Application of FST gene inhibitor in preparation of medicine for treating ovulation dysfunction

By constructing a high expression model of the FST gene and developing inhibitors, the problem of the lack of effective treatment for ovulation dysfunction in existing technologies has been solved, providing a basis for early screening and treatment, offering new treatment strategies for clinical practice, and significantly improving treatment success rates and reproductive health.

CN120860209APending Publication Date: 2025-10-31FIRST PEOPLES HOSPITAL OF YUNNAN PROVINCE +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510610364.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

Current technologies lack targeted molecular targets, resulting in limited therapeutic effects on ovulation dysfunction (OD). Furthermore, existing drugs have limited direct therapeutic effects on ovulation disorders caused by high FST levels, and there is a lack of effective FST-suppressing treatments.

Method used

We constructed a recombinant AAV2/6 vector plasmid pAAV2/6-CMV-ZsGreen and created a high-expression model of the FST gene by injecting the recombinant virus into undeveloped monkey follicles. We then used siRNA, miRNA, or antisense nucleotides to inhibit FST gene expression and promote the synthesis of mucin-type O-glycans and lysosomal pathways, aiming to develop FST inhibitors as therapeutic drugs.

Benefits of technology

The relationship between FST gene expression level and ovulation disorders has been clarified, providing a basis for early screening and treatment, significantly improving the treatment success rate, restoring ovarian function by inhibiting FST expression, and improving reproductive health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120860209A_ABST
    Figure CN120860209A_ABST
Patent Text Reader

Abstract

The invention relates to application of a gene inhibitor in preparation of a medicine for treating ovulation dysfunction, and belongs to the field of biomedicine.The FST content in serum of a healthy person and an OD patient is compared, it is found that the FST content in serum of the OD patient is far higher than that in serum of the healthy person, and then it is obtained that the FST content can be used as the basis for judging that the patient suffers from ovulation dysfunction. Therefore, early intervention and treatment can be carried out on patients. According to the invention, the FST high-expression monkey model is successfully constructed, and the pathogenic effect of FST high expression on the OD pathogenesis process is obtained through research of the FST high-expression monkey model; the invention further designs specific shRNA (short hairpin ribonucleic acid) to successfully inhibit the expression of FST, and after the expression of FST is inhibited, the ovarian structure of the test monkey tends to be healthy, the follicular development is normal, and the ovulation regularity is recovered, and the results show that the inhibition of the FST gene has a remarkable promotion effect on the ovarian function.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically, it relates to the application of FST gene inhibitors in the preparation of drugs for treating ovulation disorders. Background Technology

[0002] Infertility is a growing global problem, affecting nearly 20% of couples. More than half of infertility cases are attributed to female reproductive disorders, with the majority related to ovulatory dysfunction (OD) (Gosden, 2013). Ovulatory dysfunction is a leading cause of female infertility, characterized by interrupted ovulation, such as anovulation, irregular menstrual cycles, and impaired follicular development. According to the World Health Organization, ovulatory disorders such as polycystic ovary syndrome (PCOS) alone affect more than 116 million women worldwide. This syndrome places a heavy burden on women's reproductive health and presents significant medical and social challenges. To date, no universally effective molecular markers or therapeutic targets have been identified for OD, highlighting the urgent need for comprehensive research into its etiology and underlying mechanisms.

[0003] Current treatments for ovulation disorders (OD) primarily focus on symptom control, typically including hormone replacement therapy, ovulation-inducing drugs, and lifestyle interventions. While these methods are effective for some patients, their efficacy is low and they often have numerous side effects due to the lack of targeted molecular targets. Furthermore, existing drugs have limited direct therapeutic effects on ovulation disorders caused by high FST levels, and no suppressive treatments targeting FST have been reported. Summary of the Invention

