Design method and application of pig chromosome telomere centromere probe
By designing a porcine chromosome terminal centromere probe and combining it with fluorescence in situ hybridization technology, the problem of insufficient sensitivity and accuracy in porcine chromosome detection in existing technologies has been solved, enabling efficient detection of porcine chromosome rearrangements and translocations, and supporting the improvement of porcine genetic breeding and reproductive performance.
Patent Information
- Application Number
- CN202511030863.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-25
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2045-07-25
AI Technical Summary
The lack of mature design methods for porcine chromosome telomere probes in current technologies leads to insufficient sensitivity and accuracy in detecting porcine chromosome rearrangements and translocations, making it difficult to identify minute variations and affecting the reproductive performance and growth and development of pigs.
A probe for detecting porcine chromosome terminal centromeres was designed. Highly specific nucleotide sequences were screened using bioinformatics methods, and combined with fluorescence in situ hybridization (FISH) technology to prepare a kit for detecting porcine chromosome terminal centromeres, which can be used for chromosome detection in porcine cells.
It improves the accuracy and sensitivity of detecting pig chromosome rearrangements and translocations, and can clearly identify the position and structural changes of chromosome terminal centromeres, providing a method for in-depth research on the evolution and genetic relationships of pig chromosomes.
Smart Images

Figure CN120866534B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology, and in particular to a design method and application of a porcine chromosome terminal centromere probe. Background Technology
[0002] As one of the most important livestock species, improving the genetic breeding and reproductive performance of pigs has always been a key research focus in the field of animal husbandry science. Chromosomes are the carriers of genetic material, and the stability of their structure and number is crucial for maintaining the genetic stability of a species. However, under the influence of natural or human factors, pig chromosomes may undergo structural variations such as rearrangements and translocations. The mechanisms of chromosomal rearrangements and translocations are complex, mainly related to DNA double-strand breaks and repair processes. When DNA is damaged and double-strand breaks occur, the cell initiates DNA repair mechanisms. If errors occur in the repair process, it can lead to abnormal rejoining of chromosome segments, thereby triggering chromosomal rearrangements and translocations. In addition, nondisjunction and abnormal crossing over during meiosis can also lead to these structural variations. Chromosomal rearrangements during the long-term evolution of different pig breeds can reflect the history of speciation and may be able to determine phylogenetic relationships, reconstruct ancestral karyotypes, and identify the mechanisms of genome evolution and function.
[0003] Chromosomal rearrangements and translocations can affect germ cell formation and embryonic development in pigs. For example, translocations can cause abnormal chromosome pairing during meiosis, resulting in unbalanced gametes. Fertilization of these unbalanced gametes can lead to embryonic death, abortion, or fetal malformations, reducing reproductive efficiency in pigs. Furthermore, certain chromosomal rearrangements and translocations can affect gene expression and regulation, thus impacting growth, development, and phenotypic traits in pigs.
[0004] Traditional methods for detecting chromosomal rearrangements and translocations in pigs mainly include chromosome karyotype analysis and G-banding techniques. Chromosome karyotype analysis, by observing the morphology, number, and structure of chromosomes, provides a preliminary assessment of the presence of chromosomal abnormalities, but cannot identify which chromosome is affected. G-banding techniques can further visualize the banding characteristics of chromosomes, improving the accuracy of chromosomal structural variation detection. However, these methods have relatively low resolution and may be difficult to detect some minute chromosomal rearrangements and translocations. Centromeres are special regions on chromosomes, mainly composed of repetitive DNA sequences and related proteins. They play a crucial role in chromosome segregation, binding to spindle microtubules to ensure accurate distribution of chromosomes to daughter cells during mitosis and meiosis. Studies have shown that centromere sequences exhibit a certain degree of conservation and variability during species evolution. In translocated chromosomes, the position of the centromere may change, and by comparing the differences and similarities in centromere sequences among different pig breeds or closely related species, a deeper understanding of the evolutionary history and genetic relationships of pig chromosomes can be gained.
