Bacillus velezensis, bacillus pumilus, biocontrol agent, method and application

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to bacillus velezensis, bacillus pumilus, a biocontrol agent, a method and application. The invention provides a bacillus velezensis HzR6-0, and the preservation number of the bacillus velezensis HzR6-0 is CGMCC (China General Microbiological Culture Collection Center) The bacillus velezensis HzR6-0 disclosed by the invention has a remarkable inhibition effect on pectobacterium parvovium FN20211. The invention also provides a biocontrol agent, and the result of the embodiment shows that the bacillus velezensis HzR6-0 and bacillus pumilus G15 compounded fermentation liquor and 4% kasugamycin (aqueous solution) are applied to the field for prevention and treatment, the prevention and treatment effect on the potato aerial stem rot is the best, and the prevention and treatment effect is 40.66%.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Bacillus belye, Bacillus pumilus, biocontrol agents, methods, and applications. Background Technology

[0002] Potato blackleg is caused by *Pectobacterium* spp. It is a relatively common bacterial disease in potato production. Aerial stalk rot, on the other hand, is a new disease caused by three new species of the same genus as the pathogen that causes blackleg: *P. parvum*, *P. versatile*, and *P. brasiliense*.

[0003] In recent years, due to the widespread adoption of new varieties such as Xisen 6, aerial stem rot has occurred extensively. The incidence rate ranges from 10% to 20% in mild cases to 40% to 50% in severe cases, often resulting in missing seedlings, tuber rot in the field, and tuber rot during storage, leading to significant losses. Because aerial stem rot has only become prevalent in recent years, its disease development patterns, seed potato carrier status, and effective control methods are still underdeveloped. Currently, no strains have been found that provide good control against both potato aerial stem rot and potato blackleg. Summary of the Invention

[0004] In view of this, the present invention provides a strain of Bacillus bellis, Bacillus pumilus, a biocontrol agent, a method and application. The Bacillus bellis provided by the present invention can simultaneously control potato aerial stem rot and potato black shank.

[0005] To address the aforementioned technical problems, the present invention proposes the following technical solution:

[0006] This invention provides a strain of Bacillus velezensis HzR6-0, with accession number CGMCCNo.32838.

[0007] This invention provides a biocontrol agent comprising the fermentation broth and / or resuspension of Bacillus belye HzR6-0 as described in the above technical solution.

[0008] This invention provides a compound biocontrol agent comprising Bacillus belye HzR6-0 and Bacillus pumilus G15 as described in the above technical solution, wherein the preservation number of Bacillus pumilus G15 is CGMCC No. 32839.

[0009] Preferably, the compound biocontrol agent and chemical agent are used in combination.

[0010] Preferably, the chemical agent includes kasugamycin.

[0011] Preferably, the effective viable count of Bacillus berberis HzR6-0 in the compound biocontrol agent is ≥1×10⁻⁶. 7 CFU / mL, the effective viable count of Bacillus pumilus G15 in the compound biocontrol agent is ≥1×10⁻⁶ CFU / mL. 7 CFU / mL.

[0012] This invention provides the application of Bacillus berberis HzR6-0 as described in the above-mentioned technical solution, or the biocontrol agent or compound biocontrol agent described in the above-mentioned technical solution, in the control of potato diseases and / or the increase of potato yield.

[0013] Preferably, the pathogen of the disease includes Pectobacterium spp.

[0014] Preferably, the diseases include potato blackleg and / or potato aerial stem rot.

[0015] This invention provides a method for preventing and controlling potato diseases and / or increasing potato yield, by spraying the Bacillus berberis HzR6-0 described in the above technical solution, or the biocontrol agent described in the above technical solution, or the compound biocontrol agent described in the above technical solution, onto the potato.

[0016] The beneficial effects of this invention are as follows: This invention provides a strain of Bacillus belyssus HzR6-0, which exhibits a significant inhibitory effect on Pectinobacterium valerate FN20211. In vitro tuber studies showed that after controlling FN20211 with HzR6-0, the weight of the rotten part of the potato was 0.22 ± 0.04 g, indicating a reduction in the weight of the rotten part. Potted plant efficacy tests showed that the control efficacy of Bacillus belyssus HzR6-0 against Pectinobacterium valerate FN20211 was 49.71%.

[0017] This invention also provides a compound biocontrol agent. The results of the examples show that: when the compound fermentation broth of Bacillus belye HzR6-0 and Bacillus pumilus G15 is applied in the field with 4% kasugamycin (aqueous solution) for control, the compound fermentation broth of HzR6-0 and G15 is applied twice, followed by 4% kasugamycin (aqueous solution) applied four times, the control effect on potato aerial stem rot is the best, with a control efficacy of 40.66%. Attached Figure Description

[0018] Figure 1 The images show the colony morphology and Gram staining of two biocontrol strains. A shows the colony morphology and Gram staining of Bacillus pumilus G15; B shows the colony morphology and Gram staining of Bacillus belyssus HzR6-0.

[0019] Figure 2 The screening results of biocontrol strains for inhibiting aerial stem rot are shown in Figure A, which shows the inhibitory effect of HzR6-0 on *Pectobacterium micranthum* FN20211; Figure B shows the inhibitory effect of G15 on *Pectobacterium diversicolor* FN20111; and Figure C shows the water control group.

[0020] Figure 3 A phylogenetic tree constructed based on the gyrB gene sequence of Bacillus belyssus HzR6-0;

[0021] Figure 4 Phylogenetic trees of strains FN20211 and FN20111 constructed based on the gapA gene sequence;

[0022] Figure 5 To illustrate the virulence of pectinobacter and Bacillus in potato tubers, A shows longitudinal sections of tubers inoculated with Pectinobacter spp. FN20211, Pectinobacter spp. FN20111, Bacillus belyss HzR6-0, and Bacillus pumilus G15; B shows the difference in internal decay weight of tubers under different treatments.