[0004] Regarding the issues raised in the background section, existing research has not clarified the role of FST inhibition in the treatment of ovarian dysfunction (OD). The inventors have clinically observed that patients with OD often have abnormally elevated FST levels. Current treatments for OD lack specificity and cannot effectively address ovarian dysfunction caused by FST overexpression. The FST gene, as a potential target, has not yet been thoroughly investigated. In existing technologies, FST, as a key regulatory factor, has not fully played its role in follicular development and ovulation. To verify the relationship between FST gene overexpression and ovarian dysfunction and to explore new strategies for OD treatment based on FST gene regulation, this invention first constructed a recombinant AAV2 / 6 vector plasmid pAAV2 / 6-CMV-ZsGreen. Then, 293T cells were transiently transfected with the recombinant pAAV2 / 6-CMV-ZsGreen virus, adenovirus helper plasmid pHelper, and AAV helper plasmid pAAV-RC. The recombinant virus was then injected into undeveloped monkey follicles, successfully constructing a monkey model with high FST gene expression. Studies on this model showed that dysregulation of mucin-type O-glycan biosynthesis and lysosomal pathways were disrupted. FST pathways are an important cause of ovulation disorders. GO and KEGG pathway analysis showed that under high FST expression, mucin O-glucan synthesis and lysosomal pathways were significantly downregulated in the FST overexpression group. This indicates that by promoting mucin O-glucan synthesis and lysosomal pathways, FST gene expression can be inhibited, thus playing a therapeutic role in ovulation disorders.

[0005] This invention provides the application of FST gene inhibitors in the preparation of drugs for treating ovulation disorders.

[0006] Furthermore, the inhibitor is a heterologous siRNA molecule, miRNA molecule, or antisense nucleotide that interferes with FST gene expression and processing.

[0007] Furthermore, the FST gene inhibitor includes a lysosomal pathway promoter and a mucin-type O-glycan synthesis promoter.

[0008] This invention also provides the application of FST as a target gene in the treatment of ovarian dysfunction.

[0009] This invention also provides a method for constructing a monkey model with high FST expression. The method involves transiently transfecting 293T cells with the recombinant AAV2 / 6 vector plasmid pAAV2 / 6-CMV-ZsGreen, the adenovirus helper plasmid pHelper, and the AAV helper plasmid pAAV-RC to obtain a viral injection solution. This viral injection solution is then injected orally into both ovaries of the monkey. The recombinant AAV2 / 6 vector plasmid has the following characteristics: Figure 2 As shown.

[0010] The method for constructing a monkey model with FST overexpression provided by this invention includes the following steps:

[0011] S1, FST foLListatin [Macaca fascicuLaris (crab-eating macaque)] was synthesized in vitro, with the number XM_005556882.2, a coding region of 1035bp, GC=53, the sequence was downloaded and constructed;

[0012] S2, the in vitro synthesized FST sequence target is inserted into the pAAV2 / 6-CMV-ZsGreen vector to generate adeno-associated virus;

[0013] S3, construct recombinant AAV2 / 6 adeno-associated virus: pAAV2 / 6-CMV-ZsGreen, adenovirus helper plasmid pHelper and AAV helper plasmid pAAV-RC transiently transfected into 293T cells;

[0014] S4, using universal SYBR Green (DNA fluorescent dye) and specific primers, the viral titer was determined by real-time PCR, and the titer of the overexpression vector pAAV2 / 6-CMV.FST was identified as 1.3 × 10⁻⁶. 13 vg / mL; The specific primer sequences are: F:5′-CGGCCTCAGTGAGCGA-3′R:5′-AGGAACCCCTAGTGATG-3′;

[0015] S5 involves administering the virus after the monkey's menstruation begins, but before the ovarian follicles have developed.

[0016] This invention also provides the application of an FST gene expression level kit in the detection of ovulation disorders.

[0017] The beneficial effects of this invention are:

[0018] (1) This invention successfully constructed a monkey model with high expression of the FST gene for the first time using the recombinant AAV2 / 6 vector plasmid pAAV2 / 6-CMV-ZsGreen. After FST virus injection into the ovary,

[0019] (2) The method of this invention clarifies the relationship between FST gene expression level and ovulation disorders, providing a basis for early ovulation disorder screening based on FST expression level and for early clinical identification of high-risk groups for ovulation disorders. This allows for earlier intervention and treatment, significantly improving the success rate of treatment and preventing more serious fertility problems caused by ovulation disorders.