[0005] With the development of molecular biology techniques, technologies such as fluorescence in situ hybridization (FISH) have been gradually applied to the detection of structural variations in pig chromosomes, greatly improving the sensitivity and accuracy of detection. However, currently, there is no mature method for designing centromere probes for pigs, nor is there a FISH-based probe for detecting porcine telomere chromosomes. Summary of the Invention
[0006] The purpose of this invention is to provide a design method and application of a porcine chromosome centromere probe to solve the problems existing in the prior art. The design method of the porcine chromosome centromere probe provided by this invention can be applied to the design of most probes, and it has good specificity, good hybridization effect and high detection accuracy.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] The present invention provides a porcine chromosome terminal centromere probe, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0009] The present invention also provides a fluorescence in situ hybridization kit for detecting porcine chromosome telomere, comprising the porcine chromosome telomere probe as described in claim 1.
[0010] Preferably, the fluorescence in situ hybridization kit further includes RNase working solution, 0.1% NP-40, 0.5% Triton X-100, denaturing solution, and hybridization solution;
[0011] And / or the denaturing solution is 70% deionized formamide, 20% ddH2O and 10% 20×SSC;
[0012] And / or the hybridization solution is prepared by mixing 10% dextran sulfate, deionized formyl, Tween-20 and ddH2O in a mass ratio of 1:5:0.01:3.99.
[0013] The present invention also provides the application of the porcine chromosome terminal centromere probe in the preparation of a kit for detecting porcine chromosome terminal centromeres.
[0014] The present invention also provides the application of the porcine chromosome terminal centromere probe in the preparation of a kit for detecting the terminal centromeres of chromosomes in porcine primary small intestinal epithelial cells and porcine kidney cell lines.
[0015] The present invention also provides the application of the porcine chromosome terminal centromere probe in the preparation of a kit for detecting porcine chromosome rearrangement and translocation.
[0016] Preferably, based on fluorescence in situ hybridization, the porcine chromosome terminal centromere probe can specifically bind to the target region of the porcine chromosome terminal centromere, and accurately identify the position and structural changes of different chromosome terminal centromeres through fluorescence.
[0017] The present invention also provides a method for designing the porcine chromosome terminal centromere probe, comprising the following steps:
[0018] Based on the specific sequence regions of the centromeres of porcine chromosomes 13-18, candidate probe sequences with a length of 30-37 nucleotides were screened, and the candidate probe sequences were compared and analyzed using rmblast software.
[0019] The makeblastdb command was used to create a library of the pig reference genome Sscrofa11.1 to build a local genome database.
[0020] The blastn command was used to select candidate probe sequences as query files and compare them with the constructed local genome database. Sequences with a length of ≥25 nt were screened, and the number of repetitions of each candidate probe sequence on each chromosome of the pig was counted.
[0021] By comprehensively analyzing the repetition counts of each candidate probe sequence on different chromosomes, sequences with high repetition counts and strong specificity were selected, and finally, the nucleonucleotide probe sequence for detecting porcine chromosome terminal centromeres was determined.
[0022] The present invention also provides a method for performing in vitro chromosome fluorescence in situ hybridization on porcine cells for non-diagnostic purposes, comprising inducing metaphase of chromosomes in cultured porcine cells with colchicine, and then performing a hybridization reaction by mixing the porcine chromosome terminal centromere probe with a hybridization solution to detect the terminal centromere region of the porcine cells.
[0023] Preferably, the porcine chromosome terminal centromere probe is mixed with the hybridization solution at a volume ratio of 1:(30-40), and then heated at 80°C for 20 min in the dark, followed by transfer to ice and standing for 5-10 min.
[0024] The hybridization solution was prepared by mixing 10% dextran sulfate, deionized formyl, Tween-20 and ddH2O in a mass ratio of 1:5:0.01:3.99.
[0025] The hybridization reaction was carried out at 30°C for 20 hours.
[0026] The present invention discloses the following technical effects:
[0027] (1) This invention utilizes bioinformatics methods to design probes based on the centromere region of pig chromosomes to identify pig terminal centromeres. It also obtains the copy number of the repetitive sequence in the genome, increasing the intensity of the probe hybridization signal. Furthermore, it allows for the determination of the location of each selected probe in other chromosomal regions, improving the accuracy of the detection results. In existing studies, the denaturation temperature and hybridization time after cell smear preparation were insufficient, making it difficult for the probes to hybridize with the target DNA region. This invention improves upon existing research by modifying the fluorescence in situ hybridization method to suit hybridization methods for pig chromosome centromere probes.