[0023] Figure 6 The graph shows the inhibitory effect of Bacillus belyss HzR6-0 on Bacillus pectinophilus FN20211 on potato tubers. In this graph, A shows the effect of HzR6-0 on FN20211 on detached tubers; B shows the difference in internal decay weight of tubers under different treatments. Figure 6 The representative strain of P. parvum is FN20211;

[0024] Figure 7 The pot control efficacy of Bacillus belyss HzR6-0 against Bacillus pectinophilus FN20211 is shown in Figure A, where A is a longitudinal section of potato stems under different treatments; B is an analysis of the differences in the length of internal rot in the stems under different treatments. Figure 7 The representative strain of P. parvum is FN20211;

[0025] Figure 8 The graph shows the efficacy of different biocontrol agents against potato aerial stem rot. A represents the combined fermentation broth of HzR6-0 and G15 applied in its entirety; B represents the combined fermentation broth of HzR6-0 and G15 applied three times, followed by three applications of 4% kasugamycin (AS*); C represents the combined fermentation broth of HzR6-0 and G15 applied twice, followed by four applications of 4% kasugamycin (AS*); D represents the combined fermentation broth of HzR6-0 and G15 applied once, followed by five applications of 4% kasugamycin (AS*); E represents 500 million Bacillus polymyxa KN-03 (SC); F represents 4% kasugamycin (AS*); G, H, and I are blank controls.

[0026] Figure 9 The graph shows the potato yields treated with different biocontrol agents. A: 4% kasugamycin (AS*); B: 500 million Bacillus polymyxa KN-03 (SC); C: Full application of the combined fermentation broth of HzR6-0 and G15; D: One application of the combined fermentation broth of HzR6-0 and G15 followed by five applications of 4% kasugamycin (AS*); E: Two applications of the combined fermentation broth of HzR6-0 and G15 followed by four applications of 4% kasugamycin (AS*); F: Three applications of the combined fermentation broth of HzR6-0 and G15 followed by three applications of 4% kasugamycin (AS*); G: Blank control treatment.

[0027] Figure 10 This is a phylogenetic tree of closely related species of Bacillus pumilus G15 constructed based on the maximum likelihood method.

[0028] Biological Preservation Instructions

[0029] Bacillus velezensis HzR6-0 was deposited on November 28, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNo.32838.

[0030] Bacillus pumilus G15 was deposited on November 28, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 32839. Detailed Implementation

[0031] This invention provides a strain of Bacillus velezensis HzR6-0, with accession number CGMCC No. 32838. The gyrB gene sequence of Bacillus velezensis HzR6-0 described in this invention is shown in SEQ ID No. 1.

[0032] SEQ ID No.1:CTTCACGGTGTAGGGGCGTCCGTCGTAAACGCCTTGTC。

[0033] The Bacillus belyss HzR6-0 described in this invention was screened from rhizosphere soil samples. The colonies of Bacillus belyss HzR6-0 on LB agar plates are milky white, round in shape, smooth and slightly convex, with a diameter between 1.0 and 1.5 mm, and a relatively viscous texture.

[0034] A phylogenetic tree was constructed using the Neighbor-Joining method and the gyrB sequence of Bacillus velezensis HzR6-0 to identify strain HzR6-0 as Bacillus velezensis. Bacillus velezensis HzR6-0 exhibits significant inhibitory activity against Pectinobacter granulosus FN20211, thus controlling potato aerial stem rot and potato black shank, and increasing potato yield.

[0035] This invention provides a biocontrol agent comprising the fermentation broth and / or resuspension of Bacillus belye HzR6-0 as described in the above technical solution.

[0036] As an optional implementation, the effective viable count of Bacillus belye HzR6-0 in the biocontrol agent of the present invention is ≥1×10⁻⁶. 7 CFU / mL, preferably 1×10⁻⁶. 7 CFU / mL.

[0037] As an optional embodiment, the method for preparing the resuspension includes: inoculating the *Bacillus belye* HzR6-0 into a culture medium and culturing it to obtain HzR6-0 cells; as another optional embodiment, streaking the *Bacillus belye* HzR6-0 into a culture medium for activation culture to obtain single colonies. As an optional embodiment, the present invention does not have a particular limitation on the streaking method, and conventional methods can be used. As an optional embodiment, the activation culture temperature of the present invention is 30℃~37℃, or it can be 35~37℃; in specific embodiments of the present invention, the culture temperature is 30, 33, 34, 35, 36, or 37℃. The activation culture time is 22~26h, or it can be 23~25h. In specific embodiments of the present invention, the activation culture time is 22, 23, 24, 25, or 26h. The activation culture is a static culture.

[0038] As another optional implementation, after obtaining a single colony, the present invention inoculates the single colony into a culture medium for seed culture to obtain a seed solution; the seed solution is transferred to a culture medium for further culture to obtain a culture broth; the culture broth is centrifuged to obtain HzR6-0 cells. As an optional implementation, the present invention does not have a specific limitation on the inoculation method and conventional methods can be used. As an optional implementation, the seed culture temperature is 30℃~37℃, or 35~37℃; in specific embodiments of the present invention, the seed culture temperature is 30, 32, 34, 35, 36, or 37℃. The seed culture time is 12~18h, or 12~14h; in specific embodiments of the present invention, the seed culture time is 12, 13, 14, 15, 16, 17, or 18h. The seed culture rotation speed is 190~210rpm; in specific embodiments of the present invention, the rotation speed is 190, 200, or 210rpm. The temperature for culturing the seed culture after transfer to the culture medium is 30℃~37℃, or 35~37℃; the volume of the seed culture transferred is 1%~5% of the culture medium volume. In specific embodiments of the present invention, the culturing temperature is 30, 32, 34, 35, 36 or 37℃. The OD of the culture medium is then measured. 600 The value is 0.8–1.0. The centrifugation speed is 190–210 rpm. In specific embodiments of the present invention, the centrifugation speed is 190, 200, or 210 rpm. The present invention does not impose special limitations on the centrifugation parameters of the culture medium; conventional methods can be used.

[0039] As an optional embodiment, the present invention resuspends the HzR6-0 bacteria to obtain a resuspension. As an optional embodiment, the resuspension is further complicated by washing, wherein the washing solution includes 10 mM NaCl solution or physiological saline; the resuspension solution includes 10 mM NaCl solution.

[0040] As an optional implementation, the method for preparing the fermentation broth includes:

[0041] Bacillus belye HzR6-0 was activated and cultured on LB agar plates to obtain single colonies. These single colonies were then inoculated into LB liquid medium for seed culture to obtain a seed culture. The seed culture was then inoculated into blank LB liquid medium and cultured until OD reached... 600 The value is 0.8 to 1.0, and the fermentation broth is obtained. The activation culture, seed culture, and culture parameters described in this invention have been discussed above and will not be repeated here.