[0020] (3) The method of the present invention provides a basis for treating ovulation disorders by inhibiting FST expression and provides a basis for using FST inhibitors as drugs for treating ovulation disorders.

[0021] (4) The method of the present invention shows that under FST high expression, mucin O-glucan synthesis and lysosomal pathway are both significantly downregulated in the FST overexpression group, which provides a basis for using lysosomal pathway promoters and mucin O-glucan synthesis promoters as drugs to inhibit FST expression.

[0022] (5) The method of the present invention shows that FST can serve as a potential biomarker for ovulation disorders, providing a convenient and efficient screening method for clinical use, helping to identify problems early and take timely treatment measures, thereby improving patients' reproductive health. Attached Figure Description

[0023] Figure 1 It is a comparison of age and serum FST levels between patients with ovulation disorders and healthy individuals;

[0024] Figure 2 This refers to the detection of recombinant virus sequences in Embodiment 2 of the present invention.

[0025] Figure 3 These are images of the monkey ovary injection process in Embodiment 2 of the present invention;

[0026] Figure 4 This is a comparison image of FST fluorescence in the ovaries of the monkey model with high FST expression in Example 2 of this invention and the control group;

[0027] Figure 5 This is a hematoxylin / eosin staining image of the ovary from Example 2 of the present invention;

[0028] Figure 6 This is a map of differentially expressed genes and related pathways after FST high expression in Example 3 of the present invention;

[0029] Figure 7 This is the gene ontology (GO) pathway diagram of differentially expressed genes after FST high expression in Example 3 of the present invention;

[0030] Figure 8 This is a comparison of the FST level detection results between the experimental group and the control group in Example 4 of the present invention;

[0031] Figure 9 This refers to the ovarian development status of the experimental group in Example 4 of this invention;

[0032] Figure 10 This is a comparison of serum estradiol levels in the experimental and control groups of monkeys in Example 4 of the present invention;

[0033] Figure 11 This is a comparison of serum progesterone levels in the experimental and control groups of monkeys in Example 4 of the present invention. Detailed Implementation

[0034] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are all within the scope of protection of this invention.

[0035] Example 1

[0036] Early screening for ovulation disorders is performed by measuring the expression of FST mRNA in the patient's blood or its concentration in serum.

[0037] The inventors of this invention discovered in clinical practice that the expression level of the FST gene was significantly increased in patients with ovulation disorders, and the serum FST level was extremely significantly increased compared with the normal control group (p<0.0001). See details... Figure 1 ( Figure 1 Figure A shows the age comparison between the normal group and the OD group, and Figure B shows the serum follicle-stressor (FST) content. Therefore, it is believed that the FST gene is a very important biomarker in the early occurrence of ovulation abnormalities, and FST is a reliable indicator for early screening and diagnosis of OD.

[0038] Furthermore, existing FST expression level detection technologies can be used to detect FST expression levels. By measuring the mRNA expression of FST in a patient's blood or the concentration in their serum, early screening can be performed, enabling timely detection and treatment.

[0039] Detection of FST expression levels:

[0040] (1) Early screening of FST expression levels in blood by RT-qPCR

[0041] Total RNA was extracted from blood, and mRNA was reverse transcribed into cDNA. qPCR reactions were performed on a QuantStudio 7 using 20 μL of qPCR per reaction, with 500 nM of primer, 2 μL of cDNA, and 10 μL of 2×SYBR Green per primer. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene to normalize the amount of cDNA in each qPCR reaction. The relative mRNA expression level of FST was calculated using the 2-ΔΔCT method.

[0042] (2) ELISA method to measure FST level in patient's blood

[0043] Serum follicle-stimulating hormone (FSH) was measured using an ELISA method. 40 μL of sample was added to each designated well, followed by 10 μL of biotin-labeled anti-FST antibody. After incubation and washing, the wells were incubated with 100 μL of the chromogenic stock solution at 37°C for 10 minutes. The reaction was terminated with 50 μL of stop solution, and the absorbance was measured at 450 nm. The OD values ​​of the samples were fitted to a standard curve equation to determine the FSH concentration.