[0028] (2) The porcine chromosome telomere probe designed in this invention has the nucleotide sequence shown in SEQ ID NO.1. It has a stable effect and can cover all telomeres including chromosomes 13, 14, 15, 16, 17 and 18, with high specificity.
[0029] (3) The centromere sequence probe designed in this invention can specifically bind to the centromere region on pig chromosomes, allowing for clear observation of the centromere position under a microscope. This enables accurate identification of different chromosomes and detection of centromere position and structural changes during pig chromosome rearrangement and translocation. These variations not only affect the phenotypic characteristics of pigs but may also adversely affect reproductive performance, such as causing embryonic death and abortion. This invention provides a new perspective and method for in-depth research on pig chromosome rearrangement and translocation. Attached Figure Description
[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0031] Figure 1Sequence analysis was performed on the start region (400kb-406kb) of chromosome 13;
[0032] Figure 2 The result is the alignment of the 336bp repeat unit sequence with the 6kb sequence of the start region of chromosome 13;
[0033] Figure 3 The results of self-alignment analysis of the 336bp sequence;
[0034] Figure 4 Candidate sequences for screening;
[0035] Figure 5 The number of times each candidate sequence is repeated on each chromosome (chr1-chr18, chrX, chrY) in pigs;
[0036] Figure 6 This shows the results of the probe copy number alignment across the entire genome;
[0037] Figure 7 The results show the identification of the telomere region of chromosomes in porcine kidney cells; A: DAPI staining results (blue); B: Telomere probe staining results (green); C: Merge results;
[0038] Figure 8 The results show the identification of the terminal centromere regions of chromosomes in primary porcine small intestinal epithelial cells; A: DAPI staining results (blue); B: Terminal centromere probe staining results (green); C: Merge results. Detailed Implementation
[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0040] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0044] Example 1
[0045] 1. Design and synthesis of porcine centromere chromosome probes
[0046] (1) Design of telomere chromosome probes
[0047] Based on the specific sequence regions of the telomeres of each pig chromosome, probes were designed using PaintSHOP software (version 1.3) and used to identify the telomeres of pig chromosomes through bioinformatics analysis and fluorescence in situ hybridization.
[0048] The input files are a gene sequence file (.fasta format) and a gene annotation file (.gtf format) of the centromere region of a porcine chromosome. PaintSHOP software automatically filters candidate probe sequences of 30-37 nucleotides (nt) in length based on the input sequence files. These candidate sequences have high tandem repeatability and are suitable as probe candidates.
[0049] The `makeblastdb` command was used to construct a library from the pig reference genome Sus scrofa11.1, building a local genome database. Candidate probe sequences were used as query files via the `blastn` command, and alignment analysis was performed using the `rmblast` software (version 2.14.1). The alignment was compared with the pig reference genome database. During alignment, the output format was specified as tabular (`-outfmt 6`), and the task type was set to `blastn-short` to accommodate shorter query sequences.
[0050] In the alignment results, sequences with an alignment length ≥25 nt were selected, and the repetition count of each candidate sequence on each pig chromosome (chr1-chr18, chrX, chrY) was counted. By comprehensively analyzing the repetition count of each candidate probe sequence on different chromosomes, sequences with high repetition counts and strong specificity were selected, and finally, the nucleotide probe sequence used to detect pig chromosome centromeres was determined.
[0051] (2) Synthesis method of chromosome centromere probe
[0052] Primer sequences were designed based on the obtained porcine chromosome centromere oligonucleotide probe sequence, and DNA was synthesized using the solid-phase phosphoramidite method. The process involved: 1) Synthesizing the desired DNA strand through deprotection, coupling, capping, and oxidation reactions; 2) Removing the protecting group from the last nucleotide at the 5' end of the DNA strand by chemically reacting 488FITC fluorescent modification reagent with the exposed 5'-hydroxyl group; 3) Cleavage and deprotection of the DNA strand using ammonia to obtain a complete, unprotected DNA probe; 4) Injecting the DNA probe solution into an HPLC system, selecting a suitable column and mobile phase to separate the DNA probe from impurities. Concentration was achieved through rotary evaporation and ultrafiltration, followed by vacuum drying to obtain a dry DNA probe powder. This powder was diluted with water to a concentration of 100 μM and stored at -20°C.