[0042] This invention provides a compound biocontrol agent comprising *Bacillus belyssus* HzR6-0 and *Bacillus pumilus* G15 as described in the above technical solution. The *Bacillus pumilus* G15 described in this invention has the preservation number CGMCC No. 32839. *Bacillus pumilus* G15 was screened from rhizosphere soil samples. On LB agar plates, *Bacillus pumilus* G15 is milky white, uniformly stained, and without protrusions.

[0043] As an optional embodiment, the preparation method of the compound biocontrol agent of the present invention includes: mixing the fermentation broth and / or resuspension of *Bacillus belye* HzR6-0 with the fermentation broth and / or resuspension of *Bacillus pumilus* G15 to obtain the compound biocontrol agent. As an optional embodiment, the present invention mixes the fermentation broth of *Bacillus belye* HzR6-0 and the fermentation broth of *Bacillus pumilus* G15 at a volume ratio of 1:1 to obtain the compound biocontrol agent, which is then applied in the field. As an optional embodiment, the effective viable count of *Bacillus belye* HzR6-0 in the compound biocontrol agent of the present invention is ≥1×10⁻⁶. 7 CFU / mL, preferably 1×10⁻⁶. 7 CFU / mL; The effective viable count of Bacillus pumilus G15 in the compound biocontrol agent of this invention is ≥1×10⁻⁶. 7 CFU / mL, preferably 1×10⁻⁶. 7 CFU / mL.

[0044] As an optional implementation, the preparation methods of the resuspension of Bacillus vesiculosus HzR6-0 and the fermentation broth of Bacillus vesiculosus HzR6-0 have been discussed above and will not be repeated here.

[0045] As an optional implementation, the preparation method of the *Bacillus pumilus* G15 resuspension includes: inoculating the *Bacillus pumilus* G15 into a culture medium and culturing it to obtain G15 cells; as another optional implementation, streaking the *Bacillus pumilus* G15 into a solid culture medium for activation culture to obtain single colonies. As an optional implementation, the present invention does not have a particular limitation on the streaking method, and conventional methods can be used. As an optional implementation, the activation culture temperature of the present invention is 33℃~37℃, or it can be 35~37℃; in specific embodiments of the present invention, the culture temperature is 33, 34, 35, 36, or 37℃. The activation culture time is 22~25h, or it can be 23~24h. In specific embodiments of the present invention, the activation culture time is 22, 23, 24, 25, or 26h. The activation culture of the present invention is a static culture. The solid culture medium of the present invention includes LB solid culture medium.

[0046] As another optional implementation, the present invention inoculates the obtained single colony into a liquid culture medium for seed culture to obtain a seed solution; the seed solution is then transferred to a culture medium for further culture to obtain a culture broth; the culture broth is centrifuged to obtain G15 cells. As an optional implementation, the present invention does not have a specific limitation on the inoculation method and conventional methods can be used. As an optional implementation, the seed culture temperature is 32℃~38℃, or 36~37℃; in specific embodiments of the present invention, the seed culture temperature is 32, 33, 34, 35, 36, 37, or 38℃. The seed culture time is 12~18h, or 12~16h; in specific embodiments of the present invention, the seed culture time is 12, 13, 14, 15, 16, 17, or 18h. The seed culture rotation speed is 180~220rpm; in specific embodiments of the present invention, the rotation speed is 180, 190, 200, or 210rpm. The liquid culture medium of the present invention includes LB liquid culture medium. The seed culture is transferred to the culture medium at a temperature of 30°C to 37°C, or alternatively 35°C to 37°C; in specific embodiments of the invention, the culture temperature is 30, 32, 34, 35, 36, or 37°C. The volume of the seed culture transferred is 1% to 6% of the culture medium volume. Preferably, the culture is carried out until the OD of the culture medium reaches a certain value. 600 The value is 0.8 to 1.0. As an optional implementation, the culture rotation speed is 190 to 210 rpm; in specific embodiments of the present invention, the culture rotation speed is 190, 200, or 210 rpm.

[0047] As an optional embodiment, the present invention washes the G15 bacterial cells and then resuspends them to obtain a resuspension. As an optional embodiment, the solution used for washing and resuspension includes a 10 mM NaCl solution or physiological saline. The present invention does not have a particular limitation on the number of washes; conventional methods can be used.

[0048] As an optional implementation, the method for preparing the Bacillus pumilus G15 fermentation broth includes:

[0049] Bacillus pumilus G15 was activated and cultured on LB agar plates to obtain single colonies; these single colonies were inoculated into LB liquid medium for seed culture to obtain seed culture; the seed culture was then inoculated into LB liquid medium and cultured until OD reached. 600 The value is 0.8 to 1.0, and the fermentation broth is obtained. The activation culture, seed culture, and culture parameters described in this invention have been discussed above and will not be repeated here.

[0050] As an optional implementation, the compound biocontrol agent of the present invention can also be used in combination with chemical agents. As an optional implementation, the chemical agent of the present invention includes kasugamycin. In a specific embodiment of the present invention, the compound biocontrol agent and the chemical agent are sprayed together.

[0051] This invention provides the application of Bacillus berberis HzR6-0 or the biocontrol agent described in the above-mentioned technical solution in the control of potato diseases and / or the increase of potato yield.

[0052] As an optional embodiment, the pathogen of the disease described in this invention includes the genus *Pectobacterium* spp. As an optional embodiment, the genus *Pectobacterium* spp. includes *P. parvum*.

[0053] As an alternative implementation, the disease includes potato black shank and / or potato aerial stem rot.

[0054] As an optional implementation, the application method includes spraying the *Bacillus belye* HzR6-0 described in the above-described technical solution, or the biocontrol agent described in the above-described technical solution, or the compound biocontrol agent described in the above-described technical solution, onto the plants. As an optional implementation, the biocontrol agent of the present invention is applied in the field or in potted plants.

[0055] This invention provides a method for preventing and controlling potato diseases and / or increasing potato yield, by spraying the Bacillus berberis HzR6-0 described in the above technical solution, or the biocontrol agent described in the above technical solution, or the compound biocontrol agent described in the above technical solution, onto the potato.