[0044] When the FST level in a patient's serum is greater than 100 ng / ml, it can be preliminarily determined that the patient has ovulation disorder.

[0045] Example 2

[0046] Rodents are widely used as model organisms for disease research. However, due to significant differences in reproductive cycles and characteristics between rodents and primates, rodent models have limitations in simulating human reproductive diseases and abnormalities. Furthermore, experimental results for certain viruses in rodent models differ considerably from those in primates. In contrast, cynomolgus monkeys, as non-human primate models, are highly similar to humans genetically and physiologically; their ovarian morphology, menstrual cycle, and sex hormone secretion patterns are very similar to those of humans. Therefore, cynomolgus monkeys can serve as a promising model organism for studying the role of fibrinogen (FST) in dysplasia of the kidney (OD). However, the successful construction of a monkey model with high FST expression has not yet been reported domestically or internationally. This embodiment provides the construction of a monkey model with FST overexpression, including the following steps:

[0047] (1) Extraction of total RNA from monkey blood

[0048] First, mix fresh monkey blood with an equal volume of 1xBuffer ERL (e.g., 1 mL blood to 1 mL 1xBuffer ERL), and incubate on ice for 15 minutes, mixing twice during incubation. The solution is considered lysed when it becomes translucent and no longer appears dark red. If the hematocrit or ECR of the blood sample is elevated, the incubation time can be extended to 20 minutes. Next, centrifuge at 450xg for 10 minutes at 4°C, collect the white blood cells, and discard the supernatant. Then, add twice the original blood volume of 1xBuffer ERL to resuspend and wash the white blood cells, followed by another centrifugation at 450xg for 10 minutes at 4°C, collecting the white blood cells and discarding the supernatant. If red blood cells are still present in the white blood cells at this point, repeat the washing steps until no obvious red blood cell clumps appear. Resuspend the white blood cells in 100 μL of DEPC water and perform multiple pipetting and shaking to ensure thorough mixing. Visible cell clumps may result in low RNA extraction efficiency. Then, add MRC Lysis Buffer and β-mercaptoethanol, and vortex for 1 minute. The sample can be stored below -70°C. β-mercaptoethanol is crucial for inactivating endogenous RNase; add it proportionally, 20 μL of β-mercaptoethanol per 1 mL of MRC Lysis Buffer. Add an equal volume of 70% ethanol and vortex to mix. If precipitation occurs in the mixture, it must be repeatedly pipetted to improve recovery efficiency. Place the RNA mini column into a new 2mL collection tube. Transfer the mixture into the column, no more than 800μL at a time, and centrifuge at 10,000xg for 30 seconds at room temperature, discarding the filtrate. Gently mix the filtrate and add it to the center of the column. Incubate at room temperature for 15 minutes, then add 600μL of RNA Wash Buffer I, incubate at room temperature for 5 minutes, and finally centrifuge. Next, place the column into a new 2mL collection tube, add 500μL of RNA Wash Buffer II, centrifuge at 10,000xg for 40 seconds, and discard the filtrate. Repeat this step, adding another 500μL of RNA Wash Buffer II and centrifuging again. Finally, centrifuge at maximum speed for 2 minutes to dry the column, transfer it to a new 1.5mL centrifuge tube, add 30-50μL of DEPC water, and centrifuge at maximum speed for 2 minutes to obtain total RNA.

[0049] (2) Obtaining FST gene cDNA

[0050] Searching for FST foLListatin [Macaca fascicuLaris (crab-eatingmacaque)] on NCBI revealed the longest transcript, XM_005556882.2, with a coding region of 1035 bp and a GC ratio of 53%. The sequence was downloaded, and primers were designed and constructed. Primer sequences: FST-F: CCCAGGATGGTCCGCGCAAGGCACCAG, FST-R: CTTGTAGAGAGTTTACCACTCTAGAAT. PCR was then performed using ApexHF HSDNA polymerase premix-CL. The PCR system consisted of 10 μL ApexHF HSDNA polymerase premix, 6 μL H2O, 1 μL primer FST-F, 1 μL primer FST-R, and 2 μL cDNA, yielding the FST sequence.

