Gene expression vector and application thereof in brevibacillus laterosporus

Abstract

The invention discloses a novel gene expression plasmid pTAEP2 capable of realizing efficient and stable overexpression in brevibacillus laterosporus (Brevibacillus laterosporus), and a preparation method of the novel gene expression plasmid pTAEP2 capable of realizing efficient and stable overexpression in brevibacillus laterosporus. The plasmid contains a toxin-antitoxin system gene cassette, so that the plasmid can stably exist in a specific non-mode host; the P2 promoter can drive high-level expression of a target gene; the RepF replicon is contained, so that the plasmid can be effectively replicated in a non-mode host; the composition contains ampicillin antibiotics and erythromycin which are used as selection markers. The invention also provides a method for target protein expression by transforming specific non-mode brevibacillus laterosporus with the pTAEP2 plasmid, the plasmid contains a TraJ element, so that the plasmid is efficiently introduced into a non-mode microbial host including brevibacillus laterosporus in a conjugational transfer manner, the gene introduction process is greatly simplified, and the production cost is reduced. And stable and high expression of a target gene is realized. The invention provides a powerful molecular biological tool for developing efficient and stable gene overexpression research and industrial application, and is beneficial to efficient gene manipulation in the non-model bacteria.

Description

Technical Field

[0001] This invention relates to the field of microbial genetic manipulation technology, specifically to a novel gene expression vector for non-pattern brevicorbacillus laterosporus M811 and its construction and application methods. Background Technology

[0002] *Brevibacillus laterosporus* M811 is a microbial strain screened using a soil co-culture method. This strain can synthesize bogorols, compounds with significant antibacterial activity, showing important application potential in the pharmaceutical and agricultural fields. However, as a non-model microorganism isolated from the natural environment, *Brevibacillus laterosporus* M811 has relatively scarce genomic information and lacks a mature and efficient genetic manipulation tool system. This greatly limits its targeted metabolic modification to optimize bogorol production or endow it with other desirable traits, hindering its further development and large-scale application.

[0003] To achieve effective genetic modification of non-model microorganisms such as *Bacillus laterosporus* M811, establishing a stable, reliable, and efficient molecular genetic manipulation tool is a crucial prerequisite. In existing technologies, conventional genetic transformation methods (such as electroporation) and attempts to use various commercially available universal plasmids have failed to achieve ideal results in *Bacillus laterosporus* M811, with no single colonies growing on the plates after transformation. It is speculated that this may be due to *Bacillus laterosporus* M811 possessing strong mechanisms to defend against exogenous DNA invasion, such as efficient restriction-modification (RM) systems or CRISPR-Cas systems. These defense systems can recognize and degrade exogenous double-stranded DNA plasmids introduced into the cells via electroporation, leading to transformation failure or plasmid loss.

[0004] As a non-model chassis microorganism, *Bacillus laterosporus* M811 currently lacks a suitable plasmid replicon for stable plasmid replication. Furthermore, the suitability and expression efficiency of this strain with commonly used promoter elements are unclear, requiring further screening and validation. These factors limit its potential for development as an engineered strain.

[0005] Therefore, there is an urgent need to develop novel genetic manipulation strategies and tools to circumvent or overcome the defense system of the non-model microorganism Bacillus lateralis M811 and ensure that exogenous genes can be stably maintained and effectively expressed in the host, thereby providing technical support for the discovery and utilization of such microbial resources with important application value. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a novel plasmid vector that can stably maintain and achieve efficient gene expression in the non-model microorganism Bacillus lateralis M811, as well as its construction method and application.

[0007] To solve the above-mentioned technical problems, the present invention proposes the following technical solution:

[0008] This invention provides a backbone plasmid pTAE, with the DNA sequence shown in SEQ No. 1. The leader region of the plasmid contains the DNA sequence of the toxin-antitoxin system gene cassette shown in SEQ No. 2. This leader region first enters the recipient cell and initiates expression, producing toxin and antitoxin proteins to maintain temporary homeostasis within the cell. When the complete plasmid replicates into double-stranded DNA within the recipient cell, although it may become a target of the host defense system, if intracellular TA degrades the plasmid, the relatively unstable antitoxin will be degraded or diluted faster than the stable toxin, and the excess free toxin will kill the host cell. If the plasmid remains stable, it can continuously express antitoxin to neutralize the toxin, allowing the host cell to survive. The presence of the toxin-antitoxin system gene cassette creates strong positive selection pressure, ensuring that the plasmid can be stably maintained in the host cell after successful transformation.