[0056] As an optional implementation, when the compound biocontrol agent is applied in the field, the application rate of the compound biocontrol agent can be 1.9–2.1 L / 667 m². 2 Preferably 2L / 667m 2 The preferred time for application is during the budding stage of potato plants. The first application is made during the budding stage, and the application is performed 6 times, with an interval of 10 days between each application.

[0057] As an optional implementation, when the compound biocontrol agent is applied in the field, it is used in combination with a chemical agent, the chemical agent including kasugamycin. The kasugamycin used in this invention is preferably a 4% (w / w) aqueous solution of kasugamycin (abbreviated as 4% kasugamycin). The application rate of the compound biocontrol agent can be 1.9–2.1 L / 667 m³. 2 Preferably 2L / 667m 2The preferred application time is during the potato budding stage; the application frequency is 4-5 times. The preferred dosage of the 4% kasugamycin in this invention is 70 mL / 667 mL. 2 The preferred timing for applying the 4% kasugamycin is after the application of the compound biocontrol agent, and the number of applications is 1 to 2.

[0058] When the biocontrol agent is applied to potato potted plants, the preferred dosage of the compound biocontrol agent is 30 mL per potato plant. The application method includes spraying, and the spraying site includes the potato stem. The preferred number of applications is once, and the spraying time is approximately 30 days after the potato potted plants emerge.

[0059] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0060] Example 1

[0061] 1. Isolation and purification of Bacillus strains from rhizosphere soil

[0062] Using the soil dilution method, 10g of rhizosphere soil was weighed and added to an Erlenmeyer flask containing 90mL of sterile water. The flask was incubated at 28℃ and 200rpm for 30 minutes, after which the soil suspension was collected. 10mL of the soil suspension was added to 90mL of 85% physiological saline, and the mixture was incubated in a water bath at 80℃ for 15 minutes, followed by serial dilution to a final concentration of 10%. -3 10 -4 10 -5 100 μL of each gradient treatment was spread onto blank LB medium, with three replicates for each gradient treatment. The cultures were incubated at 37°C for 24 h. Single colonies were picked and streaked for purification. Colonies with surface wrinkles were designated as strains HzR6-0 and G15, respectively. Single colonies of strains HzR6-0 and G15 free of contaminants were prepared into seed cultures and mixed with 50% glycerol at a 1:1 volume ratio. These solutions were then stored at -80°C. (50% glycerol refers to a glycerol concentration of 50%).

[0063] The bacterial strain was streaked onto blank LB medium, and the colony color, edge, and morphological characteristics were observed under a light microscope. The bacterial suspension was stained with Gram stain, and the color and shape of the bacterial cells were observed under a light microscope. The results are shown in the figure. Figure 1 Strain G15 appears milky white on LB agar plates, with uniform staining and no raised areas (see...). Figure 1 (A) Gram-positive bacteria; strain HzR6-0 colonies on LB agar are milky white, round, smooth and slightly convex, with a diameter between 1.0 and 1.5 mm, and a relatively viscous texture. Figure 1 (B) Gram-positive bacteria.

[0064] Example 2

[0065] 1. Materials and Methods

[0066] (1) Test strains

[0067] The pathogens causing potato aerial stem rot were provided by the Potato Diseases and Plant Pathogens Innovation Team of the College of Plant Protection, Hebei Agricultural University. They are *Pectobacterium parvum* FN20211 (see “Wang Jinhui, Han Wanxin, Pirhonen Minna, Pan Yang, Zhang Dai, Zhao Dongmei, Li Qian, Cheng Jianing, Yang Zhihui, Zhu Jiehua. High-Quality Complete Genome Resource of Pectobacterium parvum Isolate FN20211 Causing Aerial Stem Rot of Potato.[J].Molecular plant-microbe interactions:MPMI,2022,35(6):MPMI01220009A-MPMI01220009A.”) and *P. versatile* FN20111 (see “Han Wanxin, Wang Jinhui, Li Zheng, Pan Yang, Zhang Dai, Zhao Dongmei, Li…”). Qian, Yang Zhihui, Zhu Jiehua. First Report of Pectobacterium versatile Causing Aerial Stem Rot of Potato in China. [J]. Plant Disease, 2021.

[0068] (2) Test culture medium

[0069] The activation, preservation and propagation of pathogens and Bacillus were carried out using Luria-Bertani (LB) medium. The specific formula for LB liquid medium is as follows: 10g peptone, 5g yeast extract, 10g sodium chloride, distilled water to a final volume of 1L, pH adjusted to 7.0, and 20g agar powder added per liter of LB solid medium.

[0070] (3) Reagents and consumables

[0071] Kits and reagents used for molecular identification of Bacillus: Bacterial DNA extraction kit was purchased from TransGen Biotech Ltd., 2×CTAB Solution for DNA extraction by CTAB method was purchased from Beijing Coollab Technology Co., Ltd., nucleic acid extraction reagent was purchased from Shanghai Jizhi Biochemical Technology Co., Ltd., 2×Taq MasterMix for routine PCR was purchased from Meijing Novizan Biotechnology Co., Ltd., and DL2000 DNA Ladder and nucleic acid dyes were purchased from Suzhou Youyilandi Biotechnology Co., Ltd.

[0072] (4) Instruments and equipment

[0073] High-pressure steam sterilizer (Hirayama, Japan) for disinfection and sterilization; ultra-clean workbench (Suzhou Antai) for operation; constant temperature shaker (Shanghai Youyi Instruments) and constant temperature incubator (Ningbo Jiangnan Instrument Factory) for microbial culture; PCR instrument (Bio-Rad Laboratories, USA); electrophoresis apparatus (Junyi Electric JY600E); centrifuge (Eppendorf, Germany).

[0074] 2. Screening of biocontrol strains - Plate inhibition test

[0075] *Pectinobacterium granulosum* FN20211 and *Pectinobacterium diversicolor* FN20111 were activated on LB agar plates. Single colonies were picked and added to LB liquid medium and cultured at 28°C with shaking at 200 rpm until OD200. 600 With a value of 0.8, we obtained two culture media: FN20211 culture medium (referred to as culture medium 1) and FN20111 culture medium (referred to as culture medium 2).