[0051] The PCR procedure is as follows:

[0052]

[0053] (3) Insert the FST gene into the recombinant vector pAAV2 / 6-CMV-ZsGreen

[0054] First, the FST gene obtained in the previous step was inserted into the recombinant vector pAAV2 / 6-CMV-ZsGreen (Miaoling Plasmid Platform). pAAV2 / 6-CMV-ZsGreen contains a ZsGreen reporter gene driven by the CMV promoter and an AAV packaging sequence. The FST gene and pAAV2 / 6-CMV-ZsGreen vector were double-digested with BamHI and XhoI restriction enzymes, and the vector DNA was purified. Next, the FST gene and linearized vector DNA were ligated using T4 DNA ligase at 16°C overnight. The ligation product was then transformed into *E. coli* DH5α and screened using LB medium containing ampicillin. Finally, single colonies were picked and sequenced to verify whether the inserted FST gene sequence matched the expected sequence. The successfully constructed recombinant vector was amplified in *E. coli*, and plasmid DNA was extracted and stored at -20°C for subsequent experiments. The structure of the recombinant vector pAAV2 / 6-CMV-ZsGreen is shown in the attached figure. Figure 2 .

[0055] (4) Packaging and detection of FST adeno-associated virus vector (AAV) overexpression

[0056] The steps for co-transfecting AAV-293 cells with the AAV vector and the helper packaging vector plasmid are as follows:

[0057] First, the day before co-transfection, seed cells into culture plates according to standard 293 cell passage procedures, ensuring cells reach approximately 80% confluence by the next day. Next, before transfection, replace the culture medium in the wells with fresh cell culture medium. Prepare the transfection solution. For each well, take a sterile EP tube, add 16 μg of DNA and an appropriate amount of antibiotic-free and glutamine-free DMEM solution, and gently mix with a pipette to a final volume of 1000 μL. Then, take another sterile EP tube, add 952 μL of Opti-MEM solution, and then add 48 μL of Lipofiter. TM Gently pipette to mix, bringing the final volume to 1000 μL. Incubate at room temperature for 5 minutes. Add the DNA solution to Lipofiter. TM When mixing the solutions, gently pipette to mix, ensuring no shaking or centrifugation occurs. Incubate at room temperature for 20 minutes. Add 1000 μL of Lipofiter... TM The DNA mixture is slowly added to each well, rotating to distribute the solution evenly and gently mixing from side to side and up and down several times. After culturing the cells in a cell culture incubator for 6 hours, the Lipofiter-containing cells are removed. TM The DNA culture medium was replaced with fresh complete medium containing 10% fetal bovine serum (FBS), and cultured for further cell growth and virus expression. Forty-eight hours post-transfection, the viral supernatant was collected, filtered, and concentrated to obtain the virus.

[0058] (4) Virus titer detection

[0059] The specific real-time PCR reaction steps are as follows: First, prepare the required PCR reaction mixture, using the universal SYBR Green real-time PCR system, and add 10µm of specific primers. The primer sequences used are as follows: F: 5′-CGGCCTCAGTGAGCGA-3′ R: 5′-AGGAACCCCTAGTGATG-3′ These primers are designed to specifically amplify a specific sequence of the vector genome. The reaction conditions include an initial denaturation temperature of 95℃, followed by 40 cycles of denaturation (95℃, 15 seconds), annealing (60℃, 20 seconds), and amplification (72℃, 30 seconds), and finally, melting curve analysis to ensure specific amplification. The real-time PCR instrument records the fluorescence signal of each cycle in real time, thereby calculating the initial copy number of the PCR product. This method allows for accurate determination of the viral vector titer, ensuring that the quality and quantity of the virus meet experimental requirements. For the pAAV2 / 6-CMV.FST vector, the measured viral titer was 1.3 × 10⁻⁶. 13 The vg / mL indicates that the vector has a high titer during the screening process, which is helpful for subsequent gene transduction experiments.