[0009] This invention provides a pTAEP2 plasmid, the DNA sequence of which is shown in SEQ No. 3. The leader region of the plasmid contains a toxin-antitoxin system gene cassette as shown in SEQ No. 2, and the upstream of the multiple cloning region contains a P2 promoter, the sequence of which is shown in SEQ No. 4. This plasmid, based on the pTAE backbone plasmid, adds an open reading frame for expressing the target gene. The upstream of the multiple cloning region is the P2 promoter, which exhibits significant initiation activity in *Bacillus laterosporus* M811 and can effectively drive the expression of downstream genes.

[0010] Furthermore, the replicons of the above plasmids are ColE1 and RepF.

[0011] Furthermore, the plasmid contains ampicillin (Amp) and erythromycin (Erm) resistance genes.

[0012] Furthermore, the plasmid contains a TraJ element, the sequence of which is shown in SEQ No. 5. The TraJ element enables the plasmid to be efficiently introduced into non-model microbial hosts, including Bacillus laterosporus M811, via conjugation transfer.

[0013] This invention also provides a method for expressing a target gene in non-model microorganisms, comprising the following steps:

[0014] Step 1: Insert the target gene into the multiple cloning region of the pTAEP2 plasmid by PCR or enzyme digestion subcloning.

[0015] Step 2: Transform the donor bacteria with the pTAEP2 plasmid containing the target gene;

[0016] Step 3: Inoculate the donor bacteria, the binding transfer helper bacteria HB101, and the recipient bacteria (non-model microorganism) into the optimal culture medium and temperature containing the corresponding antibiotics for expansion culture. Mix the donor bacteria: helper bacteria: recipient bacteria in a volume ratio of 2:2:0.5 and wash off the antibiotics. Finally, resuspend in 300 μl of NB blank medium.

[0017] Step 4: Take 300 μl of the mixture of the above three bacterial cells and drop it onto a sterile filter membrane (0.22 μm pore size). Place the filter membrane on an antibiotic-free solid culture medium in advance and incubate overnight at 33°C. Collect the filter membrane containing bacterial cells into a 15 ml centrifuge tube, add NB liquid culture medium, vortex to collect bacterial cells, spread on Erm antibiotic plates, and incubate at 33°C for about 2 days to grow single colonies.

[0018] Step 5: Pick a single colony, expand the culture, extract plasmids, and use PCR to identify the expression of the target gene.

[0019] Furthermore, the optimal usage conditions for each strain after the expansion culture in step 3 of the above method are as follows: the OD600 value of the donor and auxiliary bacteria is 0.5, and the OD600 value of the recipient bacteria is 0.7.

[0020] Furthermore, the non-model microorganisms in the above methods include, but are not limited to, Bacillus laterosporus M811.

[0021] The beneficial effects of this invention are as follows:

[0022] 1. This invention successfully constructed a pTAE plasmid backbone carrying a "toxin-antitoxin" system gene cassette. By differentiating the expression of toxin and antitoxin proteins, positive pressure screening of positive clones is achieved, ensuring that the plasmid can stably exist in the successfully transformed host cells. Based on this backbone plasmid, different open reading frames can be designed to construct target gene expression cassettes with different promoters.

[0023] 2. This invention successfully constructed a novel expression vector, pTAEP2, suitable for the non-model microorganism *Bacillus laterosporus* M811. Through a unique TA system design and conjugation transfer strategy, this vector effectively overcomes the limitations imposed by the host defense system on exogenous DNA, achieving stable maintenance of the plasmid in *Bacillus laterosporus* M811. Simultaneously, it integrates the highly active P2 promoter in *Bacillus laterosporus* M811, ensuring efficient expression of the target gene. The genetic manipulation tool pTAEP2 not only solves the technical bottleneck in the stable introduction and expression of exogenous DNA in the non-model microorganism *Bacillus laterosporus* M811, but also provides a generalized solution for other difficult-to-transform industrial microorganisms. This technological system has significant theoretical and practical value for expanding the genetic engineering toolbox for non-model microorganisms and promoting the diversified development of biomanufacturing.