[0076] After activating strain G15, single colonies were picked and cultured in LB liquid medium at 37°C with shaking at 200 rpm until OD500 was reached. 600 Value = 1.0, yielding bacterial suspension of strain G15.

[0077] After activating strain HzR6-0, single colonies were picked and cultured in LB liquid medium at 37°C with shaking at 200 rpm until OD500 was reached. 600 Value = 1.0, yielding bacterial suspension of strain G15.

[0078] Initial screening process:

[0079] Take 50 μL of culture medium 1 and spread it evenly on an LB medium plate. After standing for 5 minutes, place 5 filter paper discs on the plate. Take 10 μL of Bacillus belyss HzR6-0 and add it to the filter paper discs. After drying, incubate at 37℃ upside down for 1-2 days and then observe the results.

[0080] Take 50 μL of culture medium 2 and spread it evenly on an LB medium plate. After standing for 5 minutes, place 5 filter paper discs on the plate. Take 10 μL of Bacillus belyssus HzR6-0 and add it to the filter paper discs. After drying, incubate at 37℃ upside down for 1 to 2 days and then observe the results.

[0081] Take 50 μL of culture medium 1 and spread it evenly on an LB agar plate. After standing for 5 minutes, place 5 filter paper discs on the plate. Take 10 μL of Bacillus pumilus G15 and add it to the filter paper discs. After drying, incubate at 37°C upside down for 1-2 days and then observe the results.

[0082] Take 50 μL of culture medium 2 and spread it evenly on an LB medium plate. After standing for 5 minutes, place 5 filter paper discs on the plate. Take 10 μL of Bacillus pumilus G15 and add it to the filter paper discs. After drying, incubate at 37°C upside down for 1-2 days and then observe the results.

[0083] Set up a water control group-1: Take 50 μL of culture medium 1 and spread it evenly on an LB medium plate. After standing for 5 minutes, place 5 filter paper discs, take 10 μL of water and add it to the filter paper discs. After drying, incubate at 37℃ upside down for 1 to 2 days and then observe the results.

[0084] Set up a water control group-2: Take 50 μL of culture medium 2 and spread it evenly on an LB medium plate. After standing for 5 minutes, place 5 filter paper discs, take 10 μL of water and add it to the filter paper discs. After drying, incubate at 37℃ upside down for 1 to 2 days and then observe the results.

[0085] The secondary screening process is the same as the primary screening process, except that instead of placing 5 filter paper discs in each dish, only 1 filter paper disc is placed in the center of each dish. The secondary screening results are shown below. Figure 2 .

[0086] according to Figure 2 It can be seen that strain HzR6-0, which showed good inhibitory effect on pectinobacter spp. FN20211, was selected, with an inhibition zone diameter of 17.9±1.1 mm; strain G15, which showed good inhibitory effect on pectinobacter spp. FN20111, was selected, with an inhibition zone diameter of 19.1±0.9 mm.

[0087] Figure 2 In the table: A represents the inhibitory effect of HzR6-0 on *Pectobacterium micranthum* FN20211; B represents the inhibitory effect of G15 on *Pectobacterium diversicolor* FN20111; C represents the water control treatment.

[0088] 3. Molecular biological identification of biocontrol strains

[0089] (1) DNA extraction from strain HzR6-0 was performed using a total gold bacterial DNA extraction kit. PCR amplification was performed using universal primers for Bacillus subtilis: gyrB-F (SEQ ID No. 2: 5'-TGRCGGHRGYGGHTATAAAGT-3') and gyrB-R (SEQ ID No. 3: 5'-TCCDCCSTCAGARTCWCCCTC-3') (primer sequences are shown in Table 1). The PCR amplification system consisted of 1 μL DNA template, 1 μL gyrB-F, 1 μL gyrB-R, 12.5 μL 2×Taq Mix, and 9.5 μL ddH2O, for a total volume of 25 μL. The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, annealing at 72℃ for 30 s, for a total of 30 cycles; extension at 72℃ for 10 min. The product was stored at -20℃. The PCR amplification products were subjected to agarose gel electrophoresis, and gel imaging was used to observe the presence of the target band. PCR products with the target band were sent to Shanghai Sangon Biotech for sequencing. A phylogenetic tree was constructed using the Neighbor-Joining method, based on the alignment results of Bacillus universal primers gyrB-F and gyrB-R with NCBI. Figure 3 The strain HzR6-0 was identified as belonging to Bacillus velezensis.

[0090] Table 1 Primer sequences used for the strains

[0091]

[0092] Table 2. Reagents and concentrations required for Bacillus gyrB PCR reaction.

[0093] Element Content (μL) DNA template 1 gyrB-F 1 gyrB-R 1 2×TaqMix 12.5 <![CDATA[ddH2O]]> 9.5 Total volume 25

[0094] (2) Identification of strain G15: This invention downloaded the genome information of 12 Bacillus strains that had been sequenced in the NCBI database and performed gene similarity analysis on strain G15.

[0095] Average nucleotide identity (ANI) refers to the similarity of homologous genes between two genomes. Generally, an ANI value above 95% indicates the same species. Strain G15 has the highest ANI value of 99.49% with *Bacillus pumilus*, and its ANI values ​​with several other *Bacillus pumilus* strains are all greater than 95%; however, its ANI values ​​with several other closely related *Bacillus* strains are all less than 95%. A DDH value of 70% is generally considered the threshold for different species. The DDH values ​​of strain G15 with several other *Bacillus pumilus* strains are all above 70%, indicating that strain G15 is most closely related to *Bacillus pumilus*. Furthermore, phylogenetic trees were constructed using iqtree with the whole genome sequences of representative strains of each *Bacillus* species, and strain G15 clustered with *B. pumilus*. In conclusion, strain G15 was identified as *B. pumilus* (see Table 3). Figure 10 .

[0096] Table 3. Average Nucleotide Identification (ANI) and DNA Homology (DDH) values ​​of closely related species of Bacillus.

[0097]

[0098]

[0099] (3) Molecular biological identification of Pectinobacterium

[0100] Based on the alignment results of sequencing using the universal primers gapA-F and gapA-R for Pectinobacter, a phylogenetic tree was constructed using NCBI. Figure 4 FN20211 was identified as belonging to P. parvum, and FN20111 belonged to P. versatile. Figure 4 Phylogenetic tree constructed based on the gapA gene sequences of strains FN20211 and FN20111.

