Grape VvWRKY70 gene and application thereof in regulation and control of plant drought resistance

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a grape VvWRKY70 gene and application of the grape VvWRKY70 gene in regulation and control of plant drought resistance. In order to excavate a grape drought-resistant gene and research the regulation and control mechanism of the grape drought-resistant gene, the invention screens out a VvWRKY70 gene which is subjected to drought-induced expression, the nucleotide sequence of the VvWRKY70 gene is shown as SEQ ID NO: 1, and the VvWRKY70 gene encoding protein is positioned in a cell nucleus, can specifically recognize a W-box cis-acting element and shows transcriptional activation activity. The VvWRKY70 gene positively regulates the drought resistance of plants, and overexpression of the gene can improve the relative water content and survival rate of plant leaves, promote accumulation of the content of an osmotic regulation substance proline and the content of a secondary metabolism substance anthocyanin, reduce the content of malondialdehyde and the content of hydrogen peroxide and remarkably enhance the tolerance of the plants under drought stress.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to grapes. VvWRKY70 Genes and their application in regulating plant drought resistance. Background Technology

[0002] Grape( Vitis vinifera L . Grapes are one of the world's major cultivated fruit trees, with a wide range of uses. As a typical warm-climate crop, grapes are highly sensitive to water conditions during their growth and development. Drought hinders grape fruit growth and inhibits the synthesis of phenolic substances, leading to a sharp decline in grape yield and degradation of fruit quality. Approximately half of my country's main grape-growing areas are located in arid and semi-arid climate zones; therefore, drought is one of the major environmental stresses severely limiting grape growth and fruit production. The intensification of drought seriously threatens the sustainable development of the grape industry. Therefore, identifying drought-resistant genes in grapes and studying their regulatory mechanisms is of great significance for breeding new drought-resistant grape varieties and improving grape yield and quality. Summary of the Invention

[0003] This invention provides a grape-based solution to the above problems. VvWRKY70 The gene and its application in regulating plant drought resistance: This gene was isolated and extracted from the leaves of the "Muscat" grape variety. VvWRKY70 Genes positively regulate plant drought resistance; overexpression VvWRKY70 Genes can enhance the drought resistance of plants. This invention provides a novel germplasm material for the breeding of drought-resistant plant varieties and the improvement of drought-resistant traits in plants.

[0004] To achieve the above objectives, the present invention employs the following technical solution: This invention provides a grape VvWRKY70 The gene, whose nucleotide sequence is shown in SEQ ID NO:1.

[0005] Furthermore, the protein encoded by the gene is located in the cell nucleus.

[0006] Furthermore, in this invention, heterologous overexpression VvWRKY70 Arabidopsis plants were created through Agrobacterium-mediated genetic transformation, using a 35S promoter-driven... VvWRKY70 A stable genetic line was obtained by introducing a GFP fusion expression vector into wild-type Arabidopsis thaliana plants and selecting for resistance. The subcellular localization of the fusion protein was visualized and tracked using laser confocal microscopy to detect GFP fluorescence signals. The results showed the presence of green fluorescence signals in the nuclei of Arabidopsis thaliana root cells, indicating... VvWRKY70 The protein is located in the cell nucleus.

[0007] Furthermore, the gene can specifically recognize W-box cis-acting elements, exhibiting transcriptional activation activity.

[0008] Furthermore, this invention utilizes the yeast one-hybrid system to examine its W-box binding properties and transcriptional activity, and the results confirm... VvWRKY70 It can specifically recognize W-box cis-acting elements and exhibit transcriptional activation activity.

[0009] Furthermore, the aforementioned VvWRKY70 Gene expression is induced by drought stress.

[0010] Specifically, the present invention analyzes VvWRKY70 Gene expression patterns under drought stress were observed in grape seedlings after drought treatment. VvWRKY70 The relative expression level of the gene was significantly increased, indicating that VvWRKY70 The expression of the gene was induced by drought stress and was associated with the drought resistance of grapevines.

[0011] The present invention also provides a grape VvWRKY70 Application of genes in regulating plant drought resistance.

[0012] Furthermore, the grapes VvWRKY70 Genes positively regulate the drought resistance of plants.

[0013] Furthermore, overexpression of the grape VvWRKY70 Genes enhance the drought resistance of plants.

[0014] Furthermore, the improvement of plant drought resistance includes: 1) increasing the relative water content and survival rate of plant leaves under drought stress; 2) promoting the accumulation of osmotic regulators proline and soluble sugars, as well as the secondary metabolite anthocyanin; and 3) reducing the content of malondialdehyde and hydrogen peroxide in plant leaf cells under drought stress.