[0053] 2. Chromosome centromere probe hybridization pre-preparation reagent
[0054] (1) RNase working solution: RNase (10mg / mL) and TBS are mixed at a volume ratio of 1:100 to prepare the working solution;
[0055] (2) 0.1% NP-40: Prepare a reagent with a final concentration of 0.1% NP-40 / 2×SSC using 20×SSC, 10% NP-40 and ddH2O;
[0056] (3) Permeation solution: Prepared using Triton X-100, 10×PBS and ddH2O to a final concentration of 0.5% Triton X-100 / 1×PBS;
[0057] (4) Denaturing solution: Prepare a denaturing solution containing 70% deionized formamide, 20% ddH2O and 10% 20×SSC;
[0058] (5) Hybridization solution: Prepared using 10% sulfated dextran, deionized formyl, Tween-20 and ddH2O in a mass ratio of 1:5:0.01:3.99.
[0059] 3. Cell arrest of metaphase of chromosomes
[0060] (1) Cell culture and arrest phase: Resuscitated porcine primary small intestinal epithelial cells were cultured overnight in an incubator. When the cells grew to 70-80%, colchicine was added to the cell culture medium to a final concentration of 1 μg / mL and cultured for another 6 hours.
[0061] (2) Hypotonic treatment: The collected samples were digested with 0.25% trypsin and centrifuged at 1000 rpm for 5 min; 10 mL of hypotonic solution (0.075 M KCl solution) was added to each tube of cells and the cells were incubated in a water bath at 37°C for 40 min.
[0062] (3) Fixation: Add 1 mL of pre-cooled fixative (methanol: glacial acetic acid = 3:1, v / v) to the cell suspension after hypotonicity to pre-fix the cells. After slowly pipetting up and down 10 times, centrifuge at 1000 rpm for 5 min. Discard the supernatant and keep the precipitate. Slowly add 5 mL of pre-cooled fixative, fix at 4℃ for 30 min, centrifuge at 1000 rpm for 5 min, and repeat the steps twice.
[0063] (4) Slide preparation: Discard the supernatant after fixation, add an appropriate amount of fresh fixative to resuspend the cells according to the number of cells; take 20 μL of cell suspension and drop it from 50 cm onto a pre-cooled adhesive slide; bake the slide at 75°C for 3 h, and store at -20°C for later use.
[0064] 4. Centromere probe-based fluorescence in situ hybridization assay
[0065] (1) RNase treatment: Add 20-40 μL of RNase working solution to each slide and incubate at 37°C for 1 h; wash once with 2×SSC for 5 min;
[0066] (2) Aging and permeabilization: The sections were immersed in 0.1% NP-40 reagent for 30 min, then incubated in 0.5% Triton X-100 for 30 min. The permeabilization solution was discarded, and the sections were washed three times with 1×PBS for 5 min each time. Subsequently, they were dehydrated in a gradient of 70%, 80%, 90%, and 100% ethanol for 5 min at each gradient.
[0067] (3) Denaturation and hybridization: Add 40 μL of denaturing solution to each slide, cover with hybridization membrane and place in a humidified chamber; prepare hybridization reaction solution by mixing 100 μM probe with hybridization solution at a volume ratio of 1:39, mix thoroughly, and place the slide and hybridization reaction solution in the dark at 80℃ for 20 min for heat denaturation; quickly transfer the hybridization reaction solution to ice and let stand for 5 min; dehydrate the slide sequentially by gradients of 70%, 80%, 90%, and 100% ethanol for 1 min at each gradient, air dry the slide, add 40 μL of hybridization reaction solution and cover with membrane, and hybridize at 30℃ for 20 h;
[0068] (4) Washing: Wash once with 2×SSC preheated at 53℃ for 5 min; wash once with 0.1% NP-40 preheated at 42℃ for 5 min; wash once with 2×SSC preheated at 42℃ for 5 min.