[0101] 4. Determination of the efficacy of biocontrol strains against aerial stem rot

[0102] (1) Pathogenicity determination of pectinobacter and Bacillus on potato tubers

[0103] To clarify the virulence of two types of pectinobacteria and the Bacillus species that inhibit them on potato tubers, *Pectinobacterium valerate* FN20211, *Pectinobacterium diversicolor* FN20111, *Bacillus belyssii* HzR6-0, and *Bacillus pumilus* G15 were selected for pathogenicity testing on potato tubers. The specific procedure is as follows:

[0104] After activating *Pectinobacterium granulosum* FN20211 by streaking on LB agar plates, the culture was incubated at 28°C for 24 h. Single colonies were picked and cultured in LB liquid medium at 28°C with shaking at 200 rpm for 12–18 h. The resulting culture was centrifuged at 8500 rpm for 1 min to collect the bacterial cells. The bacterial cells were washed with 10 mM NaCl and resuspended to obtain a resuspension of *Pectinobacterium granulosum* FN20211 (denoted as FN20211-resuspension 1).

[0105] After activating *Pectinobacterium diversicolor* FN20111 by streaking on LB agar plates, the culture was incubated at 28°C for 24 h. Single colonies were picked and cultured in LB liquid medium at 28°C with shaking at 200 rpm for 12–18 h. The resulting culture was centrifuged at 8500 rpm for 1 min to collect the bacterial cells. The bacterial cells were washed with 10 mM NaCl and resuspended to obtain *Pectinobacterium diversicolor* FN20111 resuspension (denoted as FN20111-resuspension 2).

[0106] Bacillus belyss HzR6-0 was activated by streaking on LB agar plates and then incubated at 37°C for 24 h. Single colonies were picked and cultured in LB liquid medium at 37°C with shaking at 200 rpm for 12–18 h. The resulting culture was centrifuged at 8500 rpm for 1 min to collect the bacterial cells. The cells were washed with 10 mM NaCl and resuspended to obtain a resuspension of Bacillus belyss HzR6-0 (denoted as HzR6-0-resuspension 3).

[0107] Bacillus pumilus G15 was activated by streaking on LB agar plates and then incubated at 37°C for 24 h. Single colonies were picked and cultured in LB liquid medium at 37°C with shaking at 200 rpm for 12–18 h. The resulting culture was centrifuged at 8500 rpm for 1 min to collect the bacterial cells. The bacterial cells were washed with 10 mM NaCl and resuspended to obtain a Bacillus pumilus G15 resuspension (denoted as G15-resuspension 4).

[0108] Select potato tubers (Wotu No. 5) of uniform size that are highly susceptible to aerial stem rot, wash them, disinfect them with sodium hypochlorite for 20 minutes, rinse them thoroughly with sterile water, and air dry them. Use a sterile yellow nozzle to puncture the potato tubers to create cavities. Then, add 50 μL of each of the following solutions to the cavities: LFN20211-resuspended solution 1, FN20111-resuspended solution 2, HzR6-0-resuspended solution 3, and G15-resuspended solution 4. Set up 5 parallel experiments for each solution.

[0109] A buffer solution (10 mM NaCl) was added to the cavity of a potato as a negative control.

[0110] Afterwards, each group sealed the wound with Vaseline, wrapped the potato tubers with paper towels, laid them flat in a food storage box, and sprayed them with sterile water to keep them moist. After incubation in the dark at room temperature for 48–72 hours, the virulence of Pectinobacterium and Bacillus was assessed based on the weight of the soaked tissue. Figure 5 The virulence of pectinobacter and Bacillus in potato tubers is shown in Figure A, which is a longitudinal section of tubers inoculated with Pectinobacter spp. FN20211, Pectinobacter spp. FN20111, Bacillus belyss HzR6-0, and Bacillus pumilus G15; and Figure B is an analysis of the difference in internal decay weight of tubers under different treatments.

[0111] The results show that *Pectobacterium granulosum* FN20211 and *Pectobacterium diversicolor* FN20111 both caused varying degrees of rot in potato tubers, while *Bacillus belyssioides* HzR6-0 and *Bacillus pumilus* G15 did not cause rot in potato tubers. Figure 5 (A). The weights of the decayed parts caused by *Pectobacterium micranthum* FN20211 and *Pectobacterium diversicolor* FN20111 were 4.89±0.16g and 3.62±0.26g, respectively. Figure 5 (B) and the virulence caused by *Pectobacterium diversicolor* FN20111 is relatively lower than that caused by *Pectobacterium parvum* FN20211. The weight of decayed parts caused by *Bacillus belyssioides* HzR6-0 and *Bacillus pumilus* G15 were 0.23±0.03g and 0.17±0.03g, respectively. Figure 5 The results for B) showed no significant difference between the two, indicating that these two Bacillus species would not cause rot or other symptoms in potato tubers, and a fungicide inhibition test could be conducted.

[0112] (2) Determination of the efficacy of Bacillus subtilis in inhibiting potato aerial stem rot in tubers

[0113] To clarify whether biocontrol Bacillus has a preventive or curative effect against Pectinobacterium on potato tubers, two treatment groups were set up to determine the control efficacy of Bacillus on potato aerial stem rot pathogens on tubers. Specifically:

[0114] (1) Treatment 1: Select potato tubers (Wotu No. 5) of uniform size that are highly susceptible to aerial stem rot, wash them, disinfect them with sodium hypochlorite for 20 min, rinse them with sterile water, and air dry them. Use a sterile yellow nozzle to puncture the potato tubers to create cavities, then add 50 μL of LFN20211-resuspended solution 1 into the cavities, incubate them in the dark at 28℃ for 12 h, and then inoculate them with 50 μL of HzR6-0-resuspended solution 2. Set up 5 parallel experiments.

[0115] Treatment 2: Select potato tubers (Wotu No. 5) of uniform size that are highly susceptible to aerial stem rot. After washing, disinfect with sodium hypochlorite for 20 minutes, rinse thoroughly with sterile water, and air dry. Use a sterile yellow nozzle to puncture the potato tubers, creating cavities. Add 50 μL of HzR6-0-resuspended solution 2 to the cavities, and incubate in the dark at 28℃ for 12 hours. Then inoculate with 50 μL of FN20211-resuspended solution 1. Set up 5 parallel experiments.