[0015] This invention also provides a method for improving the drought resistance of plants, specifically grapes. VvWRKY70 Transforming genes into plants can improve their drought resistance.

[0016] Furthermore, the plant is grape or Arabidopsis thaliana.

[0017] Compared with the prior art, the present invention has the following advantages: This invention clones a [type of organism] from grapes. WRKY Protein genes, i.e. VvWRKY70 Transforming the aforementioned gene into plants can improve their drought resistance. VvWRKY70 A new method for increasing plant drought resistance through gene expression can be used to cultivate new stress-resistant plant varieties, which is of great significance to agricultural production. Attached Figure Description

[0018] Figure 1 For grapes VvWRKY70Analysis of gene expression patterns under drought stress; Figure 2 For grapes VvWRKY70 Protein subcellular localization map; Figure 3 For grapes VvWRKY70 Verification of transcriptional activation activity; Figure 4 for VvWRKY70 Validation of gene overexpression in Arabidopsis thaliana plants; Figure 5 Genetically modified (GMO) VvWRKY70 Phenotypic diagrams of wild-type Arabidopsis thaliana under drought stress; Figure 6 Genetically modified (GMO) VvWRKY70 The relative water content and survival rate of wild-type Arabidopsis thaliana under drought stress; Figure 7 Genetically modified (GMO) VvWRKY70 Determination of oxidative damage indices in wild-type Arabidopsis thaliana under drought stress; Figure 8 Genetically modified (GMO) VvWRKY70 Determination of proline and soluble sugars, osmotic regulators in wild-type Arabidopsis thaliana under drought stress; Figure 9 Genetically modified (GMO) VvWRKY70 The content of anthocyanins, a secondary metabolite in wild-type Arabidopsis thaliana under drought stress, was determined. Detailed Implementation

[0019] To further illustrate the technical solution of the present invention, the present invention will be further described below through embodiments. Example 1

[0020] This embodiment provides VvWRKY70 Gene acquisition and VvWRKY70 Analysis of gene expression patterns under drought stress.

[0021] (1) VvWRKY70 Acquisition of genes Using cDNA from 'Muscat' grape leaves as a template, specific primers (as shown in SEQ ID NO:2 and SEQ ID NO:3) were designed for PCR amplification. The PCR product was purified, ligated into the pDONR221 vector, transformed into E. coli DH5α, and positive clones were selected. Plasmids were extracted and sequenced to obtain... VvWRKY70 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0022] (2) VvWRKY70 Analysis of gene expression patterns under drought stress Grape leaves were transferred to dry filter paper at room temperature, and samples were taken at 0, 1, 2, 6, and 12 h to extract mRNA, which was reverse transcribed into cDNA for detection. VvWRKY70 Gene expression under drought stress. Figure 1 It can be seen that after drought treatment of grape leaves VvWRKY70 The relative expression level of the gene was significantly increased, indicating that VvWRKY70 The gene is induced to express under drought stress, and this gene may be involved in the grape drought resistance process. Example 2

[0023] This embodiment provides VvWRKY70 Subcellular localization and transcriptional activation activity analysis of gene-encoded proteins (1) VvWRKY70 Subcellular localization of proteins Subcellular localization is an indispensable technique for studying gene function. It allows researchers to pinpoint the specific location of gene expression products within cells, providing direction for understanding the gene's mechanism of action. To investigate grape... VvWRKY70 The gene's function is to clone its coding region and fuse it into green fluorescent protein (GFP), and then recombine... VvWRKY70 The -GFP fusion construct was transformed into Arabidopsis thaliana plants, and its expression site was observed under a confocal microscope. The results showed that the VvWRKY70 protein exhibited a green fluorescent signal in the nucleus of Arabidopsis root cells, indicating that the VvWRKY70 protein is localized in the nucleus. Figure 2 ).