[0060] (5) Ovarian in situ viral injection for FST overexpression experiment.

[0061] Healthy adult cynomolgus monkeys were selected and injected with the virus on the 5th day after the start of their menstrual cycle. At this time, the ovarian follicles have not yet developed, the ovarian matrix is ​​relatively firm, which is suitable for the injection needle to be inserted and is not easy to cause the leakage of other ovarian tissue fluid.

[0062] Before the injection procedure, the monkey was anesthetized with an intramuscular injection of ketamine at a dose of 0.3 ml / kg of body weight, and the patient waited 3-5 minutes. After anesthesia, the hair on the midline of the abdomen was shaved off with a razor. The experimental animal was placed face up on the operating table with its limbs spread apart by ropes. The abdomen was disinfected with iodine solution and 75% ethanol. A small incision of about 2 mm was made on the side of the monkey's umbilicus with a scalpel, and a pneumoperitoneum needle was inserted through the incision. A cannula was inserted, inflated, and the skin was separated from the muscle, visceral fat, and other tissues. A small incision of about 6 mm was made above the umbilicus, and the cannula was then inserted. The inner core of the cannula was pulled out, and a laparoscope was inserted. The appropriate angle was found, and a monitor was connected for the operator's observation. Surgical forceps were inserted into the abdominal cavity through the side incision to locate the ovaries and determine their position relative to the uterus. Grasping forceps were inserted into the abdominal cavity from an appropriate position (usually between the two ovaries, above the uterus) to fix the ovaries, at which point the ovaries could be located. The ointment was then applied to the shallower or thicker areas. Another person inserted a micro-injection needle containing the virus through the abdominal wall into each ovary, injecting 50 microliters of the viral fluid. The two individuals worked together to inject the measured amount of viral fluid into the ovary. After the fluid was withdrawn, it was left in place for a period of time to prevent leakage upon needle removal. (Careful not to insert the needle tip excessively into the ovary to avoid causing excessive damage to the monkey). The other ovary was injected using the same procedure, ensuring the wound was not too large. After injection, the wound was treated, sutured, and disinfected. Post-operatively, the experimental animals were given an intramuscular injection of 800,000 IU of penicillin to prevent post-operative infection. The behavior and wound condition of the cynomolgus monkeys were recorded 3 days post-operatively. Figure 3 ).

[0063] (6) Detection of FST gene expression level

[0064] We observed that the green fluorescence in the experimental group was significantly higher than that in the control group. The expression level of FST could be determined based on the fluorescence intensity. The FST expression level in the ovaries of the experimental group was significantly higher than that in the control group. Simultaneously, monkeys in the FST overexpression group exhibited significant ovulation abnormalities, including polycystic ovarian structure, menstrual cycle disorders, and disordered granulosa cell arrangement, symptoms consistent with clinical manifestations. See the appendix for details. Figure 4 and Figure 5 ( Figure 4 E represents the FST fluorescence image of the ovaries in the control group. Figure 4 F is the fluorescence spectrum of FST overexpression. Figure 5(Image of ovarian HE staining). This demonstrates the pathogenic role of high FST expression in the development of ovarian dysfunction (OD). This provides a basis for assessing ovarian dysfunction through FST expression levels. Clinically, FST expression levels can be used for early screening of ovulation disorders, allowing for timely intervention and treatment, which significantly improves treatment success rates and prevents more serious fertility problems caused by ovulation disorders.

[0065] Example 3

[0066] Further research on the FST-high expression model in cynomolgus monkeys

[0067] RNA-seq sequencing of monkey ovarian tissue revealed that downregulated CYP3A7, CYP19A1, and CYP3A5, which encode members of the cytochrome P450 superfamily of enzymes, play important roles in the steroid hormone biosynthesis pathway. (See attached figure for details.) Figure 6

[0068] Through append Figure 6 It can be seen that the occurrence of OD is strongly correlated with the encoding of cytochrome P450 enzyme superfamily members and steroid hormone biosynthesis pathways.