[0116] The results of the antibacterial test are shown below. Figure 6 It can be seen that the weight of the rotten part of the potato tuber caused by inoculation with *Bacillus vesiculosus* FN20211 for 12 hours followed by inoculation with *Bacillus belyssioides* HzR6-0 was 4.21 ± 0.69 g. The weight of the rotten part of the potato tuber caused by inoculation with *Bacillus belyssioides* HzR6-0 for 12 hours followed by inoculation with *Bacillus vesiculosus* FN20211 was 0.22 ± 0.04 g. Figure 6 Compared to the treatment of inoculating with Bacillus subtilis FN20211 for 12 hours followed by inoculation with HzR6-0, the treatment significantly reduced the area of ​​decayed tissue. Figure 6 Therefore, Bacillus berleis HzR6-0 has an inhibitory effect on Pectinobacterium fenestration FN20211.

[0117] 5. Test of potted plant efficacy

[0118] To determine the control efficacy of Bacillus belyssus HzR6-0 against Pectinobacterium tumefaciens FN20211 in potted potatoes, its efficacy was tested on potted potatoes. The experimental method is as follows:

[0119] (1) Preparation of resuspension: Bacillus belye HzR6-0 was activated and streaked on LB agar plates. After incubation at 37℃ for 24 h, single colonies were picked and placed in LB liquid medium. The culture was then incubated at 37℃ and 200 rpm for 12–14 h to prepare the seed culture. The seed culture was added to LB liquid at a volume ratio of 1:100 and cultured with shaking until OD was reached. 600 =1.0, the obtained culture medium was centrifuged at 8500 rpm for 1 min to collect bacterial cells, washed with physiological saline and resuspended to 10. 7 CFU / mL was used to obtain a resuspension of HzR6-0.

[0120] Activated *Pectinobacterium granulosum* FN20211 was streaked onto LB agar plates and incubated at 28°C for 24 hours. Single colonies were then picked and incubated in LB liquid medium at 28°C and 200 rpm for 12–14 hours to prepare a seed culture. The seed culture was added to LB liquid medium at a volume ratio of 1:100 and cultured with shaking until OD reached. 600 =0.8, the obtained culture medium was centrifuged at 8500 rpm for 1 min to collect the bacterial cells, washed with physiological saline and resuspended to 10. 7CFU / mL was used to obtain FN20211 resuspension.

[0121] (2) Treatment 1: The potato variety selected was Wotu No. 5, which is highly susceptible to aerial stem rot. After the tubers were cut into pieces, they were wrapped in talcum powder and planted in pots. Watering was carried out every 7 days. After about 30 days of cultivation, 30 mL of Bacillus berberis HzR6-0 resuspension was sprayed on the stem. 7 days after spraying, FN20211 resuspension was inoculated. The FN20211 resuspension was inoculated by injection. The specific operation was as follows: before injection, the inoculation site was disinfected with 75% ethanol. 30 μL of FN20211 resuspension was drawn into a 1 mL syringe and injected into the base of the potato stem. After the injection, the injection wound was sealed with Vaseline to prevent the wound from being contaminated.

[0122] Treatment 2 (negative control) was the same as treatment 1, except that the Bacillus belyssus HzR6-0 resuspension and FN20211 resuspension were replaced with physiological saline.

[0123] Treatment 3 (positive control) was the same as treatment 1, except that it was inoculated with Bacillus pectinus FN20211 resuspension and not sprayed with Bacillus beryl HzR6-0 resuspension.

[0124] Treatment 4 (drug control): Same as treatment 1, except that the inoculation with Bacillus subtilis FN20211 resuspension was replaced with spraying with 4% kasugamycin instead of Bacillus subtilis resuspension.

[0125] Ten stems were inoculated for each treatment. The control effect of Bacillus was determined by comparing the length of the soft rot in the longitudinal section of the potato plant stem.

[0126] The inhibitory effect of Bacillus bellis HzR6-0 on Pectinobacterium tumefaciens FN20211 in potato pots is shown in [reference needed]. Figure 7 The results show that in treatment 1, which involved spraying with *Bacillus belyssioides* HzR6-0 followed by inoculation with *Pectinobacterium granulosum* FN20211, the average length of internal rot was 5.28 ± 1.13 cm. In treatment 3, which involved inoculation with *Pectinobacterium granulosum* FN20211 alone (the positive control), the average length of internal rot was 10.5 ± 2.43 cm. The control efficacy of *Bacillus belyssioides* HzR6-0 against *Pectinobacterium granulosum* FN20211 in potted plants was 49.71%. In treatment 4, which involved spraying with 4% kasugamycin (AS), the area of ​​internal rot in potato stems was generally less severe, with an average rot length of 2.92 ± 0.60 cm. The control efficacy of kasugamycin (AS) against *Pectinobacterium granulosum* FN20211 was 72.20%.

[0127] 6. Field experiments

[0128] (1) Preparation method of Bacillus belyss HzR6-0 and compound fermentation broth:

[0129] Bacillus belye HzR6-0 was activated on LB agar plates. Single colonies were picked and cultured in LB liquid medium to obtain a seed culture. The seed culture was then inoculated into blank LB liquid medium at a volume ratio of 1:100 and cultured with shaking at 37°C and 200 rpm until OD reached. 600 The value was 1.0, and the HzR6-0 fermentation broth was obtained.

[0130] Bacillus pumilus G15 was activated on LB agar plates. Single colonies were picked and cultured in LB liquid medium to obtain a seed culture. The seed culture was then inoculated into blank LB liquid medium at a volume ratio of 1:100 and cultured with shaking at 37°C and 200 rpm until OD reached. 600 The value is 1.0, resulting in G15 fermentation broth.

[0131] The HzR6-0 fermentation broth and G15 fermentation broth were mixed at a volume ratio of 1:1 to obtain a compound fermentation broth.

[0132] (2) The potato variety selected for planting is Wotu No. 5, which is highly susceptible to aerial stem rot. Sowing date is April 24th, with a row spacing of 90cm, using a strip planting method. Each plot is 5m long and 4.5m wide, with an area of ​​approximately 22.5m². 2 Each plot contains approximately 110 potato plants.