[0024] (2) VvWRKY70 protein transcriptional activation To determine VvWRKY70 To investigate whether it mediates the transcriptional activation of W-box binding proteins, this study used a yeast one-hybrid system to examine its W-box binding characteristics and transcriptional activity. DNA fragments containing the W-box core sequence and its mutant mW-box were inserted into the pAbAi vector carrying the AbAr reporter gene, respectively. Subsequently, the recombinant plasmids pAbAi-W-box / pAbAi-mW-box were integrated into the genome of the Y1HGold yeast strain via homologous recombination. In the absence of prey proteins, 750 ng / mL AbA effectively inhibited the basal expression of the AbAr reporter gene in the pAbAi-W-box reporter strain. The results showed that yeast clones carrying both pAbAi-W-box and pGADT7-VvWRKY70 proliferated normally in SD / -Leu / -Ura selective medium containing 750 ng / mL AbA, while the control group carrying both pAbAi-mW-box and pGADT7-VvWRKY70 completely lost its growth ability. Figure 3This result confirms that VvWRKY70 can specifically recognize W-box cis-acting elements and exhibits general transcriptional activation activity. Example 3

[0025] This embodiment provides heterologous overexpression. VvWRKY70 The influence of genes on plant drought resistance.

[0026] (1) VvWRKY70 Construction of transgenic Arabidopsis thaliana plants Build using Gateway technology VvWRKY70 The plant expression vector Pro35S∶∶VvWRKY70-GFP was transformed into Agrobacterium competent cells GV3101. Arabidopsis inflorescences were then infected with Agrobacterium, and seeds were harvested. Homozygous selection was performed using a herbicide (PPT) to obtain the desired results. VvWRKY70 Homozygous Arabidopsis thaliana lines overexpressing the gene. qRT-PCR results confirmed... VvWRKY70 Gene transcription levels were significantly increased compared to wild type, and this overexpressing Arabidopsis strain was successfully constructed. Figure 4 ).

[0027] (2) VvWRKY70 Gene overexpression enhances drought resistance in Arabidopsis thaliana. To investigate the effect of VvWRKY70 on the drought tolerance of plants, 4-week-old plants were... VvWRKY70 Drought treatment was applied to Arabidopsis thaliana lines and wild-type plants that had been overexpressed. Figure 5 As shown, the degree of leaf curling and wilting in Arabidopsis plants increased with prolonged drought. At 8 and 10 days of drought treatment, wild-type plants exhibited more severe wilting phenotypes than transgenic lines. After 8 days of drought stress, VvWRKY70 The relative water content (RWCs) of transgenic Arabidopsis thaliana lines was significantly higher than that of wild-type plants. Figure 6 (A). As the drought duration increased, the wilting degree of transgenic Arabidopsis plants was significantly lower than that of the wild type. When almost all plants wilted, rehydration treatment was performed, and after 2 days of rehydration... VvWRKY70 The survival rate of the overexpression lines was significantly higher than that of the wild-type plants. Figure 6 (B) These results prove that, VvWRKY70 Plants with high expression of Arabidopsis thaliana showed stronger drought tolerance.

[0028] To more intuitively analyze the drought resistance of wild-type and transgenic Arabidopsis thaliana, physiological indicators of wild-type and transgenic Arabidopsis thaliana plants under drought stress were detected. As important indicators for assessing oxidative stress, the malondialdehyde (MDA) content and hydrogen peroxide (H2O2) level in Arabidopsis thaliana plants significantly increased under drought conditions, but compared with wild-type plants, VvWRKY70 The levels of these two substances were significantly reduced in the overexpression lines. Figure 7 ),show VvWRKY70 High expression effectively mitigated drought-induced oxidative damage. Under drought stress, the contents of proline and soluble sugars, important osmotic regulators, significantly increased. Compared with wild-type Arabidopsis, overexpression... VvWRKY70 The content of proline and soluble sugars was significantly increased in the transgenic lines. Figure 8 ),show VvWRKY70 It promotes the accumulation of osmotic regulatory substances, thereby enhancing the osmotic regulation capacity of plants under drought stress. Furthermore, drought stress induces anthocyanin accumulation in Arabidopsis plants, which, compared to wild-type Arabidopsis, shows a higher accumulation rate. VvWRKY70 The anthocyanin content was significantly increased in the overexpression lines. Figure 9 ).therefore, VvWRKY70 High expression of anthocyanins in Arabidopsis thaliana promotes the accumulation of anthocyanins under drought stress, and anthocyanins are involved in... VvWRKY70 Physiological responses that induce increased drought resistance.

[0029] In summary, this invention screened a drought-induced expression... VvWRKY70 The gene, whose nucleotide sequence is shown in SEQ ID NO:1; VvWRKY70 The gene-encoded protein is located in the cell nucleus, specifically recognizes W-box cis-acting elements, and exhibits transcriptional activation activity; observations were made under drought treatment. VvWRKY70 Overexpression of this gene in Arabidopsis thaliana plants and their corresponding wild-type phenotypes showed that it increased the relative water content of leaves and survival rate, promoted the accumulation of the osmotic regulator proline and the secondary metabolite anthocyanin, reduced malondialdehyde and hydrogen peroxide levels, and significantly enhanced the plant's tolerance to drought stress. This invention demonstrates... VvWRKY70 Genes positively regulate plant drought resistance, providing new gene resources for research on improving plant drought resistance using genetic engineering techniques.