[0069] Meanwhile, dysregulation of mucin-type O-glycan biosynthesis and dysregulation of lysosomal pathways may be important causes of OD (oxidation of glycoproteins). Figure 7 ).

[0070] The transcriptomic characteristics of cynomolgus monkey ovaries were analyzed using RNA-seq. KEGG pathway analysis showed that mucin-type O-glucan synthesis and lysosomal pathways were significantly downregulated in the FST overexpression group.

[0071] Downregulation of the mucin-type O-glycan biosynthesis pathway may negatively impact O-glycosylation of the low-density lipoprotein receptor (LDLR), while stable LDLR expression is crucial for LDL-C entry into cells, and lysosomes degrade LDL-C into cholesterol for cellular use. Inhibition of these two pathways makes it difficult for cells to absorb and break down LDL-C, leading to abnormal LDL-C metabolism. Simultaneously, dyslipidemia is one of the most common characteristics; women with OD have higher levels of triglycerides and LDL-C than normal women; regardless of BMI, women with OD also have higher levels of LDL-C and non-HDL cholesterol. FST overexpression, leading to dysregulation of mucin-type O-glycan biosynthesis and lysosomal pathways, may be an important cause of OD.

[0072] Example 4

[0073] FST suppression was performed on cynomolgus monkeys with high FST expression in Example 2.

[0074] Suppressing the FST gene using a lentiviral vector involves the following steps: First, a specific shRNA targeting the FST gene, GAGGAGGAGGAGGAGGAGG, is designed and synthesized, ensuring its specificity and avoiding non-specific binding to other genes. The synthesized shRNA sequence is then inserted into the lentiviral vector pLKO.1.

[0075] Next, the recombinant pLKO.1 vector, along with the packaging plasmids pMD2.G and psPAX2, was co-transfected into HEK293T cells. The day before co-transfection, cells were seeded into culture plates following standard 293 cell passage procedures, ensuring the cells reached approximately 80% confluence by the next day. Before transfection, the culture medium in the wells was replaced with fresh cell culture medium, approximately 1 mL in volume. Transfection solutions were prepared. In each well, a sterile EP tube was taken, and 16 μg of DNA and an appropriate amount of antibiotic-free and glutamine-free DMEM solution were added. The mixture was gently pipetted to a final volume of 1000 μL. Next, another sterile EP tube was taken, and 952 μL of Opti-MEM solution was added, followed by 48 μL of Lipofiter. TM Gently pipette to mix, bringing the final volume to 1000 μL. Incubate at room temperature for 5 minutes. Add the DNA solution to Lipofiter. TM When mixing the solutions, gently pipette to mix, ensuring no shaking or centrifugation occurs. Incubate at room temperature for 20 minutes. Add 1000 μL of Lipofiter... TM The DNA mixture is slowly added to each well, rotating to distribute the solution evenly and gently mixing from side to side and up and down several times. After culturing the cells in a cell culture incubator for 6 hours, the Lipofiter-containing cells are removed. TM The culture medium for shRNA was replaced with fresh complete medium containing 10% fetal bovine serum (FBS), and cultured for further cell growth and viral expression. Forty-eight hours post-transfection, the viral supernatant was collected, filtered, and concentrated to obtain lentiviral particles containing shRNA.

[0076] Subsequently, the same method as in Example 2 was used to inject the substance into the monkey's ovary.

[0077] Using a blank vector lentivirus as the control group and monkeys injected with lentivirus that inhibits FST gene expression (experimental group) as the comparison, serum samples were collected from both the control and experimental groups 30 days after injection for FST level analysis (results are shown in...). Figure 8The results showed that after using lentivirus to inhibit FST gene expression, the expression level of FST in the ovarian tissue of the experimental group animals decreased significantly, followed by a significant improvement in ovulation function. The menstrual cycles of the experimental group animals returned to normal, showing regular fluctuations in serum hormone levels, especially the cyclical changes in LH and FSH, and the animals exhibited normal sexual behavior and estrus. Ultrasound examination results showed that the ovarian structure of the experimental group animals was approaching healthy, and follicle development was normal. Figure 9 Ovulation regularity was restored. These results indicate that inhibition of the FST gene has a significant promoting effect on ovarian function in the experimental group animals.