[0069] (5) DAPI staining and mounting: Add 40 μL of DAPI staining solution, stain for 10 min in the dark, wash twice with 1×PBS in the dark for 5 min each time; after drying, add 20 μL of anti-fluorescence quenching agent to mount the slide, and store at -20℃ in the dark.
[0070] 5. Results and Analysis
[0071] 5.1 Design and Synthesis of Porcine Terminal Chromosome Probes
[0072] (1) Centromere sequence region localization
[0073] Based on research literature on centromeres in humans and pigs, the centromere sequence of chromosomes may be composed of tandem repeat sequences. Furthermore, karyotype analysis indicates that pig chromosomes 13-18 are telocentric chromosomes. Therefore, this invention uses a designed telocentric probe to perform sequence analysis on the start region (400kb-406kb) of chromosome 13.
[0074] The segment was self-aligned using the nucmer command of MUMmer software (version 4.0.0), and the results showed that the region has significant repeating structural features. Figure 1 Further analysis revealed that the basic repeating unit in this region is 336 bp. To verify this finding, the 336 bp sequence was compared with the aforementioned 6 kb sequence, and the results showed that the 336 bp unit exhibits a typical tandem repeat pattern in the 6 kb sequence. Figure 2 ).
[0075] In addition, self-alignment analysis was performed on the 336bp sequence ( Figure 3 This confirms that the sequence is the smallest repeat unit. These results collectively support the conclusion that the 336bp tandem repeat sequence is the basic structural unit of the centromere region of porcine chromosome 13.
[0076] (2) Design of specific probes
[0077] Probes were designed using PaintSHOP software (version 1.3). The input files were a gene sequence file (.fasta format) and a gene annotation file (.gtf format) of the centromere region of chromosome 13 (336 bp). The software automatically screened candidate probe sequences with a length of 30 nucleotides (nt) based on the input sequence files. These candidate sequences ( Figure 4 It has high tandem repeatability and is suitable as a candidate probe.
[0078] The candidate probe sequences were aligned and analyzed using the rmblast software (version 2.14.1). The makeblastdb command was used to construct a local genome database from the pig reference genome Sscrofa11.1. The blastn command was used to align the candidate probe sequences as query files with the pig reference genome database. During alignment, the output format was specified as tabular (-outfmt 6), and the task type was set to blastn-short to accommodate shorter query sequences.
[0079] From the alignment results, sequences with an alignment length ≥25 nt were selected, and the repetition count of each candidate sequence on each chromosome (chr1-chr18, chrX, chrY) of the pig was counted. Figure 5 By comprehensively analyzing the repetition counts of various candidate probe sequences on different chromosomes, sequences with high repetition counts and strong specificity were screened out. The final sequence determined to be SEQ ID NO.1 (GCTGAGCTTGCTTTCCCGAGGAGAGTTTCC) for detecting porcine tricentric centromeres was determined. The copy number alignment results of this probe across the entire genome are as follows: Figure 6 As shown, the probe sequence can be successfully aligned to the 13th, 14th, 15th, 16th, 17th and 18th telomeres. In addition, it can also be aligned to chromosomes 1 and 3 of the genome. However, in the pig genome, chromosome 1 has the largest morphology and is easy to identify, and chromosome 3 has a very low copy number and is not easy to hybridize. Therefore, the probe can be synthesized for the next step of the experiment.
[0080] 5.2 Fluorescence in situ hybridization assay
[0081] Porcine kidney cell lines and primary porcine small intestinal epithelial cells were cultured. After inducing the metaphase of chromosomes with colchicine, the cells were subjected to hypotonic treatment, fixation, and slide preparation, and then dried in a 75°C oven. Working solutions were prepared using pre-designed telomere probe powder to detect the telomere regions in the cells. The hybridization procedure followed the above steps sequentially, including RNase treatment, aging, permeabilization, denaturation, and hybridization. After mounting, the slides were observed under a laser confocal microscope.
