobacco plants overexpressing NtMYC2 and NtADC1 Transgenic tobacco plants of generation T0, overexpressing pBin19-NtMYC2-HA and pMDC-NtADC1-Flag, were cross-pollinated during the flowering period to obtain F1 generation hybrid seeds.

[0030] 2. Identification of hybrid tobacco plants overexpressing NtMYC2 and NtADC1 Seeds of hybrid materials were sown on MS medium containing kanamycin and hygromycin and cultured. After resistant seedlings emerged, transgenic positive plants were identified using the transgenic plant identification method described above.

[0031] The qPCR identification analysis results of hybrid tobacco lines (Hyb-1, Hyb-2, Hyb-3) overexpressing NtMYC2 and NtADC1 are as follows: Figure 3 As shown in the figure. qPCR results showed that the expression levels of NtMYC2 and NtADC1 in the hybrid tobacco lines Hyb-1, Hyb-2, and Hyb-3 were all higher than those in the control group. These results indicate that the three hybrid tobacco lines obtained according to this protocol are all positive lines.

[0032] Example 4: Nicotine content in tobacco plants 1. Cultivation and sample collection of tobacco plants Using the aforementioned method, F1 hybrid seeds overexpressing pBin19-NtMYC2-HA and pMDC-NtADC1-Flag were sown on MS medium containing kanamycin and hygromycin and cultured. Tobacco seeds overexpressing NtMYC2 were sown on MS medium containing kanamycin and cultured, while tobacco seeds overexpressing NtADC1 were sown on MS medium containing hygromycin and cultured. After the resistant seedlings emerged, they were transplanted into flowerpots and cultured in a greenhouse. Simultaneously, wild-type tobacco was sown on antibiotic-free MS medium and cultured. After the seeds germinated, they were transplanted into flowerpots and cultured in a greenhouse.

[0033] Tobacco plants were cultivated until flowering, and the middle leaves before topping were collected. Topping was then performed, and the middle leaves after topping were collected 2 weeks later. The collected leaf materials were used for nicotine content determination.

[0034] 2. Determination of nicotine content in tobacco plants The nicotine content in the leaves of F1 generation tobacco plants and the control group was determined by gas chromatography before and two weeks after topping. The results are as follows: Figure 4 and Figure 5 As shown.

[0035] Figure 4The results showed that the nicotine content in the leaves of the F1 generation hybrid tobacco lines (Hyb-1, Hyb-2, Hyb-3) before topping was about 190% higher than that of the control group, while the nicotine content in the leaves of the tobacco lines overexpressing NtMYC2 was about 40% higher than that of the control group, and the nicotine content in the leaves of the tobacco lines overexpressing NtADC1 was about 15% higher than that of the control group.

[0036] Figure 5 The results showed that the nicotine content in the leaves of the F1 generation hybrid tobacco lines (Hyb-1, Hyb-2, Hyb-3) after topping was about 210% higher than that of the control group, while the nicotine content in the leaves of the tobacco lines overexpressing NtMYC2 was about 35% higher than that of the control group, and the nicotine content in the leaves of the tobacco lines overexpressing NtADC1 was about 5% higher than that of the control group.

[0037] To more intuitively demonstrate synergistic effects, the list is shown below: Table 5 Group Pre-nicotine dosage (mg / g) Nicotine levels after capping (mg / g) wild type 10.3±0.8 22.1±1.2 Dual gene co-expression 23.6±2.3** 36.8±3.1** **p<0.01 vs wild type; The above results indicate that co-expression of NtMYC2 and NtADC1 in tobacco leaves can increase the nicotine content by about 2 times, which is significantly higher than the increase in nicotine content in leaves overexpressed by either NtMYC2 or NtADC1 alone.

[0038] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Clearly, those skilled in the art can make various alterations and variations to the invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of equivalents of the invention, the invention is also intended to include these modifications and variations.

Claims

1. A method for enhancing the nicotine synthesis level in tobacco, characterized in that, The method includes: simultaneously overexpressing the arginine decarboxylase gene NtADC1 and the transcription factor gene NtMYC2 in tobacco plants; the nucleotide sequence of the NtADC1 gene is shown in SEQ ID NO:13, and the nucleotide sequence of the NtMYC2 gene is shown in SEQ ID NO:

14.

2. The method according to claim 1, characterized in that, The method specifically includes: Construct expression vectors for the NtADC1 gene and the NtMYC2 gene; The expression vectors were transformed into Agrobacterium and co-expressed plants were obtained through hybridization.

3. The method according to claim 2, characterized in that, The method for preparing the expression vector of the NtADC1 gene includes: The NtADC1 gene was inserted into the NotI and AscI double restriction sites of pENTR-D-TOPO to obtain the pENTR-D-TOPO-NtADC1 vector. The pENTR-D-TOPO-NtADC1 vector was then linked to the CDS fragment of the NtADC1 gene via a Gateway to obtain the pMDC-attR-Flag vector.

4. The method according to claim 2, characterized in that, The expression of the NtMYC2 gene Methods for preparing the carrier include: The NtMYC2 gene was inserted into the NotI and AscI double restriction sites of pENTR-D-TOPO to obtain the pENTR-D-TOPO-NtMYC2 vector; The pENTR-D-TOPO-NtMYC2 vector was then used to ligate the CDS fragment of the NtMYC2 gene into the plant expression vector pBin19-attR-HA via Gateway, thus obtaining the pBin19-NtMYC2-HA vector.

5. An expression vector combination, characterized in that, Include: The pMDC-attR-Flag vector was constructed by ligating the gene shown in SEQ ID NO:

13. pMDC-NtADC1-Flag carrier, The gene shown in SEQ ID NO:14 was constructed by ligating the pBin19-attR-HA vector. pBin19-NtMYC2-HA vector.

6. An engineered bacterium containing the expression vector combination of claim 5.

7. A tobacco cultivation system, characterized in that, Include: An expression cassette containing the NtADC1 gene shown in SEQ ID NO:13; An expression cassette containing the NtMYC2 gene shown in SEQ ID NO:14; The expression box is operatively connected to a plant promoter.

Images