[0030] The foregoing has shown and described the main features and advantages of the present invention. It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

[0031] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

[0032] sequence list SEQ ID NO:1 ATGGAGAGGCACACAGACGCCACCATGAGCACAATGGAGTGCACCTGGTCGGAAAAGATCTCCGGCGATCGGAAAAGAGCCATCGACGAGCTGCTTCGAGGTCGCTCCTTCACCAAGCAGCTTCGCAGCGTCCTCCTCGGAGGGGATCAACAGGAGTCGGCCCAGGATCTTCTAGTGAAAATCTCGAGGTCATTCACCGATACTCTTTCTATATTGAATTCCGGCGAGTCCGACGAGGCCGTCTCACAGATTCCGGCGAGTGGTCAGCTGTATTCGCCGGGTTGGCATGGCCGGAGGTCGGAGGAATCTTGCGAGAGTGGTAAGAGTTCCACCAAGGATCGCAGGGGCTGTTACAAGCGAAGGAAGAATTCGCAATCTTGGATCAGAATCACCCCTAATTTTCACGATGACGGTTATGCCTGGCGAAAATACGGACAAAAAGTCATACTCAATGCTAAACATCAAAGAAGCTACTATAGGTGCACCCACAAGCATGACCAGGGCTGCATGGCAACCAAACAGGTTCAGATGACTGAAGAGGAGCCCCCAATGTACAAAACCACATACCACGGCCAGCACACATGCAAAAGCATGCTGAAGTCATCTCAGATTATGGTGGAAAATTCTACTGCAAGAGATTCTTCCATTCTGCTCAGCTTTGAATCAAACAATCAAGATGATAGCAACGCCTTTTTCTCATCATTCCCCTTGATAAAACAAGAGGAAGAGATCCCAAATGATGATCAGGAGGTGACCTACAATAACCATACCAATAACAACAACAAGAACAACAACTCCTCATCCTCTGATTATCTTCTGTCACTGGAGCTCACCACATTTGAATCCAATCTGGGGTCTGATCATGGTGATGTCCTTTCTGGGGTTAACTCTTCTTGTACGGACAGCACTCACAGTTTGGATGATATGATGATGGACTTTGATGATGTTCTTATCGGTTTTGAGTGTTAG SEQ ID NO:2: VvWRKY70 -F:5‘-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGAGAGGCACACAGAC-3’ SEQ ID NO:3: VvWRKY70 -R:5’-GGGGACCACTTTGTACAAGAAAGCTGGGTAACACTCAAAACCGATAAG-3’。

Claims

1. Grapes VvWRKY70 Genes, characterized by, The grapes VvWRKY70 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The grape according to claim 1 VvWRKY70 Genes, characterized by, The protein encoded by the gene is located in the cell nucleus.

3. The grape according to claim 1 VvWRKY70 Genes, characterized by, The gene can specifically recognize W-box cis-acting elements and exhibits transcriptional activation activity.

4. Grapes VvWRKY70 The application of genes in regulating plant drought resistance is characterized by, The grapes VvWRKY70 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

5. The application according to claim 4, characterized in that, The grapes VvWRKY70 Genes positively regulate the drought resistance of plants.

6. The application according to claim 4, characterized in that, Overexpression of the grape VvWRKY70 Genes enhance the drought resistance of plants.

7. The application according to claim 6, characterized in that, The improvement of plant drought resistance includes: 1) increasing the relative water content and survival rate of plant leaves under drought stress; 2) promoting the accumulation of osmotic regulators proline and soluble sugars, as well as the secondary metabolite anthocyanin; and 3) reducing the content of malondialdehyde and hydrogen peroxide in plant leaf cells under drought stress.

8. The application according to any one of claims 4-7, characterized in that, The plant in question is either grape or Arabidopsis thaliana.

9. A method for improving plant drought resistance, characterized in that, grapes VvWRKY70 Gene transfer into plants, the grapes VvWRKY70 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

10. A method for improving plant drought resistance according to claim 9, characterized in that, The plant in question is either grape or Arabidopsis thaliana.

Images