[0024] 3. This invention provides a method for expressing target genes in non-model microorganisms. It employs a conjugation transfer strategy to circumvent the host's defense system's degradation of the introduced DNA in the early stages. Using conjugation transfer as the DNA introduction method, the donor bacterium first transfers single-stranded DNA (ssDNA) to the recipient bacterium, aiming to reduce the risk of immediate degradation of the exogenous DNA by the bacterial defense system, which primarily recognizes and degrades double-stranded DNA (dsDNA), in the early stages of entry into the recipient cell. This method enables stable and efficient expression of the target gene in *Bacillus laterosporus* M811, a strain with significant industrial application potential. It expands the genetic manipulation toolbox of non-model microorganisms and provides an important strategic reference and technical platform for developing other non-model industrial microorganisms that are difficult to genetically modify. This has significant theoretical and practical value for promoting the diversified development of synthetic biology and biomanufacturing industries.

[0025] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments. Attached Figure Description

[0026] Figure 1 The plasmid maps of pTAEP2, pTAEP2gfp, and pBL9 are shown in Example 1.

[0027] Figure 2 This is a flowchart of the construction of different plasmids in Example 1.

[0028] Figure 3 This is a plate of Bacillus lateralis M811 after transformation with pTAEP2gfp and pBL9 plasmids in Example 2.

[0029] Figure 4 This is a gel electrophoresis image of the colony PCR in Example 3.

[0030] Figure 5 The green fluorescence intensity is shown for the positive strain in Example 4.

[0031] Figure 6 The green fluorescence phenomenon is observed in the positive strain in Example 4. Detailed Implementation

[0032] The following experimental examples are further illustrative of the present invention and are not intended to limit the invention. Specific experimental conditions and methods are not specified in the following examples. Experimental methods not specified in the following examples are performed according to conventional methods and conditions, or as selected according to the product instructions. In this patent, "h" represents hours and "min" represents minutes.

[0033] In this invention, all the materials and reagents described are commonly used in the field and can be obtained through conventional commercial channels.

[0034] NB liquid medium: 10.0g tryptone, 3.0g yeast extract, 5.0g sodium chloride, and double-distilled water are thoroughly mixed and brought to a final volume of 1L with double-distilled water. The medium is then autoclaved at 121℃ for 20min. The agar powder concentration of the solid medium is 2%.

[0035] LB liquid medium: 10.0g peptone, 5.0g yeast extract, 10.0g sodium chloride and double-distilled water are thoroughly mixed and brought to a final volume of 1L with double-distilled water. Sterilize at 121℃ for 20min. The agar powder concentration of the solid medium is 1.5%.

[0036] Erythromycin: Erm, Ampicillin: Amp.

[0037] Bacillus laterosporus M811 was isolated and preserved by the Antimicrobial Peptide Laboratory of the Institute of Nutrition and Feed Research, Chongqing Academy of Animal Sciences, and deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC-M2024715. It is available to the public from the Chongqing Academy of Animal Sciences.

[0038] Shuttle carriers pTAEP2, pTAEP2gfp and pBL9 (see structural diagram) Figure 1 The pBL9 plasmid is available to the public from the Chongqing Academy of Animal Sciences.

[0039] Example 1 Plasmid Construction

[0040] We amplified the "toxin-antitoxin" system gene cassette sequence from bacteria ATCC31805 (SEQ No. 2). We assembled the amplified "toxin-antitoxin" system gene cassette with the pBL9 plasmid backbone to form a novel backbone plasmid: pTAE (SEQ No. 1). Then, we assembled the P2-promoted green fluorescent protein expression cassette gene: P2gfp, onto the pTAE backbone to construct the novel expression plasmid pTAEP2gfp (Figure 1). To screen for promoters with good activity, we also constructed the pTAEPidR2gfp and pTAEPJ23119gfp plasmids, which use PidR2 and PJ23119 to promote gfp expression. Plasmid construction was completed in previous experiments; the overall workflow is described in [link to workflow]. Figure 2 .

[0041] Example 2: Transformation with different plasmids

[0042] The transformation is performed using a conjugation transfer method, and the specific steps are as follows:

[0043] First, plasmids pTAEP2gfp, pTAEPidR2gfp, pTAEPJ23119gfp, and pBL9 were transformed into *E. coli* MC1061 donor bacteria. The donor bacteria containing the plasmids, the transfer helper bacteria HB101, and the recipient bacteria *Bacillus laterosporus* M811 were inoculated overnight in optimal medium and temperature containing the corresponding antibiotics. The recipient bacteria were cultured in NB medium without antibiotics, the donor bacteria in LB medium containing 100 μg / mL Amp, and the helper bacteria HB101 in NB medium containing 50 μg / mL Kana. The next day, the donor bacteria were inoculated at 3% in 5 ml of LB medium, and the helper bacteria and recipient bacteria were inoculated at 5% and 8% in 30 ml of NB medium for expansion culture. The optimal conditions were an OD600 value of 0.5 for the donor and helper bacteria, and an OD600 value of 0.7 for the recipient bacteria. The conversion efficiency of conjugation transfer = number of conjugates / total number of donor bacteria. When OD600 = 0.5, 2 ml of donor bacteria will have a conversion efficiency of approximately 5 × 10⁻⁶. 8 Transformation of donor bacteria. A mixture of donor bacteria:helper bacteria:recipient bacteria at a volume ratio of 2 ml:2 ml:0.5 ml was prepared and antibiotics were washed off. The mixture was then resuspended in 300 μl of NB blank medium. 300 μl of the above three bacterial cultures were dropped onto a UV-sterilized filter membrane (0.22 μm pore size). The filter membrane was pre-placed on antibiotic-free NB solid medium and incubated overnight at 33°C. The next day, the filter membrane containing the bacterial cultures was collected into a 15 ml centrifuge tube, NB liquid medium was added, and the cultures were vortexed to collect the cultures. The cultures were then plated onto 2.5 μg / mL Erm antibiotic plates and incubated at 33°C for approximately 32-48 hours until identifiable single colonies appeared. Figure 3Among the various transformations, the conventional plasmid pBL9 failed to transform *Bacillus laterosporus* M811, with no single colonies observed on the plate 48 hours after transfection, indicating a transformation rate of almost 0%. pTAEP2gfp, pTAEPidR2gfp, and pTAEPJ23119gfp, however, produced numerous single colonies on the plates after transformation, demonstrating good transformation efficiency of 2.5–3 × 10⁻⁶. −7 (i.e., every 10) 8 The donor bacteria produce 25-30 conjugates, 1.8-2 × 10⁻⁶. −7 (i.e., every 10) 8 The donor bacteria produce 18-20 conjugates, 2.3-2.6 × 10⁻⁶. −7 (i.e., every 10) 8 The donor bacteria produced 23-26 conjugates. Results showed that *Bacillus laterosporus* M811 could not be successfully transformed using existing conventional plasmids. However, when using the pTAE backbone vector of this patent, not only was transformation successful, but colonies also appeared earlier, with positive colonies observed within 32 hours, achieving a transformation efficiency of 1.8-3 × 10⁻⁶. −7 (i.e., every 10) 8 The donor bacteria produce 18-30 conjugates, resulting in good transformation efficiency.

[0044] Example 3: Testing after plasmid transformation

[0045] From the plate in Case Study 2, we randomly selected 8 single colonies from one plate for PCR identification. The specific procedure is as follows:

[0046] Non-model microorganisms generally have thicker cell walls, therefore, a boiling water bath for 15 minutes is necessary before colony PCR. PCR identification mainly uses *Bacillus laterosporus* M811-specific primers (M811-F: GATGCTTTCCGTATCCGAATAGCTC and M811-R: CGCAGGATTTCATGTTCCTCGAAC) for strain identification. No band indicates contamination; a 691 bp band indicates *Bacillus laterosporus* M811. TraJ (Plasmid RP4 relaxosome protein) primers (traJ-F: GCCTTCCAGACGAACGAAGA, traJ-R: TAGTGCTTTACGGCACCTCG) are used to determine if the plasmid has successfully transferred into the host. A 229 bp band indicates successful plasmid transfer into the bacteria. Gel results are shown below. Figure 4As shown, the plasmids pTAEP2gfp, pTAEPidR2gfp, and pTAEPJ23119gfp were all transformed into Bacillus lateralis M811. The results were as expected, with all 8 colonies being positive transformants, and the yield was 100%.

[0047] Example 4: Detection of Plasmid Fluorescent Expression

[0048] We randomly selected three single colonies from the plate in Case Study 2 for green fluorescence testing. The specific procedure is as follows:

[0049] Positive transformants of *Bacillus laterosporus* M811 strain were picked from the plate and inoculated into NB+Cm medium. The culture was incubated at 33 ℃ and 222 rpm in a plate shaker until OD600 = 1. 1 mL of the bacterial suspension was centrifuged to collect the cells, washed three times with 0.1 M phosphate-buffered saline (PBS, pH 7.4), and resuspended in 1 mL PBS. 200 μL of the bacterial suspension was transferred to an ELISA plate, and fluorescence intensity was detected using a fluorescence microscopy (excitation wavelength 485 nm, emission wavelength 528 nm). For strains with significant fluorescence signals, their fluorescence expression was further observed using an inverted fluorescence microscope. The results showed that pTAEP2gfp, pTAEPidR2gfp, and pTAEPJ23119gfp all exhibited strong fluorescence signals in *Bacillus laterosporus* M811. Figure 5 ), and obvious green fluorescence was observed under the inverted fluorescence microscope ( Figure 6 Among them, J23119 is a commercially available bacterial constitutive promoter, PidR2 is a repressive promoter derived from the P43 promoter, and P2 is a constitutive promoter. In terms of fluorescence intensity, the pTAEPidR2gfp group is significantly higher than the pTAEP2gfp and pTAEPJ23119gfp groups, indicating that the P2 promoter has extremely strong activity in promoting the expression of the target gene, which is superior to the existing J23119 and PidR2 promoters.

[0050] Besides Bacillus laterosporus M811, this transformation method can also be used to achieve efficient transformation of plasmids and stable expression of target proteins in other non-model bacteria (such as Paenibacillus elgii Z121, non-model Streptococcus spp., Clostridium spp., and Brevibacillus laterosporus Q115).

[0051] In summary, the backbone plasmid pTAE of this invention can be used for transformation of non-model *Bacillus laterosporus* M811, achieving high transformation efficiency and plasmid stability in host cells through positive pressure selection of positive clones. The P2 promoter of the overexpression vector pTAEP2 exhibits excellent initiation activity in *Bacillus laterosporus* M811, enabling efficient and stable expression of the GFP gene in the multiple cloning region. Using the expression vector of this invention allows for transformation and target gene expression in non-model microorganisms, helping to solve the problem of difficult metabolic modification of industrial production strains.

Claims

1. A backbone plasmid pTAE, characterized in that: The DNA sequence is shown in SEQ No. 1, and the leader region of the plasmid contains a toxin-antitoxin system gene cassette, the sequence of which is shown in SEQ No.

2.

2. A pTAEP2 plasmid containing the pTAE plasmid of claim 1, characterized in that: The DNA sequence is shown in SEQ No.

3. The leader region of the plasmid contains a toxin-antitoxin system gene cassette, the sequence of which is shown in SEQ No.

2. The upstream region of the multiple cloning region contains a P2 promoter, the sequence of which is shown in SEQ No.

4.

3. The pTAEP2 plasmid as described in claim 2, further characterized in that: The plasmid's replicons are ColE1 and RepF.

4. The pTAEP2 plasmid as described in claim 3, further characterized in that: It contains resistance genes for ampicillin (Amp) and erythromycin (Erm).

5. The pTAEP2 plasmid as described in claim 4, further characterized in that: It contains the TraJ element, with the sequence shown in SEQ No.

5.

6. A method for expressing a target gene in a non-model microorganism, comprising the following steps: Step 1: Insert the target gene into the multiple cloning region of the pTAEP2 plasmid described in claim 5 by means of PCR or enzyme digestion subcloning. Step 2: Transform the donor bacteria with the pTAEP2 plasmid containing the target gene; Step 3: Inoculate the donor bacteria, the binding transfer helper bacteria HB101, and the recipient bacteria (non-model microorganism) into the optimal culture medium and temperature containing the corresponding antibiotics for expansion culture. Mix the donor bacteria: helper bacteria: recipient bacteria in a volume ratio of 2:2:0.5 and wash off the antibiotics. Finally, resuspend in 300 μl of NB blank medium. Step 4: Take 300 μl of the mixture of the above three bacterial cells and drop it onto a sterile filter membrane (0.22 μm pore size). Place the filter membrane on antibiotic-free solid culture medium in advance and incubate overnight at 33°C. Collect the filter membrane containing bacterial cells into a 15 ml centrifuge tube, add NB liquid culture medium, vortex to collect bacterial cells, spread on Erm antibiotic plates, and incubate at 33°C for 32-48 h to grow single colonies. Step 5: Pick a single colony, expand the culture, extract plasmids, and use PCR to identify the expression of the target gene.

7. The method as described in claim 6, further characterized in that: After step 3, the optimal usage conditions for each strain after expansion culture are: OD600 value of donor and auxiliary bacteria is 0.5, and OD600 value of recipient bacteria is 0.

7.

8. The method as described in claim 6 or 7, further characterized in that: Non-model microorganisms include, but are not limited to, Brevibacillus laterosporus M811.

Images