[0078] Every morning, the perineum and genital skin color of the cynomolgus monkeys were observed to determine if the genital skin was red and swollen, thus indicating the presence of menstruation. The first day of menstruation was recorded as the first day of the menstrual cycle. 1.5 ml of whole blood was collected, centrifuged at 5000 rpm for 5 minutes, and the supernatant serum was used to determine the serum levels of estradiol and progesterone. Serum hormone levels of estradiol and progesterone were measured using a Roche Diagnostics Cobase 411 immunoassay analyzer (Mannheim, Germany). The results showed that after FST inhibition, the estrogen levels in the monkeys returned to levels consistent with those of normal monkeys. Figure 10 and Figure 11 This result further supports the recovery of ovarian function in experimental monkeys after FST expression was suppressed.

[0079] Following FST inhibition, estrogen levels in the experimental animals gradually returned to normal, indicating a recovery in ovarian hormone secretion function. Estrogen, as the primary female sex hormone, is crucial for maintaining a normal menstrual cycle and promoting follicle maturation. Experimental data show that FST inhibition helps regulate ovarian hormone secretion and promotes ovarian function recovery. In conclusion, the treatment method of inhibiting FST gene expression demonstrates significant therapeutic potential. This treatment strategy can not only improve ovulation disorders but also promote ovarian function recovery by restoring the menstrual cycle and regulating hormone levels, providing new treatment ideas and potential therapies for patients with ovulation disorders. In the future, further optimization of FST-targeted therapy regimens may bring significant breakthroughs in the clinical treatment of related diseases.

[0080] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

Claims

1. Application of FST gene inhibitors in the preparation of drugs for treating ovulation disorders.

2. The application according to claim 1, characterized in that, The inhibitors mentioned are heterologous siRNA molecules, miRNA molecules, or antisense nucleotides that interfere with the expression and processing of the FST gene.

3. The application of FST gene inhibitors in the preparation of drugs for treating ovulation disorders, characterized in that, The FST gene inhibitors include lysosomal pathway promoters and mucin-type O-glycan synthesis promoters.

4. Application of FST as a target gene in the treatment of ovarian dysfunction.

5. A method for constructing a monkey model with high FST expression, characterized in that, Transiently transfecting 293T cells with the recombinant AAV2 / 6 vector plasmid pAAV2 / 6-CMV-ZsGreen, adenovirus helper plasmid pHelper, and AAV helper plasmid pAAV-RC yielded a viral injection solution, which was then injected orally into both ovaries of monkeys. The characteristics of the recombinant AAV2 / 6 vector plasmid are shown in Figure 2.

6. A method for constructing a monkey model with FST overexpression, characterized in that, Includes the following steps: S1, FST foLListatin [Macaca fascicuLaris (crab-eating macaque)] was synthesized in vitro, with the number XM_005556882.2, a coding region of 1035bp, GC=53, the sequence was downloaded and constructed; S2, the in vitro synthesized FST sequence target is inserted into the pAAV2 / 6-CMV-ZsGreen vector to generate adeno-associated virus; S3, recombinant AAV2 / 6 adeno-associated virus pAAV2 / 6-CMV-ZsGreen, adenovirus helper plasmid pHelper, and AAV helper plasmid pAAV-RC were constructed and transiently transfected into 293T cells; S4, viral titers were determined by real-time PCR using universal SYBR Green primers and specific primers, and the titer of the overexpression vector pAAV2 / 6-CMV.FST was identified as 1.3 × 10⁻⁶. 13 vg / mL; the specific primer sequences are: F: 5′-CGGCCTCAGTGAGCGA-3′ R: 5′-AGGAACCCCTAGTGATG-3′; S5 involves administering the virus after the monkey's menstruation begins, but before the ovarian follicles have developed.

7. Application of FST gene expression level kit in detecting ovulation disorders.