[0133] The first application of the herbicide was performed when the potato plants began to bud. The interval between two applications was 10 days. A total of 6 treatments and 1 control were established, with each treatment replicated three times. The treatments included biocontrol agents and chemical agents (treatments 1-4), a chemical agent control (treatment 5), a biocontrol agent control (treatment 6), and a control (treatment 7), as detailed below:

[0134] Treatment 1: After spraying the compound fermentation broth of Bacillus belye HzR6-0 and Bacillus pumilus G15 once, spray 4% kasugamycin (AS) five times.

[0135] Treatment 2: After spraying twice with a compound fermentation broth of Bacillus belye HzR6-0 and Bacillus pumilus G15, spray four times with 4% kasugamycin (AS).

[0136] Treatment 3: After spraying the compound fermentation broth of Bacillus belye HzR6-0 three times, spray 4% kasugamycin (AS) three times.

[0137] Treatment 4: Spray the compound fermentation broth of Bacillus belye HzR6-0 and G15 6 times.

[0138] Treatment 5: Spray 4% kasugamycin (AS) 6 times.

[0139] Treatment 6: Spray 500 million Pyromyces multimyxobin KN-03(SC) 6 times.

[0140] Treatment 7: Spray with clean water 6 times.

[0141] (3) The efficacy of biocontrol strains in the field against aerial stem rot

[0142] On August 25, 2024, the final efficacy survey of biocontrol strains for potato aerial stem rot was conducted in the experimental field. The results showed that the incidence rate in the blank control treatment reached 84.63%, indicating that the aerial stem rot disease was severe and widespread in this experimental plot. The biocontrol strains with better control effects were applied twice with a compound fermentation broth of HzR6-0 and G15, followed by four applications of 4% kasugamycin (AS*) (see...). Figure 8 (and Table 4).

[0143] Table 4. Control effects of different biocontrol agents on potato aerial stem rot

[0144] deal with Incidence rate (%) Prevention and control efficacy (%) Process 4 58.52b 31.86 Process 1 53.15c 37.36 Process 2 49.81cd 40.66 Process 3 57.04b 34.06 Process 6 49.26d 41.76 Process 5 37.96e 54.95 Process 7 84.63a -

[0145] Note: Different letters in the table indicate significant differences at the 0.05 level according to the Tukey Test, while the same letter indicates no significant difference.

[0146] (4) Effects of different biocontrol agents on potato yield

[0147] On September 6, 2024, yield measurements were conducted in experimental fields to determine the efficacy of biocontrol agents against potato aerial stem rot during harvest. In the combined application of biocontrol agents and chemical agents, after three applications of the fermentation broth of HzR6-0 and G15, the highest yield was achieved with three applications of 4% kasugamycin (AS*), but this was slightly lower than the yield of the control treatment. The lowest yield was observed in the blank control area (see Table 5). Figure 9 ).

[0148] After three applications of the HzR6-0 and G15 compound fermentation broth, the yield increase rate of 4% kasugamycin (AS*) after three applications was the highest among biocontrol agents replacing chemical agents, second only to the yield increase rate of 4% kasugamycin (AS*). Meanwhile, the yield increase rate of six applications of the HzR6-0 and G15 compound fermentation broth was higher than that of the commercially available Bacillus subtilis KN-03 (SC) with over 500 million bacteria, indicating that the combined effect of the two agents on potato yield increase is superior to that of the commercially available Bacillus subtilis KN-03 (SC).

[0149] Table 5. Effects of different biocontrol agents on potato yield

[0150]

[0151] Note: The data in the table are mean ± standard deviation. Different letters indicate significant differences at the 0.05 level according to the Tukey Test, while the same letter indicates no significant difference.

[0152] In summary, this invention provides a biocontrol agent, *Bacillus velezensis* HzR6-0, which inhibits the pathogen causing potato aerial stem rot. Strain HzR6-0 exhibits significant inhibitory activity against *Pectinobacterium valerate* FN20211. This invention also provides a compound biocontrol agent. Examples show that combining the fermentation broth of *Bacillus velezensis* HzR6-0 and *Bacillus pumilus* G15 with 4% kasugamycin (aqueous solution) in the field for control, followed by two applications of the fermentation broth of HzR6-0 and G15, and four applications of 4% kasugamycin (aqueous solution), resulted in good control of potato aerial stem rot, with a control efficacy of 49.82%.

[0153] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Bacillus velezensis HzR6-0, with accession number CGMCC No.32838.

2. A biocontrol agent, characterized in that, This includes the fermentation broth and / or resuspension of Bacillus berleis HzR6-0 as described in claim 1.

3. A compound biocontrol agent, characterized in that, Includes Bacillus belye HzR6-0 and Bacillus pumilus G15 as described in claim 1. ， The preservation number of the Bacillus pumilus G15 is CGMCC No. 32839.

4. The compound biocontrol agent according to claim 3, characterized in that, The compound biocontrol agent and chemical agent are used in combination.

5. The compound biocontrol agent according to claim 4, characterized in that, The chemical agent includes kasugamycin.

6. The compound biocontrol agent according to claim 3 or 4, characterized in that, The effective viable count of Bacillus vesiculus HFR6-0 in the compound biocontrol agent is ≥1×10⁻⁶. 7 CFU / mL, the effective viable count of Bacillus pumilus G15 in the compound biocontrol agent is ≥1×10⁻⁶. 7 CFU / mL.

7. The application of Bacillus berleis HzR6-0 as described in claim 1, or the biocontrol agent as described in claim 2, or the compound biocontrol agent as described in any one of claims 3 to 6, in the control of potato diseases and / or the increase of potato yield.

8. The application according to claim 7, characterized in that, The pathogens causing the disease include Pectobacterium spp.

9. The application according to claim 7 or 8, characterized in that, The diseases include potato blackleg and / or potato aerial stem rot.

10. A method for preventing and controlling potato diseases and / or increasing potato yield, characterized in that, Spray the Bacillus berreatus HzR6-0 of claim 1, the biocontrol agent of claim 2, or the compound biocontrol agent of any one of claims 3 to 6 onto potatoes.

Images