[0082] After labeling porcine kidney cells with telomere probes, obvious green fluorescent signals were found in the centromere regions of multiple terminal chromosomes. Figure 7However, this cell line, due to immortalization treatment, experienced chromosomal rearrangements, resulting in a discrepancy between the actual and actual chromosome numbers, potentially accompanied by centromere dysfunction. The probes of this invention, through the abnormal distribution of centromere signals, are the first to indicate the presence of high-frequency centromere-related break-fusion events in this cell line. Furthermore, by combining probe-based FISH after long-term passaging, it is possible to assess whether rearrangements accumulate with increasing passage numbers, revealing the driving factors of genomic instability in the cell line. The staining results of this cell line show good fluorescence hybridization, indicating that the probe hybridization method of this invention can be used for subsequent experiments.
[0083] Subsequently, this invention used primary porcine small intestinal epithelial cells for staining, and the results are as follows: Figure 8 As shown, the probe effectively labels all telomere chromosomes in primary porcine small intestinal epithelial cells, all exhibiting a distinct green fluorescent signal. Notably, a strong green fluorescent signal was also observed on chromosome 1. This phenomenon may be due to the presence of numerous repetitive sequences between the centromere region of chromosome 1 and the probe. Since chromosome 1 is the largest chromosome in the porcine genome due to its prominent morphology, it is easily identifiable, thus ensuring the specific labeling of all telomere chromosomes by the probe. In summary, the DNA probe of this invention can accurately detect porcine telomere chromosomes, and exhibits good fluorescence signal specificity and strong brightness.
[0084] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A probe for detecting porcine chromosome telomeres, characterized in that, The nucleotide sequence of the probe is shown in SEQ ID NO.
1.
2. A fluorescence in situ hybridization kit for detecting porcine chromosome telomeres, characterized in that, Includes the probe as described in claim 1.
3. The fluorescence in situ hybridization kit as described in claim 2, characterized in that, The fluorescence in situ hybridization kit also includes RNase working solution, 0.1% NP-40, 0.5% Triton X-100, denaturing solution, and hybridization solution; The denaturing solution is 70% deionized formamide, 20% ddH2O and 10% 20×SSC; The hybridization solution was prepared by mixing 10% dextran sulfate, deionized formyl, Tween-20 and ddH2O in a mass ratio of 1:5:0.01:3.
99.
4. The use of the probe as described in claim 1 in the preparation of a kit for detecting porcine chromosome centromeres.
5. The use of the probe as described in claim 1 in the preparation of a kit for detecting the terminal centromeres of chromosomes in porcine primary small intestinal epithelial cells and porcine kidney cell lines.
6. The application of the probe as described in claim 1 in the preparation of a kit for detecting porcine chromosomal rearrangements and translocations, characterized in that, The porcine chromosome rearrangements and translocations refer to the rearrangements and translocations of porcine chromosomes 13-18, and the application is for non-disease diagnostic purposes.
7. The application as described in any one of claims 4-6, characterized in that, Based on fluorescence in situ hybridization, the probe binds to the target region of the terminal centromere of pig chromosomes, and accurately identifies the position and structural changes of different terminal centromeres of chromosomes through fluorescence.
8. A method for in vitro chromosome fluorescence in situ hybridization on porcine cells for non-diagnostic purposes, characterized in that, The method includes inducing chromosome metaphase in cultured pig cells using colchicine, then performing a hybridization reaction using the probe described in claim 1 mixed with a hybridization solution, and detecting the telomere region in the pig cells.
9. The method as described in claim 8, characterized in that, The probe and hybridization solution were mixed at a volume ratio of 1:(30-40), and the mixture was placed in the dark at 80℃ for 20 min to denature it. Then, it was transferred to ice and allowed to stand for 5-10 min. The hybridization solution was prepared by mixing 10% dextran sulfate, deionized formyl, Tween-20 and ddH2O in a mass ratio of 1:5:0.01:3.
99. The hybridization reaction was carried out at 30°C for 20 hours.
Citation Information
Patent Citations
Method and system for multiplex profiling of chromosomes in biological samples using target-specific DNA probes
CN107709578A
Subtelomeric DNA probes and method of producing the same
US20040161773A1